The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	30321	42634	1908146		Synechococcus_phage(28.57%)	8	NA	NA
WP_111688211.1|30321_34047_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	7.8e-40
WP_023611320.1|34207_35662_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	1.7e-54
WP_002987707.1|35689_36712_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	4.0e-63
WP_002987709.1|36879_37434_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_002987711.1|37617_39165_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_063631516.1|39222_40347_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_111688212.1|40599_41865_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|42142_42634_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	611660	667301	1908146	holin,portal,capsid,tail,terminase,integrase,protease	Streptococcus_phage(64.81%)	70	629989:630008	665068:665087
WP_002983882.1|611660_613943_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_002983885.1|614240_614471_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_002983887.1|614597_615284_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_063631453.1|615283_616018_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	4.8e-34
WP_063631454.1|616166_617576_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	2.6e-60
WP_002989112.1|617753_619448_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_010922486.1|619655_620510_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_014407687.1|620662_622003_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
WP_002983901.1|621980_622196_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011284950.1|622195_623068_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011054705.1|623060_623888_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002983907.1|623874_624345_+	arginine repressor	NA	NA	NA	NA	NA
WP_063631455.1|624366_626028_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_111688263.1|626199_627165_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983913.1|627380_628232_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_063631457.1|628224_629067_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989129.1|629044_629632_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|629730_630006_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
629989:630008	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_003051793.1|630094_631237_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_011528799.1|631360_631879_-	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	1.6e-31
WP_010922480.1|631890_632646_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922479.1|632847_633060_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922478.1|633329_633641_+	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922477.1|633642_633828_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
WP_011017564.1|634331_634718_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_010922205.1|634698_634932_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
WP_002988354.1|634928_635069_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988357.1|635077_635284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528796.1|635339_635669_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	84.4	7.1e-46
WP_011054700.1|635671_636598_+	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_000594115.1|636594_636795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054699.1|636787_637585_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	83.8	1.3e-130
WP_011054698.1|637949_638345_+	hypothetical protein	NA	A8ATL9	Listeria_phage	52.3	1.4e-19
WP_011184741.1|639698_640031_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	67.0	8.8e-36
WP_011054695.1|640027_640540_+	hypothetical protein	NA	M1PFM2	Streptococcus_phage	85.9	1.7e-78
WP_011054694.1|640575_640893_+	DUF1372 family protein	NA	A1EAD7	Streptococcus_phage	71.4	9.0e-30
WP_011054693.1|640889_641045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054692.1|641041_641293_+	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	1.6e-18
WP_011528791.1|641368_641788_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	6.7e-57
WP_011054690.1|641895_642240_+	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	3.2e-41
WP_002994106.1|642387_642744_+	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_010922468.1|642740_644009_+|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
WP_010922467.1|644001_645495_+	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
WP_002994100.1|645500_645725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054745.1|645776_646043_+	hypothetical protein	NA	Q938K9	Temperate_phage	100.0	1.5e-38
WP_021299324.1|646362_647778_+|terminase	phage terminase large subunit-like protein	terminase	A0A0B5A091	Streptococcus_phage	74.6	2.0e-214
WP_010922462.1|647857_648319_+	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	4.5e-38
WP_011528788.1|648343_649255_+|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	2.2e-113
