The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483387	Streptococcus agalactiae strain NCTC8187 chromosome 1	2052456	30639	42704	2052456		Microbacterium_phage(14.29%)	8	NA	NA
WP_001042263.1|30639_34365_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	1.6e-40
WP_000220677.1|34598_36053_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	4.9e-54
WP_001291325.1|36080_37103_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	44.6	9.6e-65
WP_000685111.1|37270_37822_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	1.8e-25
WP_000780020.1|37841_38594_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000166559.1|38613_40161_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.6	5.7e-77
WP_001045908.1|40353_41253_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783424.1|41399_42704_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
NZ_LS483387	Streptococcus agalactiae strain NCTC8187 chromosome 1	2052456	572456	580010	2052456	transposase,integrase	Streptococcus_phage(50.0%)	11	565801:565816	583290:583305
565801:565816	attL	GAAAATAAATAAAATT	NA	NA	NA	NA
WP_000595708.1|572456_573653_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	4.6e-103
WP_001068667.1|574232_574580_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071659971.1|574724_575339_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_001872365.1|575341_575608_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|575607_576012_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|576173_576374_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|576395_576656_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|576781_576991_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_000508795.1|577163_577325_-	NINE protein	NA	NA	NA	NA	NA
WP_000594360.1|578066_579344_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000353149.1|579353_580010_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
583290:583305	attR	GAAAATAAATAAAATT	NA	NA	NA	NA
>prophage 3
NZ_LS483387	Streptococcus agalactiae strain NCTC8187 chromosome 1	2052456	1513203	1523937	2052456		Streptococcus_phage(84.62%)	14	NA	NA
WP_000767485.1|1513203_1514031_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.4	5.1e-125
WP_000287943.1|1514071_1514428_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_000966772.1|1514429_1514906_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
WP_000232152.1|1514962_1516144_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.3	1.1e-168
WP_001167085.1|1516206_1516755_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000158399.1|1516822_1517914_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	78.0	1.7e-165
WP_000603275.1|1518046_1518682_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425864.1|1518951_1519821_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.7	3.7e-110
WP_000358198.1|1519820_1520147_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364569.1|1520177_1521041_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.7	1.2e-73
WP_000715591.1|1521060_1521696_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	4.9e-67
WP_001144244.1|1521784_1522444_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	6.2e-65
WP_000178149.1|1522462_1523173_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
WP_001185985.1|1523172_1523937_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	2.6e-14
>prophage 4
NZ_LS483387	Streptococcus agalactiae strain NCTC8187 chromosome 1	2052456	1994617	2010970	2052456	integrase	Streptococcus_phage(66.67%)	27	1994241:1994260	2008373:2008392
1994241:1994260	attL	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_000781299.1|1994617_1995310_-	DUF3800 domain-containing protein	NA	A0A059T7P7	Listeria_phage	48.9	1.0e-54
WP_000282152.1|1995422_1995650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000347604.1|1995788_1995974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001870676.1|1996004_1996382_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_001274638.1|1996356_1996719_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_000891800.1|1997120_1997609_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	7.3e-47
WP_001258769.1|1997682_1998240_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	58.9	4.2e-30
WP_001870672.1|1998320_1999142_-	DnaD domain protein	NA	R9QM95	Lactococcus_phage	68.7	1.2e-30
WP_000492121.1|1999310_1999583_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	70.9	1.1e-28
WP_000174499.1|1999575_1999917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206023.1|1999913_2000276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001870683.1|2000287_2000479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111695112.1|2000478_2000811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259476.1|2000899_2001406_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	35.6	2.2e-06
WP_017645779.1|2001491_2001668_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000130289.1|2001893_2002067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021393.1|2002165_2002804_-	Bro-N domain-containing protein	NA	NA	NA	NA	NA
WP_000648623.1|2003026_2003269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111695113.1|2003295_2003916_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	43.0	2.9e-40
WP_000359663.1|2003939_2004140_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001080841.1|2004345_2004960_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	68.7	2.6e-17
WP_000946250.1|2004971_2005259_+	DUF3102 domain-containing protein	NA	A0A286QMZ8	Streptococcus_phage	61.4	1.9e-10
WP_000429452.1|2005797_2006763_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.1	9.3e-86
WP_047209011.1|2007101_2008268_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	69.8	2.5e-154
WP_000092759.1|2008374_2008986_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2008373:2008392	attR	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_001278152.1|2009315_2009603_-	Veg family protein	NA	NA	NA	NA	NA
WP_000852645.1|2009614_2010970_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
>prophage 5
NZ_LS483387	Streptococcus agalactiae strain NCTC8187 chromosome 1	2052456	2019290	2026494	2052456		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001042660.1|2019290_2019995_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J6C5	uncultured_Caudovirales_phage	56.6	3.2e-27
WP_000029067.1|2020100_2020640_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	46.4	3.0e-17
WP_000359358.1|2020855_2021650_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000510606.1|2021642_2022485_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.0e-15
WP_000181757.1|2022460_2023300_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.0e-16
WP_000239224.1|2023299_2023842_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000217765.1|2023964_2025248_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	23.6	1.6e-05
WP_000706190.1|2025249_2026494_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.5	1.7e-87
