The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483394	Streptococcus pyogenes strain NCTC10880 chromosome 1	1785401	36637	48951	1785401		Synechococcus_phage(28.57%)	8	NA	NA
WP_014635214.1|36637_40363_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	1.6e-40
WP_111694625.1|40523_41978_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	2.0e-52
WP_111694626.1|42005_43028_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	1.2e-62
WP_002986700.1|43195_43750_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_011054093.1|43933_45481_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_111694627.1|45539_46664_-	SH3 domain-containing protein	NA	A0A1S5PRY3	Streptococcus_phage	33.1	7.7e-07
WP_030127618.1|46916_48182_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_030127619.1|48459_48951_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	2.5e-18
>prophage 2
NZ_LS483394	Streptococcus pyogenes strain NCTC10880 chromosome 1	1785401	338542	344575	1785401		Streptococcus_phage(100.0%)	9	NA	NA
WP_014635306.1|338542_339178_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.0e-65
WP_002985844.1|339195_340071_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_038432817.1|340089_340329_+	Tpl protein	NA	NA	NA	NA	NA
WP_002985838.1|340733_341057_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_111694685.1|341061_341925_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.3	6.5e-115
WP_111694686.1|341951_342344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880724.1|342390_343020_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_111694687.1|343317_343674_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	2.8e-40
WP_002990895.1|343747_344575_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
>prophage 3
NZ_LS483394	Streptococcus pyogenes strain NCTC10880 chromosome 1	1785401	616457	627059	1785401		Streptococcus_phage(57.14%)	9	NA	NA
WP_044559748.1|616457_618668_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_002985142.1|618775_619939_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|619935_620622_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002990262.1|620715_621882_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002990260.1|621942_622284_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_111694751.1|622504_623857_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	4.5e-30
WP_111694752.1|623943_625212_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012560601.1|625241_625682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111694753.1|625916_627059_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.8e-24
>prophage 4
NZ_LS483394	Streptococcus pyogenes strain NCTC10880 chromosome 1	1785401	1065241	1171306	1785401	protease,portal,capsid,terminase,holin,integrase,tRNA,tail	Streptococcus_phage(45.59%)	110	1107580:1107599	1148985:1149004
WP_002995750.1|1065241_1065937_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002995753.1|1065955_1066717_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002989220.1|1066713_1066929_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063812309.1|1067289_1069908_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	1.5e-61
WP_063812310.1|1070294_1071350_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_063631966.1|1071412_1072120_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	5.7e-08
WP_111694868.1|1072185_1073382_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_111693281.1|1073757_1075563_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_111694869.1|1075575_1076538_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_011528761.1|1076832_1077549_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_009880651.1|1077667_1078372_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_111694870.1|1078573_1079602_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_111674951.1|1079608_1080829_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_085634525.1|1081516_1081765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023078840.1|1081793_1081976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023612500.1|1082142_1082748_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.7	1.8e-58
WP_111694871.1|1082844_1083885_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_111694872.1|1083955_1086199_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	59.2	5.2e-55
WP_111694873.1|1086179_1086842_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_172451595.1|1087041_1087782_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_111694874.1|1089160_1089937_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011017953.1|1089926_1090205_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	7.9e-06
WP_111694875.1|1090228_1092229_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	7.6e-66
WP_002989158.1|1092356_1093976_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_111694876.1|1094282_1095827_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.3	6.3e-36
WP_002983946.1|1096074_1096770_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_093974666.1|1096849_1098241_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002989146.1|1098431_1099478_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002983939.1|1099578_1100175_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_111694877.1|1100972_1101752_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_111694878.1|1101875_1102418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983930.1|1102578_1103100_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002983928.1|1103206_1103902_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_021299339.1|1104140_1105076_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	4.6e-66
WP_111694879.1|1105375_1107238_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.3	4.6e-89
1107580:1107599	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_011184726.1|1107768_1107951_-	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	2.0e-21
WP_011184727.1|1108190_1108949_+	DNase Mf2	NA	NA	NA	NA	NA
WP_002985327.1|1109059_1109767_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_023611694.1|1109835_1110588_-	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	97.2	2.1e-141
WP_003052353.1|1110589_1110922_-|holin	phage holin	holin	A3F664	Streptococcus_phage	100.0	5.7e-51
