The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	36640	49026	1906305		Synechococcus_phage(28.57%)	8	NA	NA
WP_023610838.1|36640_40366_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	2.7e-40
WP_009880323.1|40599_42054_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_023610840.1|42081_43104_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	9.0e-63
WP_023079049.1|43271_43826_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	4.0e-25
WP_023610836.1|44009_45557_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	51.8	2.2e-44
WP_023610833.1|45614_46739_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	1.0e-06
WP_023610831.1|46991_48257_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_023079042.1|48534_49026_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	1.4e-18
>prophage 2
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	758458	835059	1906305	capsid,portal,terminase,holin,integrase,protease,head,tRNA,tail	Streptococcus_phage(55.36%)	89	747586:747602	796989:797005
747586:747602	attL	AACTTGTTAAAAAAGAT	NA	NA	NA	NA
WP_023610964.1|758458_760723_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_023610967.1|760979_761600_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_085577338.1|761962_763051_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	98.3	8.9e-202
WP_011106738.1|763170_763476_-	membrane protein	NA	NA	NA	NA	NA
WP_021340822.1|763485_764274_-	peptidase S24	NA	A0A1S5SD15	Streptococcus_phage	62.6	2.9e-85
WP_080465047.1|764646_764805_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	3.4e-22
WP_085577339.1|764938_765724_-	hypothetical protein	NA	A0A1S5S7L0	Streptococcus_phage	57.4	4.8e-48
WP_021340823.1|765780_765927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023605145.1|765923_766406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340169.1|766479_766719_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	97.5	3.1e-35
WP_002984287.1|766730_766976_+	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	95.1	1.2e-34
WP_111681188.1|767199_767550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032461901.1|767524_767839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032461902.1|767981_768167_+	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	85.2	4.7e-23
WP_011017882.1|768245_768542_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_011017881.1|768538_768676_+	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
WP_085577340.1|768756_769086_+	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	3.6e-13
WP_002984315.1|769085_769280_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_011284877.1|769276_769561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014635524.1|769557_770241_+	AAA family ATPase	NA	J7KC09	Streptococcus_phage	98.2	4.6e-124
WP_085577341.1|770276_771680_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.1	2.3e-194
WP_085577342.1|771684_772167_+	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	1.7e-59
WP_011017876.1|772184_773738_+	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.6	1.5e-210
WP_085577343.1|774006_774876_+	bifunctional DNA primase/polymerase	NA	A0A1P8BME8	Lactococcus_phage	65.2	7.5e-103
WP_023079767.1|774829_775180_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	88.5	9.9e-46
WP_011018138.1|775163_775520_+	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	5.0e-61
WP_085577344.1|776040_776454_+	hypothetical protein	NA	Q938M1	Temperate_phage	63.1	7.1e-35
WP_085577345.1|776450_776657_+	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	1.0e-10
WP_011017866.1|776680_777121_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_063632710.1|777767_778106_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	97.2	2.4e-57
WP_002985371.1|778276_778744_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_085577347.1|778746_778977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063632717.1|778980_780735_+|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	95.9	0.0e+00
WP_002985365.1|780731_780902_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_002985363.1|780894_781119_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_011017578.1|781152_782373_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	6.9e-187
WP_032465106.1|782350_783016_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	77.7	1.9e-90
WP_011017580.1|783040_784228_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	74.7	1.3e-158
WP_063812171.1|784372_784675_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	88.8	5.7e-42
WP_063812172.1|784671_785019_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	87.3	6.5e-50
WP_085577348.1|785015_785393_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	3.7e-46
WP_011017584.1|785389_785815_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
WP_011017585.1|785830_786439_+	hypothetical protein	NA	J7KKC8	Streptococcus_phage	71.9	6.7e-74
WP_011017586.1|786491_786818_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
WP_021299462.1|786865_787015_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_085577349.1|787027_790951_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.6	1.9e-238
