The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483437	Streptococcus pyogenes strain NCTC13751 chromosome 1	1891258	36640	49027	1891258		Synechococcus_phage(28.57%)	8	NA	NA
WP_087486699.1|36640_40366_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.4	9.2e-41
WP_087486700.1|40599_42054_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	8.3e-54
WP_032464121.1|42081_43104_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	4.0e-63
WP_002986700.1|43271_43826_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_076639719.1|44009_45557_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_076639718.1|45614_46739_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_076639717.1|46991_48257_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002986689.1|48535_49027_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	1.9e-18
>prophage 2
NZ_LS483437	Streptococcus pyogenes strain NCTC13751 chromosome 1	1891258	266484	293587	1891258	protease,transposase,integrase	Shigella_phage(20.0%)	26	258077:258092	304789:304804
258077:258092	attL	TTATCTTGCCAAAGAA	NA	NA	NA	NA
WP_077707078.1|266484_266574_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080497430.1|267008_267149_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079890479.1|267188_267386_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	47.5	1.1e-09
WP_076639623.1|267461_267758_-|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	33.3	9.3e-05
WP_020904871.1|267790_268084_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011888599.1|273770_274352_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002991099.1|274932_275460_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_011184178.1|275459_276578_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_030127134.1|276602_276911_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002991091.1|276979_277612_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	34.8	6.2e-22
WP_002985989.1|277608_278202_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015055915.1|278225_278579_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_021775484.1|278626_279370_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011184181.1|279623_280730_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002985979.1|281211_281928_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_020904902.1|282130_282973_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011054193.1|283299_284145_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020904903.1|284394_285459_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	6.7e-29
WP_002991836.1|285459_286152_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032464179.1|286205_287576_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002991840.1|287809_289024_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002991064.1|289078_289753_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_076639620.1|289762_291154_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_023078972.1|291223_291937_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014407314.1|292086_292644_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	28.8	6.2e-10
WP_014407315.1|292690_293587_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
304789:304804	attR	TTATCTTGCCAAAGAA	NA	NA	NA	NA
>prophage 3
NZ_LS483437	Streptococcus pyogenes strain NCTC13751 chromosome 1	1891258	512279	616117	1891258	capsid,protease,portal,tail,terminase,head,holin,integrase,tRNA	Streptococcus_phage(59.15%)	116	518983:519000	590552:590569
WP_021775322.1|512279_513404_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_096466706.1|513472_514570_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002985455.1|514589_515282_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
WP_002990498.1|515274_516204_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011284638.1|516512_517211_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.9	1.0e-78
WP_002990495.1|517378_518143_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_076639550.1|518250_520752_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.0	2.8e-203
518983:519000	attL	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
WP_002985439.1|521088_522282_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002985437.1|522302_523649_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_030127588.1|524062_524953_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.5	5.1e-06
WP_020905024.1|524949_525927_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	9.6e-139
WP_002985428.1|525923_526835_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.3e-105
WP_010922052.1|527011_528427_-	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.0	2.3e-109
WP_011106738.1|528546_528852_-	membrane protein	NA	NA	NA	NA	NA
WP_030127591.1|528861_529650_-	phage repressor protein	NA	A0A1S5SD15	Streptococcus_phage	63.0	2.0e-86
WP_021340643.1|530019_530169_+	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
WP_014635530.1|530154_530370_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	97.1	8.8e-29
WP_021340638.1|530428_530587_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	5.8e-22
WP_001008979.1|530685_531327_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_014411882.1|531419_531659_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	98.7	1.4e-35
WP_023610918.1|531669_532431_+	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	61.9	3.6e-85