WP_111694880.1|1110923_1111253_-	hypothetical protein	NA	A3F663	Streptococcus_phage	99.0	6.2e-50
WP_111694881.1|1111263_1111875_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.2	3.7e-80
WP_111694882.1|1111877_1112306_-	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.2	2.8e-66
WP_111694883.1|1112314_1114138_-	gp58-like family protein	NA	Q938J9	Temperate_phage	79.8	4.2e-212
WP_032460574.1|1114148_1114478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127718.1|1114464_1115688_-	hypothetical protein	NA	A3F657	Streptococcus_phage	41.3	6.7e-49
WP_111694884.1|1115684_1117832_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.9	0.0e+00
WP_111674636.1|1117828_1118545_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	98.7	3.6e-135
WP_111694885.1|1118541_1121802_-	tape measure protein	NA	Q938K3	Temperate_phage	98.5	0.0e+00
WP_011284973.1|1121791_1122373_-	hypothetical protein	NA	Q938K4	Temperate_phage	99.5	4.9e-106
WP_010922086.1|1122376_1122811_-	hypothetical protein	NA	Q938K5	Temperate_phage	99.3	2.9e-71
WP_011054741.1|1122849_1123335_-	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
WP_010922084.1|1123334_1123733_-|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_010922083.1|1123729_1124086_-	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922082.1|1124085_1124418_-	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_111694886.1|1124407_1124824_-	hypothetical protein	NA	Q938K7	Temperate_phage	98.2	3.6e-55
WP_010922080.1|1124877_1125696_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_010922079.1|1125699_1126314_-	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
WP_111694887.1|1126439_1126706_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
WP_002986829.1|1126767_1127007_-	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
WP_111694888.1|1126978_1128457_-|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	99.6	9.0e-274
WP_010922075.1|1128461_1129964_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.6	5.9e-281
WP_172451596.1|1129977_1131261_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	84.1	2.0e-216
WP_050318691.1|1131253_1131949_-|terminase	terminase	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	34.5	4.4e-29
WP_011054881.1|1132068_1132485_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_011054882.1|1132617_1132890_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_164972002.1|1132882_1133053_-	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_111694889.1|1133053_1134376_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.7	3.0e-252
WP_050320439.1|1134372_1134648_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	98.9	3.5e-46
WP_111688312.1|1135033_1137418_-	DNA primase	NA	A7J282	Streptococcus_phage	94.6	8.2e-277
WP_111674645.1|1137422_1139345_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.4	0.0e+00
WP_111674646.1|1139387_1139951_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	59.0	8.7e-52
WP_023611034.1|1139959_1141117_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	97.9	3.0e-216
WP_002988708.1|1141116_1141416_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_023611025.1|1141504_1141708_-	hypothetical protein	NA	A7J276	Streptococcus_phage	98.5	1.6e-32
WP_111694890.1|1142197_1142584_-	hypothetical protein	NA	A7J274	Streptococcus_phage	87.4	1.4e-56
WP_023611037.1|1142789_1142960_-	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_014411880.1|1142961_1143273_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_023611028.1|1143379_1143595_+	hypothetical protein	NA	A0A1S5SA41	Streptococcus_phage	61.4	1.9e-15
WP_023611035.1|1143568_1143817_-	hypothetical protein	NA	A0A141E1M0	Streptococcus_phage	69.5	1.6e-26
WP_011017885.1|1143896_1144106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611024.1|1144247_1144508_+	hypothetical protein	NA	M1PS67	Streptococcus_phage	70.9	5.8e-27
WP_111688314.1|1144606_1145260_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	59.7	4.4e-71
WP_002993390.1|1145271_1145463_-	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
WP_020837421.1|1146098_1146194_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_111688316.1|1146616_1146964_+	helix-turn-helix transcriptional regulator	NA	Q7Y4M0	Streptococcus_phage	69.2	1.8e-39
WP_002994744.1|1146967_1147348_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	61.1	8.0e-41
WP_076634078.1|1147359_1147626_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_003051793.1|1147754_1148897_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1148986_1149262_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1148985:1149004	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_002989129.1|1149360_1149948_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002992620.1|1149925_1150768_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_172451597.1|1150760_1151612_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_111694891.1|1151826_1152765_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983909.1|1152936_1154598_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_111694892.1|1154619_1155090_-	arginine repressor	NA	NA	NA	NA	NA
WP_003056952.1|1155076_1155904_-	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_011284950.1|1155896_1156769_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002983901.1|1156768_1156984_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_032465119.1|1156961_1158302_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	1.4e-39
WP_010922486.1|1158454_1159309_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_002989112.1|1159516_1161211_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_023610117.1|1161388_1162798_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	8.8e-61
WP_002989107.1|1162946_1163681_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_023610107.1|1163680_1164367_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002983885.1|1164493_1164724_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_111694893.1|1165021_1167304_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.7	4.8e-125
WP_023610128.1|1167431_1167887_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002983878.1|1167937_1168240_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_030126392.1|1168504_1171306_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	27.0	1.4e-70
