The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483401	Streptococcus pyogenes strain NCTC10085 chromosome 1	1795272	36317	48630	1795272		Synechococcus_phage(28.57%)	8	NA	NA
WP_002987703.1|36317_40043_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.3	1.1e-38
WP_002987705.1|40203_41658_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	8.3e-54
WP_002987707.1|41685_42708_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	4.0e-63
WP_002987709.1|42875_43430_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_002987711.1|43613_45161_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_002987712.1|45218_46343_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_002987714.1|46595_47861_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48138_48630_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483401	Streptococcus pyogenes strain NCTC10085 chromosome 1	1795272	342054	348089	1795272		Streptococcus_phage(100.0%)	8	NA	NA
WP_002990917.1|342054_342690_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_002990914.1|342707_343583_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	1.0e-62
WP_002985838.1|344246_344570_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002990904.1|344574_345438_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	1.5e-114
WP_002985833.1|345464_345857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990900.1|345903_346533_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002990897.1|346831_347188_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.1e-39
WP_002990895.1|347261_348089_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
>prophage 3
NZ_LS483401	Streptococcus pyogenes strain NCTC10085 chromosome 1	1795272	620503	631106	1795272		Streptococcus_phage(57.14%)	9	NA	NA
WP_024623374.1|620503_622714_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	2.5e-267
WP_002985142.1|622821_623985_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|623981_624668_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002990262.1|624761_625928_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002990260.1|625988_626330_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_002990258.1|626550_627903_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	5.9e-30
WP_002990257.1|627990_629259_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002990255.1|629288_629729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990253.1|629963_631106_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.5	7.7e-23
>prophage 4
NZ_LS483401	Streptococcus pyogenes strain NCTC10085 chromosome 1	1795272	722533	775226	1795272	portal,capsid,integrase,tail,tRNA,terminase,head	Streptococcus_phage(39.22%)	67	736832:736880	776323:776371
WP_002990117.1|722533_723433_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002990116.1|723505_724744_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002990114.1|724736_725372_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_002984894.1|725386_726316_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_002990111.1|726315_727080_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002990110.1|727076_729287_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	3.9e-71
WP_002990109.1|729437_729956_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_002984890.1|730036_730720_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_002990106.1|730716_731373_+	endonuclease III	NA	NA	NA	NA	NA
WP_002990104.1|731444_732131_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002984887.1|732120_732909_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002990103.1|732943_734050_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002990101.1|734107_734977_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	2.7e-100
WP_002990099.1|734976_735570_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_002990096.1|735813_736854_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.5e-68
736832:736880	attL	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAA	NA	NA	NA	NA
WP_002990094.1|736947_738087_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	3.4e-119
WP_002990092.1|738222_738903_-	hypothetical protein	NA	A0A097PAS7	Streptococcus_pyogenes_phage	88.3	4.7e-76
WP_002990090.1|738940_739696_-	helix-turn-helix domain-containing protein	NA	A0A097PBE5	Streptococcus_pyogenes_phage	64.5	2.2e-82
WP_002990088.1|739855_740083_+	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	60.0	4.5e-15
WP_002990086.1|740133_740859_+	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	72.4	1.8e-94
WP_010922204.1|740890_741157_+	hypothetical protein	NA	A0A1S5SC19	Streptococcus_phage	66.3	1.1e-23
WP_002990083.1|741091_741898_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	81.7	2.3e-122
WP_002990081.1|742039_742276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990080.1|742418_742730_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.4	4.1e-43
WP_002990078.1|742731_742917_+	hypothetical protein	NA	Q938N3	Temperate_phage	90.2	1.2e-21
WP_002990076.1|743399_743786_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	47.3	1.1e-24
WP_002988350.1|743766_744000_+	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	1.8e-35
WP_002988354.1|743996_744137_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002990074.1|744145_744352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988359.1|744407_744737_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	83.5	2.1e-45
WP_002990071.1|744739_745531_+	phage recombination protein Bet	NA	A0A1S5SFP4	Streptococcus_phage	82.0	1.4e-119
WP_002990069.1|745540_746569_+	DUF1351 domain-containing protein	NA	E8ZD61	Streptococcus_phage	65.6	7.2e-121
WP_002990067.1|746764_747103_+	hypothetical protein	NA	M1PKX3	Streptococcus_phage	37.5	4.0e-12