WP_085577350.1|790950_791658_+|tail	phage tail protein	tail	Q938K2	Temperate_phage	69.4	5.4e-91
WP_085577351.1|791654_793799_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	97.5	0.0e+00
WP_111695808.1|793795_794809_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	99.1	2.3e-183
WP_111695809.1|794823_796710_+	gp58-like family protein	NA	Q938J9	Temperate_phage	72.3	1.9e-159
WP_085577293.1|796718_796880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085577294.1|796882_797494_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	90.6	4.4e-81
796989:797005	attR	AACTTGTTAAAAAAGAT	NA	NA	NA	NA
WP_011017397.1|797503_797776_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_003058873.1|797772_798000_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_011284838.1|798116_799451_+	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_002985327.1|799526_800234_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_011184727.1|800344_801103_-	DNase Mf2	NA	NA	NA	NA	NA
WP_002993136.1|801342_801531_+	hypothetical protein	NA	A3F673	Streptococcus_phage	76.3	2.1e-18
WP_002989607.1|802121_802736_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
WP_023078569.1|802866_803652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023078568.1|803661_804360_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	5.1e-09
WP_002989617.1|804359_804731_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023610966.1|804915_808026_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	1.4e-119
WP_010922375.1|808105_809119_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002984447.1|809181_810684_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984449.1|810901_811459_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011284834.1|811634_813449_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.2e-97
WP_002989626.1|813644_813980_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002992417.1|814086_814728_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023610961.1|814737_815367_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
WP_023610973.1|815382_816219_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023610969.1|816588_817362_+	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_020833513.1|817730_818966_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_023610963.1|819085_820408_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_111695810.1|820938_823257_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.0	1.0e-130
WP_002984469.1|823619_823868_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002984470.1|823904_824516_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984473.1|824526_824715_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984475.1|824727_825267_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|825307_825508_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002994467.1|825518_826007_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984480.1|826169_826811_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023610811.1|826933_827497_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989664.1|827614_828316_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_023610819.1|828330_830967_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002993908.1|831058_831655_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_085577296.1|831665_832622_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023605124.1|832718_834059_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_002989678.1|834174_835059_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	1045948	1081137	1906305	capsid,portal,terminase,holin,integrase,tail	Streptococcus_phage(67.35%)	55	1055448:1055463	1080215:1080230
WP_111695817.1|1045948_1046404_-|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	82.1	1.4e-63
WP_111695818.1|1046413_1047025_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	87.7	7.7e-78
WP_012560658.1|1047027_1047189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111695819.1|1047200_1048985_-	hypothetical protein	NA	Q938J9	Temperate_phage	48.7	2.8e-96
WP_168390558.1|1048999_1050022_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	83.4	1.6e-149
WP_172451686.1|1050021_1052001_-|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	51.4	6.3e-105
WP_063629041.1|1051982_1052678_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	2.6e-05
WP_111695821.1|1052674_1055032_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	48.4	3.9e-138
WP_011528785.1|1055031_1055403_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	59.2	1.2e-33
WP_003047548.1|1055417_1055681_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	54.7	1.7e-18
1055448:1055463	attL	AATTTCTTTGATTTCT	NA	NA	NA	NA
WP_172451687.1|1055691_1056282_-|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	61.4	1.0e-58
WP_000573598.1|1056297_1056633_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_111695823.1|1056633_1056870_-	hypothetical protein	NA	M1NRG9	Streptococcus_phage	70.5	9.6e-21
WP_011054681.1|1056862_1057201_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_109828577.1|1057160_1057583_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.9	4.8e-47