WP_011889039.1|532571_532754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076639549.1|532840_532978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032465394.1|532979_533165_+	hypothetical protein	NA	Q938N3	Temperate_phage	91.8	3.1e-22
WP_011017564.1|533683_534070_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_010922205.1|534050_534284_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
WP_002988354.1|534280_534421_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988357.1|534429_534636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528796.1|534691_535021_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	84.4	7.1e-46
WP_011054700.1|535023_535950_+	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_000594115.1|535946_536147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076639548.1|536139_536937_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	82.3	5.2e-127
WP_030127594.1|537113_537455_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	39.6	1.4e-12
WP_029714370.1|537451_537964_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	74.4	3.4e-63
WP_011017567.1|537950_538148_+	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.9e-11
WP_011017568.1|538141_538426_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_002987593.1|538422_538692_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011017569.1|538701_539115_+	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	6.4e-36
WP_030127595.1|539111_539396_+	hypothetical protein	NA	A3F628	Streptococcus_phage	95.7	7.0e-42
WP_011017571.1|539399_539882_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
WP_076639547.1|540072_540474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054572.1|540473_541109_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.9	2.2e-88
WP_011017866.1|541382_541823_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_030127683.1|542377_543289_+	DNA adenine methylase	NA	A0A126HDT5	Lactococcus_phage	64.5	4.3e-101
WP_002987543.1|543414_543792_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|543843_544029_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_002985371.1|544772_545240_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_002985368.1|545242_545473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024623442.1|545476_547231_+	amino acid transporter	NA	J7KKD1	Streptococcus_phage	96.1	0.0e+00
WP_021299470.1|547227_547398_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	60.4	3.9e-08
WP_002985363.1|547390_547615_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_011017578.1|547648_548869_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
WP_011017579.1|548846_549512_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.1	3.5e-92
WP_011017580.1|549536_550724_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	74.7	1.3e-158
WP_011017581.1|550868_551171_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	88.8	1.3e-41
WP_011017582.1|551167_551515_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	88.2	2.9e-50
WP_011527557.1|551511_551889_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	1.8e-45
WP_011017584.1|551885_552311_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
WP_011017585.1|552326_552935_+	hypothetical protein	NA	J7KKC8	Streptococcus_phage	71.9	6.7e-74
WP_011017586.1|552987_553314_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
WP_021299462.1|553361_553511_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_030127684.1|553523_557447_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.3	2.5e-238
WP_011527559.1|557446_558154_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.9	6.8e-94
WP_076639342.1|558150_560298_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	93.1	0.0e+00
WP_063808246.1|560297_561572_+	collagen-like protein	NA	A3F657	Streptococcus_phage	39.9	2.1e-21
WP_063808247.1|561574_562222_+	hypothetical protein	NA	A3F658	Streptococcus_phage	47.0	1.4e-50
WP_076639341.1|562232_564269_+	gp58-like family protein	NA	Q938J9	Temperate_phage	69.5	8.3e-169
WP_002983467.1|564280_564712_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_011017592.1|564714_565332_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
WP_002987582.1|565341_565617_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_000609113.1|565613_565841_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_002985329.1|565956_567162_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	83.3	1.6e-204
WP_002985327.1|567229_567937_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_002985324.1|568047_568806_-	DNase Mf2	NA	NA	NA	NA	NA
WP_063723270.1|569117_570536_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_076639340.1|570687_572235_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002990479.1|572382_573105_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076639339.1|573124_574324_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002985307.1|574420_574681_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_076639338.1|574795_575737_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_032460256.1|576130_576580_+	flavodoxin	NA	NA	NA	NA	NA
WP_063631291.1|576755_577040_+	chorismate mutase	NA	NA	NA	NA	NA
WP_076639337.1|577032_578295_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	1.1e-94
WP_002985298.1|578409_578757_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_087486710.1|579118_579412_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141DZH6	Streptococcus_phage	45.9	1.2e-09
WP_002985295.1|579771_580341_+	hydrolase	NA	NA	NA	NA	NA
