The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483435	Neisseria elongata subsp. glycolytica strain NCTC11050 chromosome 1	2249415	1561315	1607884	2249415	tRNA,capsid,integrase,portal,terminase,head	Burkholderia_phage(15.79%)	49	1594237:1594283	1608291:1608337
WP_003770382.1|1561315_1563946_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.9	1.6e-185
WP_003770384.1|1564032_1564611_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_040665695.1|1564649_1565735_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	29.0	6.2e-30
WP_003770389.1|1565856_1566177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770391.1|1566240_1567719_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_040665672.1|1567837_1568104_-	membrane protein	NA	NA	NA	NA	NA
WP_040665674.1|1568572_1568935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770404.1|1569186_1570983_-	chorismate-binding protein	NA	S4VT78	Pandoravirus	28.9	7.4e-36
WP_041961378.1|1571230_1572160_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_111751073.1|1572283_1573039_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003770412.1|1573156_1573537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770418.1|1575106_1575697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041961380.1|1575759_1576548_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_040665696.1|1576869_1577232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770424.1|1577399_1578422_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_003770427.1|1578418_1579798_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003770429.1|1579890_1580088_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003770434.1|1580304_1580646_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003770436.1|1580722_1581085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040665677.1|1581081_1581261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041961381.1|1581378_1581843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770444.1|1582032_1583886_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	44.6	1.0e-112
WP_003770446.1|1583927_1584428_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_003770450.1|1584825_1585146_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	3.0e-25
WP_003770452.1|1585192_1585447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770455.1|1585588_1585975_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	83.5	7.5e-55
WP_003770459.1|1586650_1587865_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_003770462.1|1587891_1588335_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_040665678.1|1588563_1589733_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003770466.1|1589861_1590899_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	28.2	1.2e-33
WP_041961383.1|1591166_1592852_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.9	5.0e-34
WP_003770475.1|1592930_1594034_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1594237:1594283	attL	GACTCATAATCCCTTGGTCGTGGGTTCGAACCCCACCGGACCCACCA	NA	NA	NA	NA
WP_111751044.1|1594308_1594644_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	56.4	4.7e-13
WP_041961384.1|1594531_1595389_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	50.4	2.9e-30
WP_003770482.1|1595385_1595985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003770483.1|1596068_1596362_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_040665680.1|1596351_1596831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040665681.1|1596892_1597177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158437458.1|1597372_1597489_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_111751074.1|1597726_1598416_+	helix-turn-helix domain-containing protein	NA	E5FFF8	Burkholderia_phage	33.1	5.9e-26
WP_052437418.1|1598481_1599621_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	40.5	5.7e-58
WP_003770494.1|1599630_1600638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770496.1|1600642_1601584_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	67.3	1.2e-122
WP_003770497.1|1601667_1602168_-|head	head completion/stabilization protein	head	A0A077K9R2	Ralstonia_phage	40.2	7.8e-12
WP_003770500.1|1602275_1602905_-|terminase	phage small terminase subunit	terminase	K4NX86	Burkholderia_phage	36.6	3.9e-24
WP_003770502.1|1602987_1604037_-|capsid	P2 family phage major capsid protein	capsid	Q19UT3	Mannheimia_phage	45.0	1.7e-61
WP_050783669.1|1604076_1604970_-|capsid	capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	44.7	4.8e-28
WP_041961606.1|1605090_1606890_+	oxidoreductase	NA	E5FFI8	Burkholderia_phage	50.2	1.2e-158
WP_003770515.1|1606903_1607884_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	47.5	4.1e-81
1608291:1608337	attR	GACTCATAATCCCTTGGTCGTGGGTTCGAACCCCACCGGACCCACCA	NA	NA	NA	NA