WP_053308481.1|1057733_1058627_-|capsid	phage major capsid protein	capsid	A0A126GGI3	Streptococcus_phage	77.4	6.3e-129
WP_053308482.1|1058630_1059095_-	DUF4355 domain-containing protein	NA	A0A141E167	Streptococcus_phage	57.8	6.3e-40
WP_111695824.1|1059175_1060591_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	8.5e-213
WP_011888764.1|1060672_1060909_-	hypothetical protein	NA	M1IRA5	Streptococcus_phage	80.3	1.2e-31
WP_002986828.1|1060910_1061177_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_032461150.1|1061169_1061349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994100.1|1061398_1061623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017978.1|1061628_1063122_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.6	3.7e-89
WP_011017979.1|1063114_1064383_-|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.2	2.4e-190
WP_109828582.1|1064379_1064736_-	hypothetical protein	NA	A0A0B5A7G9	Streptococcus_phage	40.9	1.7e-08
WP_011017980.1|1064885_1065230_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	2.5e-41
WP_010922470.1|1065337_1065757_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	8.7e-57
WP_032460172.1|1066121_1066415_-	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	99.0	2.7e-49
WP_023077953.1|1066462_1067227_-	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	91.9	2.8e-133
WP_011017571.1|1067216_1067699_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
WP_111695825.1|1067702_1067972_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.0	1.9e-25
WP_111695826.1|1067976_1068162_-	hypothetical protein	NA	A3F626	Streptococcus_phage	83.8	3.5e-10
WP_111695827.1|1068148_1068661_-	hypothetical protein	NA	A0A1S5S8V7	Streptococcus_phage	71.4	3.2e-61
WP_111695828.1|1068657_1068999_-	hypothetical protein	NA	M1PKX3	Streptococcus_phage	37.5	3.7e-13
WP_011888756.1|1069193_1070222_-	DUF1351 domain-containing protein	NA	E8ZD61	Streptococcus_phage	65.9	9.5e-121
WP_111695829.1|1070231_1071056_-	phage recombination protein Bet	NA	A0A1S5SFP4	Streptococcus_phage	77.6	1.1e-114
WP_111695868.1|1071058_1071388_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	84.4	7.1e-46
WP_111695830.1|1071564_1071819_-	hypothetical protein	NA	Q938N0	Temperate_phage	89.3	1.8e-36
WP_000166038.1|1071829_1071970_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	2.6e-05
WP_002985387.1|1071966_1072200_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_172451688.1|1072180_1072594_-	DnaD domain protein	NA	Q938N2	Temperate_phage	84.7	5.4e-59
WP_076634492.1|1072662_1072932_-	transcriptional regulator	NA	A0A060QMU7	Streptococcus_phage	46.3	2.5e-12
WP_032461153.1|1073031_1073217_-	hypothetical protein	NA	Q938N3	Temperate_phage	90.2	1.8e-22
WP_032461154.1|1073218_1073530_-	hypothetical protein	NA	A1EAC3	Streptococcus_phage	86.4	1.7e-49
WP_011889039.1|1073636_1073819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111695831.1|1073959_1074676_-	phage antirepressor KilAC domain-containing protein	NA	C9WB91	Streptococcus_virus	76.3	4.7e-103
WP_002993390.1|1074687_1074879_-	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
WP_020837683.1|1075514_1075610_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002994741.1|1076032_1076380_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SEQ8	Streptococcus_phage	72.6	1.2e-40
WP_002994744.1|1076383_1076764_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	61.1	8.0e-41
WP_002994745.1|1076775_1077042_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_011528538.1|1077168_1078308_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	55.8	4.4e-119
WP_023610978.1|1078390_1079431_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.5e-68
WP_002990099.1|1079674_1080268_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
1080215:1080230	attR	AATTTCTTTGATTTCT	NA	NA	NA	NA
WP_014407521.1|1080267_1081137_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	5.4e-101
>prophage 4
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	1185609	1196212	1906305		Streptococcus_phage(57.14%)	9	NA	NA
WP_011184383.1|1185609_1186752_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
WP_012560601.1|1186986_1187427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023610854.1|1187456_1188725_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_023610863.1|1188812_1190165_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.2	1.6e-30
WP_002985134.1|1190385_1190727_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_002985136.1|1190787_1191954_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_023610850.1|1192047_1192734_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	5.4e-88
WP_011054349.1|1192730_1193894_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	5.8e-143
WP_011054348.1|1194001_1196212_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
>prophage 5
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	1227907	1276925	1906305	capsid,portal,terminase,holin,integrase,tRNA,tail	Temperate_phage(59.02%)	74	1218441:1218456	1282962:1282977
1218441:1218456	attL	AATCCTGAAGCAACCA	NA	NA	NA	NA
WP_111695834.1|1227907_1228825_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.5	2.1e-34
