The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483458	Haemophilus haemolyticus strain NCTC10839 chromosome 1	1934644	458293	519818	1934644	transposase,integrase,tRNA	Bacillus_phage(15.38%)	55	469690:469727	476534:476571
WP_111696174.1|458293_460183_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_111696175.1|460246_461059_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	2.0e-57
WP_111696176.1|461043_461397_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111696177.1|461490_461958_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_111696178.1|462064_463519_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_111696175.1|463575_464388_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	2.0e-57
WP_111696176.1|464372_464726_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111696179.1|464823_465615_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005629228.1|465780_466215_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_111696180.1|466214_467102_+	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	28.3	1.9e-16
WP_111696181.1|467138_469724_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.8	2.9e-33
469690:469727	attL	GGCGTATGTTGTTGGAAATTTTCTTCGGAAATCATCTA	NA	NA	NA	NA
WP_111696182.1|469908_471183_+|integrase	site-specific integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	26.6	5.4e-17
WP_111696183.1|471210_472644_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	36.5	4.2e-42
WP_111696184.1|472693_473086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032827201.1|473092_473608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696185.1|473716_474085_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145960440.1|474136_474601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696186.1|474568_474991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696187.1|475162_475411_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_111696188.1|475403_476426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696189.1|476701_477934_-|transposase	transposase	transposase	NA	NA	NA	NA
476534:476571	attR	GGCGTATGTTGTTGGAAATTTTCTTCGGAAATCATCTA	NA	NA	NA	NA
WP_105899312.1|478017_479436_-	tryptophanase	NA	NA	NA	NA	NA
WP_111696190.1|479523_479604_-	tryptophanase leader peptide	NA	NA	NA	NA	NA
WP_111696191.1|479793_480387_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	58.0	1.8e-55
WP_111696192.1|480769_480943_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111696193.1|481041_481893_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009499663.1|482059_482419_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105876747.1|482475_483087_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_105876746.1|483206_483581_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_005629251.1|483608_484397_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_005629249.1|484452_484707_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_005649414.1|484756_485227_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_111696194.1|485239_485773_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_005629241.1|485785_487327_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_111696195.1|487342_488212_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_005629235.1|488228_489602_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_111696196.1|489632_490061_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_111696197.1|490105_490969_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_111696198.1|490987_492847_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	9.1e-13
WP_111696199.1|492843_494229_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_111696200.1|494495_494819_-	DUF4298 domain-containing protein	NA	NA	NA	NA	NA
WP_111696201.1|495105_498702_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_005635264.1|498929_499238_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111696202.1|499569_501228_-	thiol reductant ABC exporter subunit CydC	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	8.9e-20
WP_111696203.1|501220_502966_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	24.3	5.2e-10
WP_172454018.1|503230_506305_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_111696205.1|506409_509289_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005632254.1|509390_510671_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_111696206.1|510682_511981_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_005629395.1|511970_513662_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_005644150.1|513955_515398_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_111696207.1|515501_516596_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	33.9	6.1e-09
WP_005635291.1|516824_517619_+	aquaporin	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	31.9	4.4e-17
WP_005635293.1|517639_519151_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_111696208.1|519215_519818_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	60.1	6.4e-61
>prophage 2
NZ_LS483458	Haemophilus haemolyticus strain NCTC10839 chromosome 1	1934644	616869	679258	1934644	tRNA,tail,head,portal,protease,terminase	uncultured_Caudovirales_phage(33.33%)	51	NA	NA
WP_046939842.1|616869_617898_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	1.5e-110
WP_046942645.1|617906_618488_+	thymidine kinase	NA	M9UV85	Escherichia_phage	52.9	1.1e-52
WP_111696277.1|618524_619745_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_111696278.1|619831_620092_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.8	9.0e-20
WP_111696279.1|620169_620952_+	ribonuclease HI	NA	NA	NA	NA	NA
WP_065246783.1|621047_622208_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_111696280.1|622327_623407_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_111696281.1|623474_624515_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_111696282.1|624727_626272_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_111696283.1|626280_627069_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005633049.1|627170_628424_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_005643966.1|628493_629210_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005633053.1|629382_629811_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005649467.1|629815_630505_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_111696285.1|630887_634916_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	25.7	1.0e-21