WP_010922460.1|649254_649455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054682.1|649464_649887_+	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
WP_011054681.1|649846_650185_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_000032787.1|650177_650414_+	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_011528787.1|650414_650750_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	1.7e-34
WP_014635577.1|650761_651340_+	hypothetical protein	NA	A0A1X9I5X2	Streptococcus_phage	62.9	2.9e-58
WP_003047548.1|651350_651614_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	54.7	1.7e-18
WP_011528785.1|651628_652000_+	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	59.2	1.2e-33
WP_011528784.1|651999_654357_+	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.3	2.6e-134
WP_002992579.1|654353_655049_+	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	32.2	4.7e-07
WP_028797149.1|655030_657007_+|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.9	8.0e-100
WP_011528782.1|657003_658119_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	66.6	4.8e-110
WP_011528781.1|658133_659915_+	hypothetical protein	NA	Q938J9	Temperate_phage	40.2	1.5e-65
WP_011528780.1|659923_660352_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	87.9	3.7e-63
WP_011528779.1|660354_660987_+	hypothetical protein	NA	Q938J7	Temperate_phage	50.5	4.0e-45
WP_011017397.1|660998_661271_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_003058873.1|661267_661495_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_014635574.1|661613_662831_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.1	1.1e-163
WP_002985327.1|662899_663607_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_014635573.1|663717_664476_-	DNase Mf2	NA	NA	NA	NA	NA
WP_014635572.1|664715_664898_+	hypothetical protein	NA	A3F673	Streptococcus_phage	80.0	1.7e-20
WP_011284945.1|665438_667301_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	5.4e-90
665068:665087	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
>prophage 3
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	778464	859407	1908146	holin,capsid,tail,protease,terminase,head,tRNA,integrase,portal	Streptococcus_phage(55.56%)	93	781830:781889	825960:826055
WP_032464409.1|778464_780729_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_063629276.1|780984_781605_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
781830:781889	attL	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGA	NA	NA	NA	NA
WP_111688273.1|781967_783056_-|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	6.1e-203
WP_011106738.1|783175_783481_-	membrane protein	NA	NA	NA	NA	NA
WP_021340822.1|783490_784279_-	peptidase S24	NA	A0A1S5SD15	Streptococcus_phage	62.6	2.9e-85
WP_021340823.1|784453_784600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111688274.1|784596_785103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340169.1|785152_785392_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	97.5	3.1e-35
WP_029714276.1|785403_785667_+	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	98.9	3.6e-40
WP_011054584.1|785703_786000_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	100.0	2.1e-49
WP_165357622.1|785996_786134_+	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	91.1	5.4e-16
WP_021340847.1|786149_786464_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	95.2	1.2e-50
WP_021340846.1|786692_787175_+	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	98.8	7.9e-78
WP_002995975.1|787175_787856_+	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
WP_021340851.1|787957_789187_+	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	99.8	1.3e-236
WP_002995969.1|789202_789661_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	100.0	3.8e-82
WP_014411877.1|789663_790476_+	bifunctional DNA primase/polymerase	NA	A0A1P8VVM6	Streptococcus_phage	97.4	1.3e-152
WP_021340849.1|790465_791941_+	nucleoside triphosphatase	NA	A0A1P8VVM0	Streptococcus_phage	87.1	2.0e-249
WP_032459901.1|792544_792865_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	94.3	5.5e-51
WP_032459900.1|792848_793205_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	96.6	4.6e-59
WP_011018137.1|793446_793731_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	97.9	2.7e-49
WP_021340843.1|793727_794141_+	hypothetical protein	NA	Q938M1	Temperate_phage	63.8	2.4e-35
WP_032459898.1|794137_794422_+	hypothetical protein	NA	A3F628	Streptococcus_phage	91.5	8.6e-40
WP_021340844.1|794425_794911_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	4.6e-94
WP_021340166.1|794914_795142_+	hypothetical protein	NA	A3F630	Streptococcus_phage	76.0	1.9e-26
WP_002987468.1|795239_795641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340848.1|795640_796276_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.4	2.5e-87
WP_011017866.1|796548_796989_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_011284864.1|797760_798675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990048.1|798764_798977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002987543.1|799292_799670_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|799721_799907_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_029714359.1|800142_800484_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	89.8	9.6e-54