WP_023610402.1|1228928_1229597_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	1.3e-30
WP_010922123.1|1229606_1230683_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002990406.1|1230755_1231142_-	YbgA family protein	NA	NA	NA	NA	NA
WP_002993028.1|1231134_1231512_-	OsmC family protein	NA	NA	NA	NA	NA
WP_002986897.1|1231760_1231943_-	hypothetical protein	NA	A3F673	Streptococcus_phage	78.3	6.9e-19
WP_002986898.1|1232153_1232393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986905.1|1232432_1232906_+	hypothetical protein	NA	A3F671	Streptococcus_phage	92.3	1.6e-78
WP_002986907.1|1232907_1233264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054729.1|1233331_1234198_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
WP_011017840.1|1234185_1234710_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_023611747.1|1234849_1236052_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	97.5	4.6e-236
WP_000609113.1|1236167_1236395_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_002987582.1|1236391_1236667_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_032461328.1|1236676_1237294_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.8	1.7e-77
WP_002987513.1|1237296_1237728_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	100.0	1.1e-73
WP_111695835.1|1237739_1239623_-	gp58-like family protein	NA	Q938J9	Temperate_phage	96.2	1.6e-251
WP_111695836.1|1239632_1240649_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	98.2	1.1e-180
WP_111695837.1|1240645_1242790_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	98.5	0.0e+00
WP_011054737.1|1242786_1243503_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	100.0	2.9e-137
WP_111695838.1|1243499_1246760_-	tape measure protein	NA	Q938K3	Temperate_phage	97.1	0.0e+00
WP_011284973.1|1246749_1247331_-	hypothetical protein	NA	Q938K4	Temperate_phage	99.5	4.9e-106
WP_011054740.1|1247334_1247769_-	hypothetical protein	NA	Q938K5	Temperate_phage	100.0	2.6e-72
WP_011054741.1|1247807_1248293_-	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
WP_010922084.1|1248292_1248691_-|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_111695839.1|1248687_1249044_-|capsid	capsid protein	capsid	Q79S88	Temperate_phage	98.3	5.0e-61
WP_010922082.1|1249043_1249376_-	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_010922081.1|1249365_1249782_-	hypothetical protein	NA	Q938K7	Temperate_phage	99.1	4.3e-56
WP_010922080.1|1249835_1250654_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_010922079.1|1250657_1251272_-	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
WP_011888689.1|1251397_1251664_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_010922077.1|1251750_1251978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111695840.1|1251977_1253471_-|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	80.0	3.1e-213
WP_010922075.1|1253475_1254978_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.6	5.9e-281
WP_010922074.1|1254991_1256203_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_023612332.1|1256285_1256759_-	hypothetical protein	NA	Q938L4	Temperate_phage	98.7	7.3e-76
WP_002986841.1|1256809_1257187_-	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
WP_076639321.1|1257247_1257631_-	GNAT family N-acetyltransferase	NA	B5SP24	Lactococcus_phage	58.5	3.9e-35
WP_002986850.1|1257639_1258317_-	hypothetical protein	NA	Q938L6	Temperate_phage	100.0	8.7e-131
WP_002986854.1|1258295_1258814_-	ParB N-terminal domain-containing protein	NA	Q938L7	Temperate_phage	100.0	1.5e-90
WP_011054748.1|1258894_1259152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340586.1|1259726_1260164_-	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
WP_010922070.1|1260430_1261066_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	69.4	2.0e-89
WP_111695841.1|1261067_1261352_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	86.2	2.6e-36
WP_023610894.1|1261361_1261631_-	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	91.0	1.2e-43
WP_111695842.1|1261627_1261912_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	96.8	1.0e-48
WP_011017567.1|1261905_1262103_-	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.9e-11
WP_111695843.1|1262089_1262602_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	73.8	3.4e-63
WP_002990067.1|1262598_1262937_-	hypothetical protein	NA	M1PKX3	Streptococcus_phage	37.5	4.0e-12
WP_009880273.1|1263113_1263281_-	hypothetical protein	NA	A0A1S5SEF3	Streptococcus_phage	55.6	6.0e-09
WP_111695844.1|1263290_1264088_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	82.3	5.8e-126
WP_000594115.1|1264080_1264281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111695845.1|1264277_1265204_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_032463369.1|1265206_1265536_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	87.2	1.1e-46
WP_011017565.1|1265591_1265798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017992.1|1265806_1265947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986875.1|1265952_1266165_-	hypothetical protein	NA	Q938N1	Temperate_phage	58.6	5.4e-15
WP_172450154.1|1266145_1266556_-	DnaD domain protein	NA	Q938N2	Temperate_phage	78.1	1.3e-52
