The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483369	Neisseria cinerea strain NCTC10294 chromosome 1	1832904	439220	557534	1832904	protease,integrase,tRNA,portal,terminase,capsid,head,tail	uncultured_Caudovirales_phage(12.0%)	115	450143:450169	551476:551502
WP_111726613.1|439220_440060_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_111726615.1|440278_440926_+	adenylate kinase	NA	NA	NA	NA	NA
WP_111726617.1|441032_441773_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_111726619.1|441827_442790_+	ADP-heptose synthase	NA	M4QF80	Synechococcus_phage	29.6	1.0e-15
WP_111726621.1|442855_443860_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	33.3	3.0e-26
WP_167395518.1|443937_445479_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.7	9.6e-101
WP_079870635.1|445595_445679_+	DNA-damage-inducible D domain protein	NA	NA	NA	NA	NA
WP_111726625.1|445823_446417_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	27.8	1.8e-07
WP_167395586.1|446433_446961_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_111726628.1|447039_450138_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.9	4.5e-25
450143:450169	attL	ATGCCGTCTGAAATTTCAGACGGCATT	NA	NA	NA	NA
WP_111726630.1|450176_452468_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.7e-168
WP_111726632.1|452469_452772_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_003682902.1|453021_453225_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	78.8	2.6e-22
WP_111726634.1|453550_454882_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_107996968.1|455034_455547_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_111726636.1|455593_456307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726639.1|456375_458076_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.1	2.6e-67
WP_111726640.1|458138_459062_+	DMT family transporter	NA	NA	NA	NA	NA
WP_111726642.1|459138_460527_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_111726644.1|460675_462655_-	transketolase	NA	NA	NA	NA	NA
WP_111726646.1|463218_464715_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_039853826.1|464717_465266_+	FixH family protein	NA	NA	NA	NA	NA
WP_107819648.1|465325_466501_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_111726648.1|467092_468505_+	3'-5' exonuclease	NA	G3MAD3	Bacillus_virus	29.8	1.2e-09
WP_050892787.1|468715_469495_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_111726651.1|469768_472858_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_111726653.1|473001_474060_+	DNA polymerase IV	NA	I6RSM4	Salmonella_phage	31.6	2.6e-17
WP_111726655.1|474158_476174_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	36.6	6.9e-107
WP_111726657.1|476193_476958_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	33.3	1.3e-18
WP_107960220.1|477157_478204_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.6	2.4e-119
WP_111726659.1|478367_479288_-	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_107859161.1|479412_479748_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_111726661.1|479829_482013_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.6	1.6e-45
WP_111726663.1|482100_484077_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.9	7.2e-85
WP_002213027.1|484220_484406_+	DUF3460 family protein	NA	NA	NA	NA	NA
WP_107859157.1|484416_485085_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_111726665.1|485084_485801_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_111726666.1|485848_486334_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	8.1e-22
WP_111727614.1|486405_487707_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003709053.1|488104_488581_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003674519.1|488689_488884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674521.1|489031_489214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726670.1|489274_490261_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_111726672.1|490395_491583_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	44.3	1.6e-84
WP_111726674.1|491641_492136_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_111726676.1|492453_492717_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_167395519.1|492781_493729_-	SAM-dependent methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	57.5	1.1e-96
WP_167395520.1|493700_493931_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	58.1	3.6e-12
WP_111726680.1|494220_494859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111726682.1|494981_495242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111726685.1|495276_495492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111726687.1|495596_495812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167395587.1|496052_496478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111726691.1|496580_497279_-	helix-turn-helix domain-containing protein	NA	Q7Y5W5	Haemophilus_phage	55.1	1.7e-52
WP_111726693.1|497392_497623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726695.1|497784_498132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726697.1|498246_501093_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	32.4	1.8e-73