WP_002985371.1|800651_801119_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_021340859.1|801133_802888_+|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.1	0.0e+00
WP_002985365.1|802884_803055_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_002985363.1|803047_803272_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_111688275.1|803305_804526_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	5.8e-186
WP_021341093.1|804503_805169_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	77.2	5.6e-90
WP_021340812.1|805193_806378_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.6	1.5e-162
WP_021340811.1|806522_806825_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	88.8	3.0e-43
WP_003055344.1|806821_807169_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	80.9	2.6e-46
WP_003055321.1|807165_807543_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	76.0	1.5e-47
WP_011017584.1|807539_807965_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
WP_011017585.1|807980_808589_+	hypothetical protein	NA	J7KKC8	Streptococcus_phage	71.9	6.7e-74
WP_011017586.1|808641_808968_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
WP_021299462.1|809015_809165_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_021340814.1|809177_813101_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.5	1.9e-238
WP_111688276.1|813100_813808_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	69.8	1.1e-91
WP_111688277.1|813804_815952_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	93.1	0.0e+00
WP_168625266.1|815951_817064_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	73.3	8.4e-123
WP_111686356.1|817073_819089_+	gp58-like family protein	NA	Q938J9	Temperate_phage	84.2	3.2e-213
WP_021340778.1|819100_819532_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	99.3	5.2e-73
WP_021340776.1|819534_820140_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	98.0	4.8e-88
WP_011017397.1|820157_820430_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_011017843.1|820426_820654_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_012560948.1|820769_821978_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	85.6	1.5e-210
WP_011017840.1|822116_822641_+	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011054729.1|822628_823495_+	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
WP_014635497.1|823798_824512_+	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	59.5	9.0e-78
WP_021340779.1|824793_825582_+	streptococcal pyrogenic exotoxin SpeL	NA	Q938J1	Temperate_phage	41.4	9.1e-47
WP_011054546.1|825696_825885_+	hypothetical protein	NA	A3F673	Streptococcus_phage	84.7	1.2e-21
WP_011285558.1|826475_827090_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	1.1e-50
825960:826055	attR	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGATTACTTACGGTAAGCATTGATGGAGCTGGTGGGAGT	NA	NA	NA	NA
WP_002984433.1|827216_828002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038434125.1|828011_828710_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002989617.1|828709_829081_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038434124.1|829265_832376_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	8.3e-120
WP_002984444.1|832455_833469_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002984447.1|833530_835033_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984449.1|835250_835808_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011284834.1|835983_837798_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.2e-97
WP_002989626.1|837993_838329_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002992417.1|838435_839077_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002992415.1|839086_839716_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.8e-28
WP_038434123.1|839731_840568_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023078574.1|840937_841711_+	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_038434122.1|842080_843316_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_012560755.1|843435_844758_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_002989648.1|845286_847605_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-131
WP_002984469.1|847968_848217_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010922368.1|848253_848865_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984473.1|848875_849064_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984475.1|849076_849616_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002989656.1|849656_849857_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	53.0	3.6e-08