WP_019418742.1|1266677_1266935_-	hypothetical protein	NA	A0A141E1D1	Streptococcus_phage	40.5	8.9e-12
WP_002986881.1|1267028_1267214_-	hypothetical protein	NA	Q938N3	Temperate_phage	95.1	1.2e-23
WP_032463372.1|1267242_1267500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023611028.1|1267605_1267821_+	hypothetical protein	NA	A0A1S5SA41	Streptococcus_phage	61.4	1.9e-15
WP_023611035.1|1267794_1268043_-	hypothetical protein	NA	A0A141E1M0	Streptococcus_phage	69.5	1.6e-26
WP_111695846.1|1268121_1268322_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	72.3	1.1e-20
WP_002986888.1|1268318_1268468_-	hypothetical protein	NA	Q938N4	Temperate_phage	100.0	1.8e-20
WP_002986890.1|1268500_1269229_-	phage antirepressor KilAC domain-containing protein	NA	Q938N5	Temperate_phage	99.6	3.4e-133
WP_002986891.1|1269239_1269431_-	hypothetical protein	NA	A7J270	Streptococcus_phage	90.5	1.2e-24
WP_020837683.1|1270065_1270161_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_011054768.1|1270579_1270939_+	helix-turn-helix transcriptional regulator	NA	Q938N6	Temperate_phage	100.0	1.1e-60
WP_002986894.1|1270952_1271333_+	hypothetical protein	NA	Q938N7	Temperate_phage	100.0	5.3e-69
WP_002986895.1|1271343_1271865_+	hypothetical protein	NA	Q938N8	Temperate_phage	100.0	2.3e-67
WP_080277749.1|1271983_1273138_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	99.7	1.1e-205
WP_085577314.1|1273266_1275672_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_032464300.1|1275881_1276925_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.3	2.7e-30
1282962:1282977	attR	TGGTTGCTTCAGGATT	NA	NA	NA	NA
>prophage 6
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	1420490	1426861	1906305	portal	Streptococcus_phage(66.67%)	12	NA	NA
WP_023610462.1|1420490_1421168_-	asparagine synthetase A	NA	A0A167RLM0	Powai_lake_megavirus	28.6	2.4e-11
WP_011017510.1|1421191_1421530_-	Fic family protein	NA	NA	NA	NA	NA
WP_011528388.1|1421922_1422231_-	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	64.9	5.7e-21
WP_023610443.1|1422296_1422749_-|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	85.6	4.4e-62
WP_023610483.1|1422843_1423125_-	hypothetical protein	NA	E4ZFM1	Streptococcus_phage	50.7	3.2e-07
WP_002985606.1|1423143_1423449_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011054283.1|1423448_1423751_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002990640.1|1423805_1423982_-	hypothetical protein	NA	M1PSF2	Streptococcus_phage	87.9	3.8e-22
WP_165745700.1|1423997_1424891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023610394.1|1424890_1425121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085577319.1|1425111_1426662_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_023610427.1|1426651_1426861_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	63.1	3.4e-17
>prophage 7
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	1478961	1539010	1906305	tRNA,bacteriocin,protease	Streptococcus_phage(33.33%)	60	NA	NA
WP_003060803.1|1478961_1479162_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002992018.1|1479174_1479402_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|1480624_1480807_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002994504.1|1480821_1481067_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002985741.1|1482023_1482500_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1482519_1483416_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1483535_1483943_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985748.1|1483923_1484421_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_009880369.1|1484579_1485155_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_010921967.1|1485200_1486253_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_010921966.1|1486411_1488184_-	oleate hydratase	NA	NA	NA	NA	NA
WP_023610441.1|1488497_1489646_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.4e-16
WP_002985757.1|1489801_1490017_-	YozE family protein	NA	NA	NA	NA	NA
WP_010921964.1|1490013_1490523_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_020833311.1|1490595_1491453_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002985763.1|1491561_1492119_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1492147_1492876_-	UMP kinase	NA	NA	NA	NA	NA
WP_002985768.1|1493197_1493887_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1493992_1494418_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_010921962.1|1494661_1495015_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_023610449.1|1495084_1497490_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_002990808.1|1497706_1498513_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_011017448.1|1498660_1499515_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985780.1|1499515_1500241_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_004218965.1|1500304_1501237_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023610422.1|1501382_1502030_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_023610418.1|1502129_1502471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023610413.1|1502621_1503317_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002993069.1|1503336_1503588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985793.1|1503587_1504142_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_023610405.1|1504172_1505555_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.4	5.0e-32