WP_011017600.1|580341_582294_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.2	8.9e-144
WP_002990455.1|582661_584386_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002990451.1|584517_584976_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002985288.1|585208_586516_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
WP_002985285.1|587190_587352_+	TOMM family cytolysin streptolysin S	NA	NA	NA	NA	NA
WP_002985278.1|587573_588524_+	streptolysin S biosynthesis dehydrogenase SagB	NA	NA	NA	NA	NA
WP_002985275.1|588520_589579_+	streptolysin associated protein SagC	NA	NA	NA	NA	NA
WP_002990434.1|589598_590957_+	YcaO-like family protein	NA	NA	NA	NA	NA
590552:590569	attR	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
WP_076639336.1|590931_591603_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002990431.1|591599_592283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990429.1|592305_593229_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	38.1	6.7e-33
WP_014407462.1|593237_594365_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076639335.1|594361_595480_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076639334.1|596050_598783_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_002985256.1|599060_599561_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	5.4e-05
WP_014635380.1|599754_601713_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	34.9	1.3e-102
WP_002985252.1|601726_602749_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	27.9	3.6e-19
WP_002985249.1|603140_603338_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_002985244.1|603372_604089_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002990420.1|604106_604601_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_030126744.1|604600_605137_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011889023.1|605152_606658_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_002985236.1|606676_607552_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_076639333.1|607714_609124_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_002985233.1|609133_609550_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_002994426.1|609815_610073_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_002994428.1|610137_611409_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_023078815.1|611412_611601_+	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_003057440.1|612458_613502_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	4.6e-30
WP_076639331.1|613711_616117_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_LS483437	Streptococcus pyogenes strain NCTC13751 chromosome 1	1891258	651527	662130	1891258		Streptococcus_phage(57.14%)	9	NA	NA
WP_044559748.1|651527_653738_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_002985142.1|653845_655009_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|655005_655692_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_076639328.1|655785_656952_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.2	1.9e-32
WP_002990260.1|657012_657354_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_044559750.1|657574_658927_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	4.5e-30
WP_021775342.1|659014_660283_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_021775338.1|660312_660753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184383.1|660987_662130_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 5
NZ_LS483437	Streptococcus pyogenes strain NCTC13751 chromosome 1	1891258	753954	805447	1891258	capsid,portal,tail,terminase,integrase,holin,tRNA	Streptococcus_pyogenes_phage(47.37%)	68	754534:754549	809699:809714
WP_002990117.1|753954_754854_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
754534:754549	attL	GACCGTATCAATCAGC	NA	NA	NA	NA
WP_030127486.1|754926_756165_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002990114.1|756157_756793_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_023611152.1|756807_757737_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_002984893.1|757736_758501_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076639688.1|758497_760708_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	3.9e-71
WP_002990109.1|760857_761376_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_002984890.1|761456_762140_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_002990106.1|762136_762793_+	endonuclease III	NA	NA	NA	NA	NA
WP_020905114.1|762864_763551_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002984887.1|763540_764329_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_076639687.1|764368_765475_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002992970.1|765532_766402_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
WP_002990099.1|766401_766995_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_076639686.1|767238_768279_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	8.5e-69
WP_011528538.1|768361_769501_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	55.8	4.4e-119
WP_011528539.1|769622_770309_-	hypothetical protein	NA	A0A1P8VVT3	Streptococcus_phage	100.0	5.7e-122
WP_011054825.1|770479_770632_-	hypothetical protein	NA	A0A1P8VVQ0	Streptococcus_phage	100.0	5.2e-20
WP_011054824.1|770642_771020_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	100.0	4.0e-69
WP_011528540.1|771003_771363_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	98.3	1.8e-58
WP_009881062.1|771551_771770_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	100.0	4.1e-34