WP_002994467.1|849867_850356_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_111688278.1|850518_851160_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989661.1|851302_851845_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989664.1|851962_852664_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_038434121.1|852678_855315_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002993908.1|855406_856003_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002989673.1|856013_856970_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_111688279.1|857066_858407_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_038434120.1|858522_859407_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	1010568	1154948	1908146	portal,tail,protease,terminase,head,tRNA,integrase,capsid	Streptococcus_phage(76.64%)	160	1110419:1110467	1152176:1152224
WP_111688296.1|1010568_1011945_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_111688297.1|1012012_1013422_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002989923.1|1013546_1014149_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_063631353.1|1014333_1016130_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_111688298.1|1016231_1017629_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002984833.1|1017743_1018790_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002984836.1|1018783_1019572_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012560683.1|1019575_1021225_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	1.8e-12
WP_002989931.1|1021360_1022188_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_038434067.1|1022184_1022994_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002989934.1|1023010_1023502_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_011528592.1|1023520_1023946_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_038434066.1|1024152_1025172_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_038434065.1|1025301_1025739_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_111688300.1|1027542_1029375_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
WP_029714017.1|1030128_1030311_-	hypothetical protein	NA	A3F673	Streptococcus_phage	71.7	1.0e-17
WP_011054450.1|1030509_1030719_-	helix-turn-helix transcriptional regulator	NA	A3F668	Streptococcus_phage	100.0	1.2e-30
WP_011054449.1|1030872_1031019_+	hypothetical protein	NA	A3F667	Streptococcus_phage	97.9	4.0e-17
WP_011054448.1|1031159_1031411_+	hypothetical protein	NA	A3F666	Streptococcus_phage	96.4	2.8e-42
WP_011054447.1|1031674_1031914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063808249.1|1031971_1032328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063629047.1|1032444_1033650_-	glucosaminidase domain-containing protein	NA	A7J2B5	Streptococcus_phage	82.5	3.2e-200
WP_011184796.1|1033762_1033948_-	hypothetical protein	NA	Q938J5	Temperate_phage	98.4	6.6e-25
WP_011018110.1|1033944_1034244_-	hypothetical protein	NA	Q938J6	Temperate_phage	93.8	1.9e-42
WP_029714007.1|1034254_1034872_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	87.8	1.0e-77
WP_011018112.1|1034874_1035303_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	78.6	1.9e-54
WP_011018113.1|1035314_1037330_-	gp58-like family protein	NA	Q938J9	Temperate_phage	73.2	2.4e-176
WP_111688302.1|1037344_1038349_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	63.0	1.4e-108
WP_111688303.1|1038345_1040397_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	84.0	0.0e+00
WP_063808240.1|1040393_1041164_-|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	87.1	7.8e-128
WP_063633123.1|1041176_1045277_-|tail	phage tail tape measure protein	tail	A3F654	Streptococcus_phage	68.5	0.0e+00
WP_063633122.1|1045502_1045805_-	hypothetical protein	NA	A3F652	Streptococcus_phage	97.0	3.1e-48
WP_063633121.1|1045897_1046482_-|tail	phage tail protein	tail	A3F651	Streptococcus_phage	90.2	1.6e-93
WP_063633120.1|1046493_1046874_-	hypothetical protein	NA	A3F650	Streptococcus_phage	97.6	2.4e-61
WP_011017387.1|1046866_1047265_-	HK97 gp10 family phage protein	NA	A3F649	Streptococcus_phage	100.0	2.9e-70
WP_063633119.1|1047266_1047629_-	hypothetical protein	NA	A3F648	Streptococcus_phage	96.7	2.1e-59
WP_063633118.1|1047621_1047930_-	hypothetical protein	NA	A3F647	Streptococcus_phage	92.2	8.1e-44
WP_165363099.1|1047929_1048103_-	hypothetical protein	NA	A3F646	Streptococcus_phage	93.0	1.1e-21
WP_063808241.1|1048113_1049247_-|capsid	phage major capsid protein	capsid	A3F645	Streptococcus_phage	95.8	3.9e-200
WP_063808242.1|1049263_1050070_-|protease	Clp protease ClpP	protease	A3F644	Streptococcus_phage	98.9	1.2e-147
WP_063633115.1|1050050_1051238_-|portal	phage portal protein	portal	A3F643	Streptococcus_phage	96.5	3.3e-218
WP_032461344.1|1051390_1051615_-	hypothetical protein	NA	A3F642	Streptococcus_phage	97.3	2.0e-36
WP_011017380.1|1051605_1053336_-|terminase	terminase large subunit	terminase	A3F641	Streptococcus_phage	97.0	0.0e+00
WP_011017379.1|1053348_1053666_-|terminase	P27 family phage terminase small subunit	terminase	A3F640	Streptococcus_phage	99.0	3.9e-49
WP_011054436.1|1053806_1054079_-	HNH endonuclease	NA	A3F639	Streptococcus_phage	95.6	4.8e-48
WP_011017377.1|1054104_1054491_-	hypothetical protein	NA	A3F638	Streptococcus_phage	93.0	1.4e-64