WP_002990064.1|747099_747612_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	73.2	2.9e-62
WP_002990058.1|747789_748035_+	hypothetical protein	NA	A0A1P8VVL2	Streptococcus_phage	92.5	4.5e-21
WP_002990055.1|748086_748548_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	60.1	4.5e-46
WP_002990052.1|748997_749438_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	98.6	4.2e-78
WP_002990050.1|749752_750667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990048.1|750756_750969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990047.1|751174_751657_+|terminase	terminase small subunit	terminase	E0Y3R8	Staphylococcus_virus	40.3	3.3e-15
WP_002988380.1|751634_752924_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	74.9	1.5e-184
WP_002988384.1|752935_754438_+|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.6e-140
WP_002988386.1|754418_755981_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	1.6e-47
WP_002988389.1|755984_756170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988396.1|756555_756822_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	72.7	1.7e-26
WP_002990039.1|756965_757499_+	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	82.5	1.8e-14
WP_002990036.1|757508_757889_+	structural protein	NA	A0A0K2CNR0	Brevibacillus_phage	36.3	6.4e-06
WP_002990034.1|757891_758941_+|capsid	major capsid protein	capsid	B0YL60	Streptococcus_virus	56.9	2.6e-105
WP_002990031.1|758952_759219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990030.1|759230_759584_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	7.4e-25
WP_002990028.1|759580_759889_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	5.7e-13
WP_002984399.1|759869_760235_+	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	7.7e-17
WP_002990026.1|760231_760621_+	hypothetical protein	NA	Q38611	Lactococcus_phage	69.0	1.6e-44
WP_002990025.1|760630_761284_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	53.3	6.6e-43
WP_002990023.1|761343_761697_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	48.6	5.5e-20
WP_002988428.1|761738_762068_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	5.7e-11
WP_010922222.1|762082_765718_+	tape measure protein	NA	U6E979	Streptococcus_phage	28.0	4.0e-04
WP_002988434.1|765750_766530_+|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	55.6	9.2e-68
WP_002990019.1|766526_768578_+|tail	phage tail protein	tail	A3F656	Streptococcus_phage	83.8	0.0e+00
WP_002990017.1|768574_769696_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	73.3	1.9e-127
WP_002990016.1|769708_771622_+	gp58-like family protein	NA	Q938J9	Temperate_phage	61.3	2.7e-92
WP_002987333.1|771635_771797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990014.1|771799_772411_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	91.1	5.7e-81
WP_002990012.1|772421_772718_+	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_002990010.1|772714_772900_+	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_044565069.1|772985_774275_+	lysin	NA	Q5MY96	Streptococcus_phage	92.7	2.6e-237
WP_047373492.1|774548_775226_+	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
776323:776371	attR	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAA	NA	NA	NA	NA
>prophage 5
NZ_LS483401	Streptococcus pyogenes strain NCTC10085 chromosome 1	1795272	1308397	1381491	1795272	tRNA,portal,capsid,integrase,tail,terminase,head	Streptococcus_phage(74.55%)	86	1337286:1337302	1378087:1378103
WP_002988865.1|1308397_1310437_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002988863.1|1310814_1311732_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002983542.1|1312103_1312637_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_002988859.1|1312768_1313608_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.3	1.9e-50
WP_002988858.1|1313729_1314878_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002988856.1|1314995_1316627_-	Na/Pi cotransporter family protein	NA	A0A1B1ITU5	uncultured_Mediterranean_phage	38.8	2.7e-05
WP_002988854.1|1316828_1317551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988852.1|1317679_1318522_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	61.9	1.3e-91
WP_002988850.1|1318814_1319372_+	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	60.3	4.2e-14
WP_002988848.1|1319407_1320232_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002983523.1|1320233_1320851_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_002983521.1|1321047_1322025_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002988842.1|1322106_1322370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988840.1|1322523_1322940_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_002988838.1|1322954_1323380_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_011527719.1|1323637_1325089_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002988834.1|1325114_1325420_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002988832.1|1325412_1325886_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002988830.1|1326122_1326893_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	1.1e-20
WP_002988828.1|1327092_1327296_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_002988826.1|1327309_1329541_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.7	1.3e-114
WP_002988824.1|1329540_1329975_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002988822.1|1330146_1331136_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002988820.1|1331266_1331617_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002983491.1|1331822_1334684_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.2	4.5e-19