WP_011528542.1|771864_772116_+	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	100.0	2.8e-42
WP_011528544.1|772296_772611_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	100.0	1.7e-52
WP_011528545.1|772837_773320_+	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	100.0	1.2e-78
WP_002995975.1|773320_774001_+	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
WP_011528546.1|774102_775332_+	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	100.0	3.3e-237
WP_002995969.1|775347_775806_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	100.0	3.8e-82
WP_030126642.1|775808_776621_+	bifunctional DNA primase/polymerase	NA	A0A1P8VVM6	Streptococcus_phage	99.6	5.5e-156
WP_020905118.1|776610_778092_+	DNA primase	NA	A0A1P8VVM0	Streptococcus_phage	100.0	1.3e-296
WP_002995960.1|778336_778657_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	100.0	2.0e-53
WP_011018138.1|778640_778997_+	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	5.0e-61
WP_011017568.1|779238_779523_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_002987593.1|779519_779789_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011054753.1|779798_780203_+	hypothetical protein	NA	Q938M1	Temperate_phage	100.0	6.0e-71
WP_011054752.1|780199_780370_+	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	4.2e-26
WP_011054751.1|780366_780873_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	100.0	9.8e-95
WP_164997036.1|780869_781040_+	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	98.2	1.1e-26
WP_011017866.1|781313_781754_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_011285571.1|781901_782282_+	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
WP_021299302.1|782271_783546_+|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	99.8	1.9e-251
WP_011528552.1|783545_784871_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	95.6	6.3e-234
WP_011528553.1|784839_785748_+|capsid	minor capsid protein	capsid	A0A097PBF2	Streptococcus_pyogenes_phage	94.5	2.4e-83
WP_011528554.1|785754_785985_+	hypothetical protein	NA	Q938K9	Temperate_phage	62.5	4.0e-19
WP_021299309.1|786096_786666_+	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	90.5	1.4e-60
WP_009880261.1|786684_787575_+	hypothetical protein	NA	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
WP_011528557.1|787586_787880_+	Rho termination factor N-terminal domain-containing protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	99.0	1.3e-46
WP_011528558.1|787893_788238_+	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	99.1	1.5e-54
WP_011528559.1|788234_788546_+	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	94.2	4.6e-47
WP_011528560.1|788542_788938_+	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	93.0	1.8e-56
WP_011528561.1|788939_789350_+	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	99.3	1.8e-70
WP_079890482.1|789361_789868_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	98.7	8.3e-78
WP_011528563.1|789880_790198_+	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	98.1	1.9e-51
WP_011528564.1|790170_790629_+	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	93.4	7.0e-76
WP_011528565.1|790621_792427_+|tail	tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	95.5	9.1e-252
WP_011528566.1|792427_793912_+|tail	phage tail family protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	98.8	1.8e-290
WP_050336170.1|793912_797362_+|tail	phage tail protein	tail	A0A097PBF5	Streptococcus_pyogenes_phage	99.0	0.0e+00
WP_011528568.1|797366_799229_+	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.8	0.0e+00
WP_009880247.1|799239_799587_+	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	100.0	3.5e-59
WP_015055952.1|799736_800060_+	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	100.0	7.7e-53
WP_011054798.1|800059_800392_+|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	100.0	5.7e-51
WP_011054797.1|800393_801158_+	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	100.0	1.5e-150
WP_011054796.1|801169_801772_+	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
WP_011528569.1|801782_802556_+	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	94.6	4.6e-128
WP_009880241.1|802565_802787_+	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
WP_011528570.1|802786_803446_+	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	96.3	6.3e-118
WP_011017966.1|803514_803949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285611.1|804220_805021_-	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011528571.1|805258_805447_+	hypothetical protein	NA	A3F673	Streptococcus_phage	73.3	6.1e-18
809699:809714	attR	GCTGATTGATACGGTC	NA	NA	NA	NA
>prophage 6
NZ_LS483437	Streptococcus pyogenes strain NCTC13751 chromosome 1	1891258	1141855	1247912	1891258	capsid,protease,portal,tail,terminase,head,integrase,tRNA	Streptococcus_phage(47.14%)	116	1182937:1182956	1225616:1225635
WP_011184658.1|1141855_1142551_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_020905286.1|1142569_1143331_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002989220.1|1143327_1143543_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076639299.1|1143903_1146522_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	1.1e-61
WP_020905289.1|1146908_1147964_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_002989211.1|1148026_1148734_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