WP_011017376.1|1054516_1054720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017375.1|1054777_1055071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054435.1|1055224_1055800_-|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	99.5	7.4e-107
WP_011017373.1|1055959_1056361_-	hypothetical protein	NA	A3F635	Streptococcus_phage	100.0	2.7e-71
WP_011017372.1|1056375_1057203_-	prohibitin family protein	NA	A3F634	Streptococcus_phage	100.0	1.3e-117
WP_011017371.1|1057205_1057544_-	helix-turn-helix transcriptional regulator	NA	A3F633	Streptococcus_phage	92.9	1.1e-54
WP_011054431.1|1057540_1057822_-	hypothetical protein	NA	A3F632	Streptococcus_phage	92.2	4.5e-33
WP_011017369.1|1058224_1058446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017368.1|1058442_1058928_-	DUF1642 domain-containing protein	NA	A0A1S5S9L5	Streptococcus_phage	41.4	5.6e-23
WP_023611652.1|1058932_1059565_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	65.7	5.9e-81
WP_033888177.1|1059566_1060052_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	83.8	3.5e-81
WP_011017366.1|1060054_1060324_-	hypothetical protein	NA	A7J287	Streptococcus_phage	80.9	1.4e-28
WP_023611649.1|1060320_1060491_-	hypothetical protein	NA	Q938M0	Temperate_phage	55.4	2.7e-09
WP_011017365.1|1060487_1060931_-	hypothetical protein	NA	A0A1C9LX52	Streptococcus_phage	55.0	1.6e-32
WP_032467212.1|1061086_1061314_-	hypothetical protein	NA	C5J991	Streptococcus_phage	49.3	9.3e-13
WP_023611651.1|1061313_1062126_-	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	77.6	6.8e-122
WP_011017361.1|1062125_1062887_-	conserved phage C-terminal domain-containing protein	NA	A0A220GFI5	Streptococcus_phage	56.1	9.1e-28
WP_011106800.1|1062879_1064235_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	84.7	9.3e-209
WP_032461348.1|1064206_1064395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017359.1|1064515_1064707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054421.1|1064799_1065057_-	hypothetical protein	NA	A3F618	Streptococcus_phage	98.8	5.4e-41
WP_011017357.1|1065130_1065850_-	ORF6C domain-containing protein	NA	A3F617	Streptococcus_phage	78.7	4.6e-106
WP_032464978.1|1065901_1066402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054420.1|1066729_1066942_-	helix-turn-helix transcriptional regulator	NA	M1Q1B4	Streptococcus_phage	52.9	1.7e-13
WP_011017354.1|1066976_1067252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017353.1|1067540_1067891_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	63.5	1.2e-35
WP_011017352.1|1067894_1068287_+	hypothetical protein	NA	A3F612	Streptococcus_phage	68.7	2.2e-38
WP_011017351.1|1068297_1069038_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A3F611	Streptococcus_phage	100.0	1.6e-130
WP_011017350.1|1069348_1070545_+|integrase	site-specific integrase	integrase	A3F610	Streptococcus_phage	99.0	3.9e-227
WP_063631343.1|1070752_1071415_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_063631342.1|1071404_1071746_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_111688304.1|1071742_1072612_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_063631341.1|1072611_1076715_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_063631340.1|1077160_1077793_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_063631339.1|1077792_1078557_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_063631338.1|1078556_1079309_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_063631337.1|1079318_1080449_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_023080006.1|1080511_1081153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063631336.1|1081277_1082633_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002984857.1|1082686_1083643_-	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_002984858.1|1083639_1084491_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_011284741.1|1084597_1085941_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_063631335.1|1085940_1086732_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002992006.1|1086840_1087830_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	25.2	8.2e-13
WP_063631334.1|1088062_1090480_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_002989978.1|1091153_1092917_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.5	1.2e-33
WP_111688305.1|1093243_1094653_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_002989981.1|1094837_1095836_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_023613204.1|1095894_1096863_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_038434054.1|1097147_1099055_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	3.4e-55
WP_002989987.1|1099100_1099427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038434053.1|1099456_1100242_-	esterase family protein	NA	NA	NA	NA	NA
WP_009880824.1|1100374_1102036_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002989991.1|1102239_1102998_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
