The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483443	Aggregatibacter segnis ATCC 33393 strain NCTC 10977 chromosome 1	2022832	44570	67725	2022832	head,integrase,tail,terminase,portal,protease,tRNA,capsid	uncultured_Caudovirales_phage(50.0%)	25	53158:53177	68082:68101
WP_006719227.1|44570_46586_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.8	7.7e-143
WP_006719228.1|46656_47235_-	thymidine kinase	NA	A0A076YPF1	Citrobacter_phage	51.6	5.2e-52
WP_006719229.1|47234_47468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719230.1|47538_48567_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.1	7.3e-113
WP_005701713.1|48791_49007_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_006719232.1|49128_50889_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.2	1.1e-44
WP_006719233.1|50964_52830_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.3	3.4e-36
53158:53177	attL	TGTAACCACGATTGTAACCA	NA	NA	NA	NA
WP_006719234.1|53231_54428_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.7	1.2e-79
WP_006719237.1|56362_56806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719238.1|56805_57030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719239.1|57022_57373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719240.1|57359_57551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719242.1|57566_57749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719243.1|57741_58341_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005633836.1|58539_58851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719245.1|58862_59066_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_006719246.1|59210_60167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006719247.1|60311_60872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005633848.1|63094_63463_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	66.1	3.0e-37
WP_006719250.1|63683_64040_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	53.6	1.9e-28
WP_006719251.1|64054_64369_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	49.5	2.7e-18
WP_006719252.1|64355_64700_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_006719253.1|64683_65916_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	62.5	2.8e-143
WP_006719254.1|65917_66484_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.4	1.1e-49
WP_032997978.1|66537_67725_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	63.3	1.4e-131
68082:68101	attR	TGTAACCACGATTGTAACCA	NA	NA	NA	NA
>prophage 2
NZ_LS483443	Aggregatibacter segnis ATCC 33393 strain NCTC 10977 chromosome 1	2022832	1637955	1735063	2022832	head,integrase,tail,terminase,portal,protease,lysis,tRNA,capsid	Mannheimia_phage(18.42%)	95	1676953:1676970	1709395:1709412
WP_032997898.1|1637955_1638648_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_006718519.1|1638647_1639058_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_006718521.1|1639501_1639978_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	44.2	4.8e-27
WP_032997899.1|1639983_1641183_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	32.4	1.6e-58
WP_006718525.1|1641179_1641560_+	SufE family protein	NA	NA	NA	NA	NA
WP_006718527.1|1641598_1643029_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.5	6.9e-37
WP_006718529.1|1643146_1644079_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	38.8	6.9e-54
WP_006718531.1|1644130_1644694_-	molecular chaperone	NA	NA	NA	NA	NA
WP_006718533.1|1644693_1645305_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006718535.1|1645313_1645760_-	NfeD family protein	NA	NA	NA	NA	NA
WP_006718537.1|1645779_1646706_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_032997900.1|1652847_1653921_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_006718541.1|1654047_1655331_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_006718542.1|1655401_1657993_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_006718544.1|1658059_1658863_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_006718546.1|1658998_1659340_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.1	2.9e-26
WP_032997901.1|1659341_1659704_+	YacL family protein	NA	NA	NA	NA	NA
WP_006718550.1|1659734_1662116_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_006718551.1|1662247_1663939_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_006718552.1|1664236_1665832_+	lactate permease LctP family transporter	NA	NA	NA	NA	NA
WP_006718553.1|1665929_1666655_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_006718554.1|1666661_1668074_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_032997902.1|1668073_1668781_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_006718556.1|1668966_1670874_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_006718557.1|1670916_1671438_+	iron transporter	NA	NA	NA	NA	NA
WP_006718558.1|1671567_1672986_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_006718559.1|1672988_1674314_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006718560.1|1674300_1675440_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006718561.1|1675441_1676113_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	31.4	9.2e-16
WP_006718563.1|1676102_1676609_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_006718565.1|1676605_1676917_+	c-type cytochrome	NA	NA	NA	NA	NA
1676953:1676970	attL	ATAAAAAAACCGCACTTT	NA	NA	NA	NA
WP_006718567.1|1682851_1683055_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_006718569.1|1683138_1684071_-	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_032997903.1|1684221_1685688_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.4	1.2e-97