WP_002995765.1|1148799_1149996_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011054652.1|1150371_1152177_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002983995.1|1152189_1153152_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_020905292.1|1153447_1154164_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_009880651.1|1154282_1154987_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_076639300.1|1155188_1156217_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002983986.1|1156223_1157444_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_020905297.1|1158131_1158380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020905298.1|1158434_1158590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020905299.1|1158751_1159357_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	52.7	3.9e-58
WP_020905300.1|1159453_1160494_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_076639301.1|1160564_1162808_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.2	7.5e-54
WP_002983967.1|1162788_1163451_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011054661.1|1163650_1164391_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_020905303.1|1164430_1165285_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011017953.1|1165274_1165553_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	7.9e-06
WP_020905304.1|1165576_1167577_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	3.4e-66
WP_020905305.1|1167704_1169324_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.5e-59
WP_020905306.1|1169630_1171175_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.8	1.1e-35
WP_011017956.1|1171422_1172118_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_076639302.1|1172197_1173589_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_020905307.1|1173787_1174834_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002983939.1|1174934_1175531_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_076639303.1|1176329_1177109_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002989140.1|1177232_1177775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983930.1|1177935_1178457_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002983928.1|1178563_1179259_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_023610138.1|1179497_1180433_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	3.0e-65
WP_076639304.1|1180732_1182595_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	1.9e-90
1182937:1182956	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_032463717.1|1183125_1183308_-	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	4.4e-21
WP_021340779.1|1183422_1184211_-	streptococcal pyrogenic exotoxin SpeL	NA	Q938J1	Temperate_phage	41.4	9.1e-47
WP_032463716.1|1184492_1185206_-	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	59.1	9.0e-78
WP_003051628.1|1185589_1186183_-	GNAT family N-acetyltransferase	NA	A0A0A8WFI2	Clostridium_phage	38.2	2.4e-23
WP_011018107.1|1186182_1186386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994484.1|1187249_1187942_-	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
WP_023078271.1|1188174_1188732_-	glycoside hydrolase family 73 protein	NA	Q938J4	Temperate_phage	89.2	2.8e-95
WP_011054731.1|1188842_1189028_-	hypothetical protein	NA	Q938J5	Temperate_phage	100.0	1.7e-25
WP_023078532.1|1189024_1189321_-	hypothetical protein	NA	Q938J6	Temperate_phage	99.0	2.9e-46
WP_023611372.1|1189331_1189964_-	hypothetical protein	NA	Q938J7	Temperate_phage	50.0	2.6e-44
WP_032463718.1|1189966_1190395_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.3	9.8e-64
WP_076639305.1|1190406_1192293_-	gp58-like family protein	NA	Q938J9	Temperate_phage	84.9	8.1e-219
WP_032463712.1|1192307_1193321_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	98.2	1.6e-181
WP_050436577.1|1193320_1195426_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	43.1	2.3e-129
WP_030127447.1|1195422_1196193_-|tail	phage tail family protein	tail	A1EAB1	Streptococcus_phage	45.0	1.2e-56
WP_050436576.1|1196192_1198940_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	36.4	8.3e-55
WP_030127445.1|1198939_1199257_-	hypothetical protein	NA	A1EAF6	Streptococcus_phage	44.4	6.9e-14
WP_030127444.1|1199277_1199646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127443.1|1199699_1200218_-|tail	phage major tail protein, TP901-1 family	tail	A1EAF4	Streptococcus_phage	51.7	2.2e-41
WP_030127442.1|1200205_1200604_-	DUF3168 domain-containing protein	NA	A1EAF3	Streptococcus_phage	44.5	3.8e-25
WP_030127441.1|1200600_1200957_-	HK97 gp10 family phage protein	NA	A1EAF2	Streptococcus_phage	44.0	4.7e-19
WP_032463711.1|1200956_1201253_-	hypothetical protein	NA	A0A1P8BKV3	Lactococcus_phage	35.6	9.6e-10
WP_030127439.1|1201249_1201603_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	52.1	3.9e-26
WP_030127438.1|1201614_1201881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127437.1|1201892_1202942_-|capsid	major capsid protein	capsid	A0A286QR01	Streptococcus_phage	57.7	1.8e-106
WP_002990036.1|1202944_1203325_-	structural protein	NA	A0A0K2CNR0	Brevibacillus_phage	36.3	6.4e-06
WP_030127436.1|1203334_1203868_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	82.5	1.8e-14
WP_030127435.1|1204011_1204278_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	77.3	4.1e-28
WP_032463710.1|1204293_1205208_-|capsid	minor capsid protein	capsid	A1EAE3	Streptococcus_phage	50.0	2.2e-73
WP_032461297.1|1205188_1206679_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.0	1.3e-142
WP_014635515.1|1206690_1207998_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.0	2.9e-183