WP_038434052.1|1102994_1103864_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023610992.1|1104208_1105207_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038434051.1|1105560_1107213_+	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_002990000.1|1107271_1108519_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011284730.1|1108508_1109690_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002984880.1|1109747_1110224_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
1110419:1110467	attL	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_010922229.1|1110827_1111538_-	streptococcal pyrogenic exotoxin SpeH	NA	NA	NA	NA	NA
WP_047373492.1|1111563_1112241_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
WP_111688306.1|1112514_1113849_-	lysin	NA	Q5MY96	Streptococcus_phage	92.6	1.4e-246
WP_002990010.1|1113960_1114146_-	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_002990012.1|1114142_1114439_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_046166091.1|1114448_1115060_-	phage protein	NA	A7J2B1	Streptococcus_phage	89.7	1.8e-82
WP_002988795.1|1115062_1115224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111688307.1|1115232_1117251_-	gp58-like family protein	NA	Q938J9	Temperate_phage	53.1	4.6e-119
WP_111688308.1|1117263_1118385_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	72.2	1.8e-128
WP_111688309.1|1118381_1120361_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	93.6	0.0e+00
WP_011054865.1|1120370_1121213_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.9	8.8e-157
WP_011888929.1|1121224_1125607_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	75.2	2.5e-226
WP_011888930.1|1125621_1125855_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	98.7	1.3e-33
WP_011888931.1|1125929_1126385_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	99.3	5.3e-76
WP_011054869.1|1126438_1127038_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054870.1|1127049_1127409_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_111688310.1|1127412_1127757_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	97.4	1.1e-54
WP_011054872.1|1127753_1128032_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011888932.1|1128042_1128399_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	99.2	7.9e-59
WP_002983429.1|1128410_1129298_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011888933.1|1129310_1129880_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	100.0	1.9e-83
WP_011888934.1|1130041_1130308_-	hypothetical protein	NA	Q938K9	Temperate_phage	96.6	2.9e-37
WP_011054876.1|1130312_1130501_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_111688311.1|1130528_1131977_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.4	1.3e-277
WP_038433243.1|1131936_1133469_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.8	4.5e-292
WP_063632647.1|1133484_1134762_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	99.5	6.9e-246
WP_011106637.1|1134751_1135204_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_011888938.1|1135293_1135710_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	98.6	9.5e-72
WP_011054882.1|1135842_1136115_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_164972002.1|1136107_1136278_-	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_109981995.1|1136278_1137601_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.5	1.1e-251
WP_050320439.1|1137597_1137873_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	98.9	3.5e-46
WP_111688312.1|1138258_1140643_-	DNA primase	NA	A7J282	Streptococcus_phage	94.6	8.2e-277
WP_111688313.1|1140647_1142570_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.3	0.0e+00
WP_111674646.1|1142612_1143176_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	59.0	8.7e-52
WP_023611034.1|1143184_1144342_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	97.9	3.0e-216
WP_002988708.1|1144341_1144641_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_023611025.1|1144729_1144933_-	hypothetical protein	NA	A7J276	Streptococcus_phage	98.5	1.6e-32
WP_023611037.1|1146015_1146186_-	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_014411880.1|1146187_1146499_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_023611028.1|1146605_1146821_+	hypothetical protein	NA	A0A1S5SA41	Streptococcus_phage	61.4	1.9e-15
WP_023611035.1|1146794_1147043_-	hypothetical protein	NA	A0A141E1M0	Streptococcus_phage	69.5	1.6e-26
WP_011017885.1|1147122_1147332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611024.1|1147473_1147734_+	hypothetical protein	NA	M1PS67	Streptococcus_phage	70.9	5.8e-27
WP_111688314.1|1147832_1148486_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	59.7	4.4e-71
WP_002993390.1|1148497_1148689_-	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
WP_111688315.1|1149324_1149567_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_111688316.1|1149842_1150190_+	helix-turn-helix transcriptional regulator	NA	Q7Y4M0	Streptococcus_phage	69.2	1.8e-39
WP_002994744.1|1150193_1150574_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	61.1	8.0e-41
WP_076634078.1|1150585_1150852_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_011888953.1|1150979_1152119_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	1.2e-119