WP_111726699.1|501691_502072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726701.1|502220_502538_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	37.6	1.6e-10
WP_111726703.1|502728_503316_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	35.7	5.8e-14
WP_111726705.1|503309_504998_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	58.2	1.1e-190
WP_111726707.1|505006_506248_+|portal	phage portal protein	portal	Q3HQS8	Burkholderia_phage	51.1	5.0e-108
WP_111726709.1|506219_507065_+|protease	Clp protease ClpP	protease	Q3HQS9	Burkholderia_phage	54.1	7.1e-74
WP_111726711.1|507068_508304_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	52.9	1.3e-108
WP_111726713.1|508397_508685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726715.1|508681_508999_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	43.1	2.9e-12
WP_111727617.1|509210_509426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726717.1|509428_509830_+	DUF3310 domain-containing protein	NA	A0A088FRG2	Mycobacterium_phage	57.1	1.0e-09
WP_111726719.1|509883_510513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726721.1|510567_510900_+|head	phage head closure protein	head	A0A2H4JC00	uncultured_Caudovirales_phage	31.5	1.9e-06
WP_111726723.1|510883_511405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167395521.1|511385_511724_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_111726727.1|511792_512437_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	46.9	6.7e-48
WP_111726729.1|512508_512826_+	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	29.9	5.1e-09
WP_111727619.1|512876_513146_+	DUF1799 domain-containing protein	NA	E7EKR1	Edwardsiella_phage	43.2	2.4e-07
WP_111726731.1|513138_516348_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.2	2.0e-39
WP_111726733.1|516370_516697_+|tail	phage tail protein	tail	Q3HQU0	Burkholderia_phage	41.5	1.5e-16
WP_111726736.1|516720_517404_+|tail	phage minor tail protein L	tail	Q9FZU6	Neisseria_meningitidis_phage	70.4	6.4e-73
WP_111726738.1|517405_518152_+	C40 family peptidase	NA	Q9FZU5	Neisseria_meningitidis_phage	53.3	3.6e-69
WP_111726740.1|518148_518970_+|tail	tail assembly protein	tail	Q9FZU4	Neisseria_meningitidis_phage	46.1	1.5e-52
WP_167395522.1|518959_522838_+	DUF1983 domain-containing protein	NA	Q9FZU3	Neisseria_meningitidis_phage	56.9	6.9e-281
WP_111726744.1|523165_525154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726745.1|525205_525523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111727621.1|525587_526049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726746.1|526049_526382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167395523.1|526368_526704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145960423.1|526874_527246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726749.1|527289_527949_+	hypothetical protein	NA	Q708K2	Streptococcus_phage	50.0	6.2e-41
WP_111726751.1|527958_528423_+	DUF4376 domain-containing protein	NA	A0A0R6PGN1	Moraxella_phage	47.2	2.0e-30
WP_111726753.1|528419_528884_+	hypothetical protein	NA	A0A0R6PGL8	Moraxella_phage	50.7	3.7e-32
WP_111726755.1|528896_529394_+	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	54.8	3.7e-46
WP_111726757.1|530724_530886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726759.1|530911_531802_-	Rha family transcriptional regulator	NA	D0UIK6	Aggregatibacter_phage	39.7	1.3e-17
WP_111726761.1|532368_533409_+	hypothetical protein	NA	A0A0N7KZA9	Stx2-converting_phage	42.3	2.2e-56
WP_167395524.1|533481_533664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167395525.1|533721_533889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111726765.1|534222_534384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111726767.1|534811_538645_-	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_107996991.1|539174_540866_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_111726769.1|541054_541426_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_003674530.1|541585_542134_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_107996993.1|542229_543321_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_003674535.1|543445_543616_+	rubredoxin	NA	NA	NA	NA	NA
WP_111726771.1|543729_545799_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_111726773.1|546095_548852_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.0	7.2e-91
WP_111726777.1|549404_549905_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_108043922.1|549987_550209_+	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_003680782.1|550168_550489_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	49.5	6.3e-23
WP_003674559.1|550853_551240_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	1.9e-53
WP_111726779.1|551515_552730_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.2	6.1e-34
551476:551502	attR	ATGCCGTCTGAAATTTCAGACGGCATT	NA	NA	NA	NA
WP_107859140.1|552759_553206_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_107997001.1|553560_554733_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_111727624.1|554797_555721_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002241698.1|555753_556125_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_107997003.1|556289_557534_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.6	1.6e-130