WP_030127432.1|1207975_1208428_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	95.7	1.7e-66
WP_011054881.1|1208517_1208934_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_023079210.1|1208917_1209064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054882.1|1209066_1209339_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_164972002.1|1209331_1209502_-	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_030127431.1|1209502_1210825_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.5	4.3e-251
WP_011054885.1|1210821_1211097_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
WP_032463709.1|1211482_1213867_-	DNA primase	NA	A7J282	Streptococcus_phage	94.6	6.3e-277
WP_030127429.1|1213871_1215794_-	DNA polymerase	NA	A7J280	Streptococcus_phage	99.1	0.0e+00
WP_086934854.1|1215836_1216400_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1216408_1217566_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_030127427.1|1217565_1217865_-	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	3.7e-41
WP_030127426.1|1217952_1218156_-	hypothetical protein	NA	A7J276	Streptococcus_phage	89.6	3.7e-29
WP_017647437.1|1218152_1218305_-	hypothetical protein	NA	A7J275	Streptococcus_phage	98.0	9.9e-19
WP_030127425.1|1218301_1218688_-	hypothetical protein	NA	A7J274	Streptococcus_phage	87.4	6.8e-56
WP_030127424.1|1218684_1218888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023611037.1|1218880_1219051_-	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_014411880.1|1219052_1219364_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_011054585.1|1219441_1219627_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1219793_1220033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1220182_1220392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157159.1|1220637_1220844_-	helix-turn-helix domain-containing protein	NA	A0A1X9I5S3	Streptococcus_phage	64.7	1.1e-17
WP_050429000.1|1220893_1221400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340823.1|1221396_1221543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127422.1|1221597_1222197_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	99.5	9.1e-108
WP_076636802.1|1222227_1222386_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	98.1	1.1e-23
WP_030127421.1|1222775_1223534_+	helix-turn-helix domain-containing protein	NA	A0A097PBE5	Streptococcus_pyogenes_phage	65.9	3.1e-84
WP_030127420.1|1223568_1224249_+	hypothetical protein	NA	A0A097PAS7	Streptococcus_pyogenes_phage	87.7	1.2e-74
WP_003051793.1|1224385_1225528_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1225617_1225893_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1225616:1225635	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_002989129.1|1225991_1226579_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002992620.1|1226556_1227399_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_161237429.1|1227391_1228243_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	9.2e-13
WP_076639306.1|1228458_1229373_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_076639307.1|1229544_1231206_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002983907.1|1231226_1231697_-	arginine repressor	NA	NA	NA	NA	NA
WP_011017996.1|1231683_1232511_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_076639308.1|1232503_1233376_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002983901.1|1233375_1233591_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_076639309.1|1233568_1234909_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	6.3e-40
WP_010922486.1|1235061_1235916_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_076639310.1|1236123_1237818_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.2	4.5e-128
WP_023610117.1|1237995_1239405_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	8.8e-61
WP_010922488.1|1239553_1240288_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	8.2e-34
WP_011054708.1|1240287_1240974_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002983885.1|1241100_1241331_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_002983882.1|1241628_1243911_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_020905319.1|1244038_1244494_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002983878.1|1244544_1244847_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_076639311.1|1245110_1247912_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	27.0	1.4e-70
>prophage 7
NZ_LS483437	Streptococcus pyogenes strain NCTC13751 chromosome 1	1891258	1281217	1325369	1891258	capsid,portal,tail,terminase,holin,integrase	Temperate_phage(79.03%)	67	1306823:1306839	1325548:1325564
WP_076639316.1|1281217_1282951_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.2	2.3e-26
WP_023610925.1|1282947_1283688_-	response regulator	NA	NA	NA	NA	NA
WP_011054726.1|1283932_1284115_-	hypothetical protein	NA	A3F673	Streptococcus_phage	76.7	2.6e-18
WP_011054727.1|1284460_1285036_-	hypothetical protein	NA	Q938J0	Temperate_phage	100.0	1.7e-111
WP_011054728.1|1285511_1286291_-	streptococcal pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	100.0	5.4e-145
WP_076639317.1|1286594_1287461_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	99.3	2.4e-133
WP_011017840.1|1287448_1287973_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011054730.1|1288112_1289315_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	100.0	3.3e-242