WP_011284729.1|1152201_1153242_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
1152176:1152224	attR	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_002990099.1|1153485_1154079_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_011284728.1|1154078_1154948_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
>prophage 5
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	1257096	1267699	1908146		Streptococcus_phage(57.14%)	9	NA	NA
WP_011184383.1|1257096_1258239_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
WP_038434003.1|1258473_1258914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038434002.1|1258943_1260212_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_038434000.1|1260299_1261652_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	1.7e-29
WP_038433999.1|1261872_1262214_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	3.4e-19
WP_111688317.1|1262274_1263441_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	33.6	3.7e-36
WP_002985140.1|1263534_1264221_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1264217_1265381_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_011054348.1|1265488_1267699_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
>prophage 6
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	1438215	1444865	1908146	portal	Streptococcus_phage(66.67%)	11	NA	NA
WP_010922009.1|1438215_1439040_-	asparagine ligase A	NA	M1PB22	Moumouvirus	33.1	6.2e-22
WP_011285437.1|1439063_1439402_-	Fic family protein	NA	NA	NA	NA	NA
WP_011285436.1|1439818_1440133_-	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	64.5	4.9e-20
WP_010922006.1|1440198_1440651_-|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	84.9	4.4e-62
WP_010922005.1|1440755_1441028_-	hypothetical protein	NA	E4ZFM1	Streptococcus_phage	48.1	1.2e-06
WP_011285435.1|1441046_1441352_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002991611.1|1441351_1441654_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_015055928.1|1441708_1441885_-	prophage LambdaSa04	NA	M1PSF2	Streptococcus_phage	86.2	3.2e-21
WP_136040166.1|1441900_1442794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922001.1|1442793_1443018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030127191.1|1444655_1444865_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	61.5	9.8e-17
>prophage 7
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	1554897	1560932	1908146		Streptococcus_phage(100.0%)	8	NA	NA
WP_002990895.1|1554897_1555725_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
WP_038433921.1|1555798_1556155_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	3.1e-39
WP_038433920.1|1556454_1557084_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023609786.1|1557130_1557523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111688343.1|1557549_1558413_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	3.8e-115
WP_002985838.1|1558417_1558741_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002995107.1|1559403_1560279_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	48.3	6.3e-73
WP_002990917.1|1560296_1560932_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
>prophage 8
NZ_LS483389	Streptococcus pyogenes strain NCTC10879 chromosome 1	1908146	1856671	1867696	1908146	integrase	Streptococcus_phage(76.92%)	16	1855816:1855833	1867791:1867808
1855816:1855833	attL	TTAAAGCATTTTGTTATA	NA	NA	NA	NA
WP_003057167.1|1856671_1857103_-	DUF1492 domain-containing protein	NA	A0A1S5SFS8	Streptococcus_phage	26.8	3.6e-05
WP_003057160.1|1857601_1858105_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	50.6	8.6e-43
WP_003057164.1|1858198_1858729_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	55.9	2.5e-48
WP_000694575.1|1858749_1858923_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	78.9	1.8e-16
WP_003058303.1|1859259_1860762_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	37.2	2.0e-63
WP_003058307.1|1860781_1861651_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	75.4	1.8e-125
WP_003058305.1|1861785_1862067_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	75.6	2.5e-31
WP_003058293.1|1862059_1862392_-	DNA-binding protein	NA	A0A1X9I5Z6	Streptococcus_phage	46.5	2.5e-14
WP_003058300.1|1862403_1862604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003058296.1|1862596_1862806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003058310.1|1862802_1863231_-	hypothetical protein	NA	A0A1X9I5T7	Streptococcus_phage	77.5	7.8e-61
WP_016481383.1|1863605_1863794_-	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	42.6	1.2e-05
WP_111688375.1|1863983_1864604_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	53.8	1.1e-18
WP_003055091.1|1864978_1865983_+	hypothetical protein	NA	Q331X4	Clostridium_botulinum_C_phage	28.1	6.8e-15
WP_003055128.1|1865982_1866435_+	Fic family protein	NA	NA	NA	NA	NA
WP_172451781.1|1866523_1867696_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	74.7	1.6e-164
1867791:1867808	attR	TTAAAGCATTTTGTTATA	NA	NA	NA	NA