WP_005633056.1|635041_639292_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	2.7e-68
WP_172454019.1|639486_640431_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_111696286.1|640482_641202_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_111696287.1|641263_642175_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_111696288.1|642226_642724_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_005643970.1|642878_644264_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005633078.1|644368_645217_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.0	4.0e-32
WP_111696289.1|645708_648480_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	35.0	1.8e-20
WP_111696290.1|648482_649142_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_111696291.1|649168_649747_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005643940.1|649776_650529_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111696292.1|650656_651409_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_111696293.1|651466_651856_+	RidA family protein	NA	NA	NA	NA	NA
WP_162837812.1|652021_652876_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032828119.1|652920_653160_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	66.7	4.7e-07
WP_005636109.1|653276_653897_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.0	1.3e-24
WP_111696294.1|653899_655363_+	potassium transporter	NA	NA	NA	NA	NA
WP_172454020.1|661397_662537_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_111696296.1|662546_663458_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_111696297.1|663487_664330_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_111696298.1|664329_665562_-	murein hydrolase activator EnvC	NA	A0A292GJG6	Xanthomonas_phage	40.2	3.4e-08
WP_005625827.1|665737_666421_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_111696299.1|666498_667101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005625828.1|667186_667399_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_111696300.1|667573_668710_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_005625838.1|668687_668960_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_111696301.1|668974_670051_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_111696302.1|672596_673163_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.6	4.3e-51
WP_111696303.1|673164_674397_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	63.3	1.7e-145
WP_005633854.1|674380_674725_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_111696304.1|674711_675020_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	49.0	1.3e-17
WP_111696305.1|675036_675399_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	55.4	4.6e-30
WP_005626376.1|675501_675876_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	64.9	1.7e-35
WP_111696306.1|675883_677551_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	70.0	7.1e-243
WP_111696307.1|677702_678146_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	49.0	3.5e-32
WP_111696308.1|678148_679258_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	28.0	1.4e-21
>prophage 3
NZ_LS483458	Haemophilus haemolyticus strain NCTC10839 chromosome 1	1934644	1319677	1381223	1934644	protease,transposase,tRNA	Vibrio_phage(13.33%)	60	NA	NA
WP_111697128.1|1319677_1319896_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_172454040.1|1319929_1320364_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	49.3	9.1e-33
WP_111696711.1|1320484_1322440_+	recombinase	NA	NA	NA	NA	NA
WP_111696712.1|1322483_1322600_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_111696713.1|1322654_1323602_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	29.1	4.4e-24
WP_111696714.1|1323601_1324783_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_172454072.1|1324804_1326094_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	3.8e-18
WP_111696716.1|1326102_1327245_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_111696717.1|1327254_1327902_+	DUF452 family protein	NA	NA	NA	NA	NA
WP_111696718.1|1327889_1328669_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_111696719.1|1328681_1329323_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_111696720.1|1329404_1330088_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.6	1.6e-36
WP_111696721.1|1330087_1331338_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_172454073.1|1331576_1332644_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A1Z1LYN9	Serratia_phage	45.2	1.9e-79
WP_009500595.1|1332713_1333154_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009500594.1|1333441_1334686_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_111696722.1|1334806_1335415_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_111696723.1|1335414_1335969_+	molecular chaperone	NA	NA	NA	NA	NA
WP_111696724.1|1336015_1336570_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_111696725.1|1336667_1338515_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_111696726.1|1338580_1340593_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_111696727.1|1340741_1341962_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_005628952.1|1342026_1342290_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	71.4	3.2e-25
WP_046942722.1|1342406_1343321_+	RimK family alpha-L-glutamate ligase	NA	A0A1D7SA11	Synechococcus_phage	34.0	1.7e-33
WP_080950181.1|1343565_1345719_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005633520.1|1345821_1346163_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_046942724.1|1346257_1347472_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_111696728.1|1347501_1349757_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.0	4.4e-86
WP_111696729.1|1349824_1351723_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.2	7.2e-98