WP_011054444.1|1289430_1289658_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_011017397.1|1289654_1289927_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_011054443.1|1289938_1290571_-	hypothetical protein	NA	Q938J7	Temperate_phage	49.5	2.0e-44
WP_002988448.1|1290573_1291002_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_047235372.1|1291013_1292903_-	gp58-like family protein	NA	Q938J9	Temperate_phage	75.6	1.4e-189
WP_011284842.1|1292913_1293243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284843.1|1293229_1294444_-	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
WP_076639318.1|1294440_1296588_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	93.8	0.0e+00
WP_076639319.1|1296584_1297301_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	95.8	1.8e-131
WP_076639320.1|1297297_1300558_-	tape measure protein	NA	Q938K3	Temperate_phage	99.8	0.0e+00
WP_011054739.1|1300547_1301129_-	hypothetical protein	NA	Q938K4	Temperate_phage	100.0	1.3e-106
WP_011054740.1|1301132_1301567_-	hypothetical protein	NA	Q938K5	Temperate_phage	100.0	2.6e-72
WP_011054741.1|1301605_1302091_-	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
WP_010922084.1|1302090_1302489_-|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_010922083.1|1302485_1302842_-	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922082.1|1302841_1303174_-	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_011054743.1|1303163_1303580_-	hypothetical protein	NA	Q938K7	Temperate_phage	100.0	1.1e-56
WP_010922080.1|1303633_1304452_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_011106689.1|1304455_1305070_-	hypothetical protein	NA	Q938K8	Temperate_phage	100.0	1.3e-96
WP_011054745.1|1305195_1305462_-	hypothetical protein	NA	Q938K9	Temperate_phage	100.0	1.5e-38
WP_002986829.1|1305523_1305763_-	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
WP_011054746.1|1305734_1307213_-|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	100.0	8.2e-275
1306823:1306839	attL	CATCAATAGCTTGTCTA	NA	NA	NA	NA
WP_002986832.1|1307217_1308720_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	100.0	5.4e-282
WP_010922074.1|1308733_1309945_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_011054747.1|1310027_1310501_-	hypothetical protein	NA	Q938L4	Temperate_phage	99.4	4.3e-76
WP_002986841.1|1310551_1310929_-	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
WP_076639321.1|1310989_1311373_-	GNAT family N-acetyltransferase	NA	B5SP24	Lactococcus_phage	58.5	3.9e-35
WP_076639322.1|1311398_1311917_-	ParB N-terminal domain-containing protein	NA	Q938L7	Temperate_phage	99.4	1.1e-88
WP_011054748.1|1311997_1312255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017866.1|1312893_1313334_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_164997036.1|1313607_1313778_-	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	98.2	1.1e-26
WP_011054751.1|1313774_1314281_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	100.0	9.8e-95
WP_011054752.1|1314277_1314448_-	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	4.2e-26
WP_011054753.1|1314444_1314849_-	hypothetical protein	NA	Q938M1	Temperate_phage	100.0	6.0e-71
WP_011054754.1|1314858_1315128_-	hypothetical protein	NA	Q938M2	Temperate_phage	100.0	4.0e-47
WP_011054755.1|1315124_1315409_-	DUF3310 domain-containing protein	NA	Q938M3	Temperate_phage	100.0	5.4e-50
WP_011054756.1|1315402_1315654_-	hypothetical protein	NA	Q938M4	Temperate_phage	100.0	6.8e-41
WP_011054757.1|1315650_1316007_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	85.6	1.6e-51
WP_011054758.1|1316003_1316444_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.3	8.5e-79
WP_011106686.1|1316443_1316647_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011054759.1|1316652_1317072_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	100.0	1.6e-71
WP_011054760.1|1317064_1317739_-	ERF family protein	NA	Q938M8	Temperate_phage	100.0	2.5e-106
WP_011018142.1|1317739_1318222_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
WP_011054761.1|1318243_1318498_-	hypothetical protein	NA	Q938N0	Temperate_phage	100.0	7.4e-43
WP_011284979.1|1318508_1318649_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	52.3	7.5e-05
WP_011054762.1|1318645_1318879_-	hypothetical protein	NA	Q938N1	Temperate_phage	100.0	5.0e-38
WP_011054763.1|1318859_1319273_-	DnaD domain protein	NA	Q938N2	Temperate_phage	100.0	2.1e-63
WP_011106684.1|1319394_1319652_-	hypothetical protein	NA	A0A1S5SFN6	Streptococcus_phage	46.4	1.2e-11
WP_011054765.1|1319745_1319931_-	hypothetical protein	NA	Q938N3	Temperate_phage	100.0	1.1e-24
WP_002988339.1|1319959_1320217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054766.1|1320462_1320717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986887.1|1320705_1320906_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	72.3	6.3e-21
WP_002986888.1|1320902_1321052_-	hypothetical protein	NA	Q938N4	Temperate_phage	100.0	1.8e-20
WP_011054767.1|1321084_1321813_-	phage antirepressor KilAC domain-containing protein	NA	Q938N5	Temperate_phage	100.0	6.9e-134
WP_002986891.1|1321823_1322015_-	hypothetical protein	NA	A7J270	Streptococcus_phage	90.5	1.2e-24
WP_011054768.1|1322810_1323170_+	helix-turn-helix transcriptional regulator	NA	Q938N6	Temperate_phage	100.0	1.1e-60
WP_002986894.1|1323183_1323564_+	hypothetical protein	NA	Q938N7	Temperate_phage	100.0	5.3e-69
WP_002986895.1|1323574_1324096_+	hypothetical protein	NA	Q938N8	Temperate_phage	100.0	2.3e-67
WP_002986896.1|1324214_1325369_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	100.0	2.8e-206
1325548:1325564	attR	TAGACAAGCTATTGATG	NA	NA	NA	NA