WP_006718572.1|1685894_1687271_+	purine permease	NA	H9YQ34	environmental_Halophage	45.4	7.9e-22
WP_006718574.1|1687426_1688782_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_006718576.1|1688891_1689761_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006718577.1|1689931_1691491_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006718580.1|1691693_1692893_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	58.2	5.6e-133
WP_006718582.1|1692907_1693477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050540578.1|1693476_1693674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718586.1|1693870_1694722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718588.1|1694762_1695101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718590.1|1695097_1698313_-|tail	phage tail protein	tail	A0A0M3LR06	Mannheimia_phage	63.2	1.3e-06
WP_006718593.1|1698963_1699722_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	47.8	1.9e-62
WP_006718595.1|1699723_1700458_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	56.4	1.2e-72
WP_032997904.1|1700457_1700790_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	33.9	2.5e-14
WP_006718599.1|1700799_1704126_-	tape measure protein	NA	A0A0E3GMH8	Enterobacteria_phage	26.7	1.2e-60
WP_006718602.1|1704189_1704387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718604.1|1704462_1704888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718605.1|1705070_1705265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032997905.1|1705239_1705470_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_032998163.1|1705514_1705928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718611.1|1705982_1706636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718612.1|1706639_1706984_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_006718615.1|1706985_1707468_-	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	31.5	8.9e-13
WP_006718616.1|1707460_1707784_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	46.3	5.8e-16
WP_032997907.1|1707780_1708101_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	37.3	2.2e-07
WP_006718619.1|1708150_1709377_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	64.8	3.9e-145
WP_006718621.1|1709442_1710045_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	71.9	5.8e-78
1709395:1709412	attR	ATAAAAAAACCGCACTTT	NA	NA	NA	NA
WP_006718623.1|1710037_1711258_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	60.9	1.2e-143
WP_006718625.1|1711254_1711407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718628.1|1711403_1713110_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	71.4	1.9e-243
WP_006718629.1|1713106_1713589_-|terminase	phage terminase small subunit P27 family	terminase	Q8W632	Enterobacteria_phage	44.9	1.4e-29
WP_032997909.1|1713717_1714068_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	64.7	6.9e-39
WP_006718636.1|1714317_1714674_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_006718638.1|1714649_1715225_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	43.0	1.2e-35
WP_050540580.1|1715208_1715436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006718641.1|1715595_1716102_-	antitermination protein	NA	K7PHU3	Enterobacteria_phage	31.4	3.2e-13
WP_006718646.1|1716094_1716457_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	49.2	6.0e-30
WP_006718649.1|1716453_1716747_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	68.1	7.8e-28
WP_006718650.1|1716816_1717452_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	26.9	9.3e-18
WP_006718652.1|1717421_1717940_-	DNA N-6-adenine-methyltransferase	NA	D0UIL3	Aggregatibacter_phage	82.4	4.5e-79
WP_006718654.1|1717936_1718611_-	replication protein	NA	D0UIL4	Aggregatibacter_phage	93.8	9.0e-120
WP_006718657.1|1719380_1720145_-	KilA-N domain-containing protein	NA	Q8W644	Enterobacteria_phage	38.7	5.2e-31
WP_006718658.1|1720188_1720485_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	99.0	1.2e-47
WP_032997910.1|1720505_1720706_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006718663.1|1721564_1722617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006718664.1|1722609_1722978_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_155811790.1|1723009_1723498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006718666.1|1723857_1724382_-	hypothetical protein	NA	Q7Y5W8	Haemophilus_phage	69.4	1.1e-59
WP_032997911.1|1724887_1725355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032997912.1|1725973_1726306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081456143.1|1726752_1727028_+	hypothetical protein	NA	Q776W5	Haemophilus_phage	40.7	2.9e-08
WP_006718671.1|1727020_1727308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006718672.1|1727294_1727459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032997913.1|1727461_1728379_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	47.8	5.8e-61
WP_006718674.1|1728391_1729273_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	59.4	5.2e-59
WP_006718675.1|1729269_1729929_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	74.4	2.9e-83
WP_006718677.1|1730102_1730537_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006718681.1|1730734_1730947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006718684.1|1730952_1731132_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	44.9	5.6e-05
WP_006718686.1|1731825_1732779_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_006718688.1|1732850_1733708_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_006718690.1|1733752_1735063_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