WP_111696730.1|1351796_1352732_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	39.6	2.2e-52
WP_111696731.1|1352828_1354259_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.0	2.7e-33
WP_005628925.1|1354624_1354894_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_111696732.1|1355028_1356798_-	ABC transporter ATP-binding protein/permease	NA	A0A1V0SE00	Indivirus	23.2	1.4e-07
WP_111696733.1|1356863_1359071_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_111696734.1|1359257_1360697_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_005628917.1|1360860_1361337_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_111696735.1|1361375_1361675_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_005637911.1|1361801_1362431_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_111696736.1|1362520_1364413_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.5	8.4e-115
WP_111696737.1|1364536_1365364_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_111696738.1|1365401_1366736_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_111696739.1|1366795_1367293_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_111696740.1|1367513_1367981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005628902.1|1368056_1368323_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_005628900.1|1368424_1369153_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_111696741.1|1369238_1370120_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_005628896.1|1370430_1370859_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005631594.1|1370875_1371268_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_111696742.1|1371441_1372080_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_111696743.1|1372079_1372532_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	53.2	3.3e-25
WP_111696744.1|1372566_1374444_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_111696745.1|1374498_1375389_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_005628882.1|1375388_1375628_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_111696746.1|1375786_1377244_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_111696747.1|1377258_1377579_+	YqcC family protein	NA	NA	NA	NA	NA
WP_111696748.1|1377572_1378292_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_005628875.1|1378284_1378443_+	YoaH family protein	NA	NA	NA	NA	NA
WP_111696749.1|1378587_1378806_+	cold shock domain-containing protein CspD	NA	A0A2I7R0P9	Vibrio_phage	52.4	1.3e-11
WP_005628871.1|1378874_1379321_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_172454041.1|1379447_1381223_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 4
NZ_LS483458	Haemophilus haemolyticus strain NCTC10839 chromosome 1	1934644	1443241	1557161	1934644	tRNA,tail,holin,portal,protease,terminase,integrase	Mannheimia_phage(37.78%)	105	1431830:1431849	1502412:1502431
1431830:1431849	attL	TAATTAAAGTGCGGTCAAAA	NA	NA	NA	NA
WP_111696797.1|1443241_1443718_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_111696798.1|1443776_1444730_+	oxidoreductase	NA	NA	NA	NA	NA
WP_111696799.1|1444755_1445112_+	DsrE family protein	NA	NA	NA	NA	NA
WP_111696800.1|1446334_1448395_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	34.0	5.8e-85
WP_111696801.1|1448634_1449444_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_111407406.1|1449443_1450640_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_111696802.1|1450657_1451416_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_111696803.1|1451555_1452392_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_111696804.1|1452590_1453520_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_005634634.1|1453653_1454427_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_111696805.1|1454828_1455920_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	35.5	9.6e-55
WP_032827947.1|1456278_1456500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696806.1|1456695_1457184_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	37.1	2.0e-20
WP_032827949.1|1457219_1457585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696807.1|1457594_1457819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696808.1|1457818_1458469_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	70.6	9.0e-85
WP_111696809.1|1459403_1459697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696810.1|1459680_1459896_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111696811.1|1459895_1460195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696812.1|1460290_1460941_-	antA/AntB antirepressor family protein	NA	A0A0M3LQ72	Mannheimia_phage	62.7	9.4e-74
WP_165819731.1|1462472_1462640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696815.1|1462670_1463093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696816.1|1463104_1463587_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	41.3	2.0e-20
WP_111696817.1|1463600_1463855_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_111696818.1|1463928_1464594_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	52.4	9.7e-42
WP_005688828.1|1464693_1464933_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.2	7.0e-11
WP_111696819.1|1464987_1465428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696820.1|1466184_1466907_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	68.8	7.7e-61
WP_111696821.1|1466903_1467524_+	replication P	NA	A0A0M3LS65	Mannheimia_phage	38.5	2.2e-27
WP_111696822.1|1467520_1467745_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	50.0	1.7e-11
WP_111696823.1|1467741_1468668_+	N-6 DNA methylase	NA	A0A0M3LQ47	Mannheimia_phage	57.5	1.5e-96
WP_111696824.1|1468664_1469081_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	85.5	8.6e-65
WP_111696825.1|1469170_1469716_+	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	63.5	1.0e-57
WP_111696826.1|1469716_1470235_+	antitermination protein	NA	NA	NA	NA	NA
WP_111696827.1|1470492_1470852_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_111696828.1|1470817_1471420_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	54.9	8.7e-58
WP_111696829.1|1471412_1471736_+	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	63.6	1.4e-25