WP_002983488.1|1334703_1335006_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002983486.1|1334998_1335295_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002988817.1|1335310_1336468_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002988815.1|1336642_1337179_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
1337286:1337302	attL	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
WP_002988813.1|1337423_1337603_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.1	5.6e-21
WP_002988811.1|1337841_1339014_+	streptodornase Sda1	NA	A7J2B8	Streptococcus_phage	49.8	4.7e-76
WP_002988807.1|1339129_1340326_-	streptodornase Sda1	NA	Q938J4	Temperate_phage	82.2	6.1e-196
WP_002988802.1|1340436_1340622_-	hypothetical protein	NA	Q938J5	Temperate_phage	93.4	9.5e-24
WP_002988799.1|1340618_1340918_-	hypothetical protein	NA	Q938J6	Temperate_phage	82.3	3.5e-36
WP_002988797.1|1340928_1341549_-	hypothetical protein	NA	A3F662	Streptococcus_phage	88.8	8.3e-80
WP_002988795.1|1341551_1341713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988792.1|1341721_1343629_-	gp58-like family protein	NA	Q938J9	Temperate_phage	60.9	1.3e-134
WP_002988442.1|1343639_1344275_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	67.6	2.2e-75
WP_002988439.1|1344274_1345330_-	hypothetical protein	NA	A3F657	Streptococcus_phage	73.2	1.2e-126
WP_002988790.1|1345326_1347309_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.5	0.0e+00
WP_002988788.1|1347318_1348161_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	99.6	8.5e-160
WP_002988786.1|1348172_1352555_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	76.4	3.2e-226
WP_002983445.1|1352569_1352803_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	100.0	4.4e-34
WP_002983443.1|1352877_1353333_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	100.0	8.3e-77
WP_002988784.1|1353386_1353986_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	98.9	4.1e-92
WP_002988782.1|1353997_1354357_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	97.5	6.8e-58
WP_002988781.1|1354360_1354705_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	99.1	6.1e-56
WP_000639437.1|1354701_1354980_-	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_002988776.1|1354990_1355347_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	97.5	2.8e-56
WP_002988771.1|1355358_1356246_-	hypothetical protein	NA	A7J297	Streptococcus_phage	99.7	3.6e-161
WP_002988768.1|1356258_1356828_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	97.9	2.6e-80
WP_002988765.1|1356983_1357250_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	88.6	1.7e-34
WP_002983423.1|1357252_1357441_-	hypothetical protein	NA	A7J294	Streptococcus_phage	98.4	1.4e-22
WP_015446273.1|1357471_1358917_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	92.9	3.4e-257
WP_002988758.1|1358876_1360409_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	98.2	1.3e-286
WP_002988754.1|1360424_1361702_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	97.6	1.3e-241
WP_011106637.1|1361691_1362144_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_002988747.1|1362233_1362650_-	DUF722 domain-containing protein	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
WP_002988743.1|1362646_1362838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988740.1|1362827_1363679_-	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	71.9	1.5e-100
WP_002988738.1|1363687_1363954_-	hypothetical protein	NA	A7J287	Streptococcus_phage	65.2	5.4e-20
WP_002988735.1|1363950_1364118_-	hypothetical protein	NA	A7J285	Streptococcus_phage	94.5	1.9e-23
WP_002988733.1|1364118_1365441_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	98.4	1.9e-254
WP_002988730.1|1365437_1365713_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	100.0	9.1e-47
WP_011285674.1|1366099_1368484_-	DNA primase	NA	A7J282	Streptococcus_phage	94.4	4.1e-276
WP_002988723.1|1368488_1370411_-	DNA polymerase	NA	A7J280	Streptococcus_phage	96.7	0.0e+00
WP_002988718.1|1370453_1371011_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	57.9	2.5e-51
WP_002988715.1|1371021_1371420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988711.1|1371423_1372578_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	91.9	4.5e-204
WP_002988708.1|1372577_1372877_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_002988705.1|1372964_1373168_-	hypothetical protein	NA	A7J276	Streptococcus_phage	95.5	2.3e-31
WP_002988700.1|1373314_1373701_-	hypothetical protein	NA	A7J274	Streptococcus_phage	88.2	3.1e-56
WP_002988697.1|1373697_1373901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988693.1|1373893_1374064_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	6.9e-21
WP_002988687.1|1374060_1374336_-	hypothetical protein	NA	A7J272	Streptococcus_phage	95.6	5.9e-46
WP_002988684.1|1374397_1374613_-	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	76.8	4.2e-23
WP_002988681.1|1374660_1375074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988678.1|1375054_1375210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285676.1|1375484_1375886_+	helix-turn-helix transcriptional regulator	NA	A7J269	Streptococcus_phage	72.9	1.1e-40
WP_002988673.1|1375899_1376283_+	hypothetical protein	NA	A7J268	Streptococcus_phage	99.2	5.3e-69
WP_002988670.1|1376293_1376845_+	hypothetical protein	NA	A7J267	Streptococcus_phage	92.3	3.4e-85
WP_002988667.1|1376961_1378041_+|integrase	site-specific integrase	integrase	A7J266	Streptococcus_phage	86.9	1.3e-176
WP_002983387.1|1378238_1378874_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
1378087:1378103	attR	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
WP_002983385.1|1378873_1379665_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_002988663.1|1379728_1380763_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002983379.1|1380765_1381491_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-20