WP_111696830.1|1471647_1471932_+	hypothetical protein	NA	Q776X1	Haemophilus_phage	73.9	8.0e-30
WP_111696831.1|1471928_1472192_+	hypothetical protein	NA	Q776V9	Haemophilus_phage	70.9	2.4e-28
WP_042599555.1|1472524_1472998_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	52.3	7.1e-39
WP_111696832.1|1473000_1475130_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	67.3	6.7e-278
WP_111328013.1|1475253_1475781_+	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	43.3	2.0e-29
WP_075916313.1|1475820_1476042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696833.1|1476045_1477569_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	57.9	8.4e-158
WP_172454045.1|1477504_1479544_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1W6JT88	Pseudomonas_phage	56.9	5.2e-203
WP_111696834.1|1479622_1479946_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_111696835.1|1479926_1480232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005633937.1|1480231_1480777_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	41.2	3.6e-26
WP_111696836.1|1480773_1481172_+|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	34.8	4.8e-12
WP_111696837.1|1481171_1481675_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	52.9	2.9e-38
WP_111696838.1|1481677_1482067_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_111696839.1|1482129_1482390_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_111696840.1|1482376_1484752_+|tail	phage tail tape measure protein	tail	A0A0M3LS69	Mannheimia_phage	43.2	1.7e-16
WP_111696841.1|1484756_1485101_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	37.0	5.6e-09
WP_111696842.1|1485183_1485717_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_111696843.1|1486023_1486881_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	82.8	1.8e-56
WP_111696844.1|1486940_1487654_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	64.7	8.1e-87
WP_111696845.1|1487656_1488391_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.8	3.0e-84
WP_005633953.1|1488333_1488918_+|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	54.1	2.8e-53
WP_111696846.1|1488928_1492882_+|tail	phage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	60.8	1.2e-14
WP_032827959.1|1492890_1493238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696847.1|1493237_1493894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696848.1|1493934_1494555_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_111696849.1|1494547_1495009_+	hypothetical protein	NA	A0A0R6PFI9	Moraxella_phage	47.2	3.8e-29
WP_005633456.1|1495045_1495339_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	67.0	4.9e-30
WP_111696850.1|1495393_1495771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696851.1|1495907_1496273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696852.1|1496275_1496938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111696853.1|1496985_1497495_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	52.4	6.9e-48
WP_111696854.1|1497537_1497822_-	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	47.5	2.2e-11
WP_111696855.1|1498392_1498890_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_005634630.1|1498907_1499393_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_111696856.1|1500087_1501509_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_111696857.1|1501521_1502397_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
WP_111696858.1|1502465_1506998_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
1502412:1502431	attR	TAATTAAAGTGCGGTCAAAA	NA	NA	NA	NA
WP_111696859.1|1506997_1507732_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_111696860.1|1507989_1509324_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_111696861.1|1509473_1510415_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	83.5	1.9e-123
WP_111696862.1|1510416_1510746_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	52.8	5.3e-25
WP_005631673.1|1510853_1511063_+	molybdenum-pterin-binding protein	NA	NA	NA	NA	NA
WP_005644716.1|1511251_1513183_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.2	1.9e-130
WP_111696863.1|1513467_1514052_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_111696864.1|1514126_1516733_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.5	2.4e-88
WP_111696865.1|1516828_1517746_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111696866.1|1517807_1519232_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_005631652.1|1519242_1520781_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_048952664.1|1521071_1521695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696867.1|1521666_1522869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048953336.1|1522915_1523242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696868.1|1525098_1525569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111696869.1|1527250_1527781_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_111696870.1|1527953_1528265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172454074.1|1528266_1528584_-	adhesin	NA	NA	NA	NA	NA
WP_111697130.1|1530676_1530802_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_111696872.1|1533783_1534176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172454003.1|1537445_1541027_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	33.7	2.2e-39
WP_111696873.1|1541096_1542872_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.6	3.5e-38
WP_111696874.1|1543053_1545519_-	glycogen/starch/alpha-glucan phosphorylase	NA	A0A140XAG6	Dickeya_phage	54.2	1.7e-19
WP_111696875.1|1545759_1547190_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_005627058.1|1547296_1548598_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_111696876.1|1548620_1550597_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_111696877.1|1550600_1552790_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_172454046.1|1552799_1554890_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_111696879.1|1554960_1555413_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_111696880.1|1555490_1557161_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.0	6.2e-255