WP_023610456.1|1505727_1507065_-	MFS transporter	NA	NA	NA	NA	NA
WP_023610399.1|1507397_1508357_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023610469.1|1508432_1509131_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	2.4e-11
WP_002990844.1|1509123_1509360_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_023610476.1|1509720_1510362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340584.1|1510455_1510707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023610434.1|1510947_1511352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023610485.1|1511748_1512225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023610444.1|1514012_1514390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111695856.1|1514887_1515463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023610438.1|1515921_1516674_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_023610421.1|1516877_1519064_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	44.3	1.2e-168
WP_002985812.1|1519030_1519519_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_010921941.1|1519522_1520536_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.7	2.5e-97
WP_080263221.1|1521029_1523030_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	34.9	1.5e-85
WP_023610445.1|1523269_1523977_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_085577371.1|1524750_1529688_-|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_002985826.1|1529952_1531134_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_023610361.1|1531367_1532195_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.1	3.2e-127
WP_023610367.1|1532268_1532625_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	1.7e-40
WP_111695857.1|1532924_1533554_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011017426.1|1533600_1533993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021733048.1|1534019_1534883_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	3.8e-115
WP_002985838.1|1534887_1535211_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_023610359.1|1535614_1535854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023610380.1|1535872_1536748_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	48.6	3.7e-73
WP_023610360.1|1536765_1537401_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	64.4	1.4e-66
WP_002985847.1|1537649_1537925_-	YlbG family protein	NA	NA	NA	NA	NA
WP_002985850.1|1538419_1539010_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
>prophage 8
NZ_LS483360	Streptococcus pyogenes strain NCTC10876 chromosome 1	1906305	1734948	1847684	1906305	capsid,portal,terminase,holin,integrase,protease,head,tRNA,bacteriocin,tail	Streptococcus_phage(62.9%)	113	1765269:1765294	1796951:1796976
WP_023610712.1|1734948_1735254_-|protease	Spi family protease inhibitor	protease	NA	NA	NA	NA
WP_023610705.1|1735255_1736452_-	cysteine proteinase exotoxin SpeB	NA	NA	NA	NA	NA
WP_023610751.1|1736723_1736894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002982409.1|1737392_1738235_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010922721.1|1738475_1739291_-	streptodornase B	NA	A7J2B8	Streptococcus_phage	33.3	6.7e-29
WP_011185025.1|1739654_1740164_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.5	1.1e-37
WP_023610739.1|1740245_1741334_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_023610763.1|1741390_1742059_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	34.7	2.6e-26
WP_023079149.1|1742073_1744491_-	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
WP_023610767.1|1744701_1746006_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002992103.1|1746015_1746324_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002992105.1|1746351_1746672_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002982359.1|1746959_1747940_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032465931.1|1747955_1748702_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002992110.1|1748827_1749601_+	glycyl-radical enzyme activating protein	NA	A0A0U2DAM7	Escherichia_phage	36.2	3.8e-05
WP_002982348.1|1749836_1750013_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002982344.1|1750026_1750179_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_111695863.1|1750227_1752564_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002982339.1|1752602_1752983_-	RidA family protein	NA	NA	NA	NA	NA
WP_011285240.1|1753558_1754560_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.6	3.7e-05
WP_023610749.1|1754648_1756289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023610765.1|1756535_1758035_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_023610701.1|1758746_1759013_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002982320.1|1759263_1760895_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	1.8e-153
WP_002991292.1|1760930_1761221_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_023610724.1|1761398_1763843_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.0	4.1e-122
WP_023610213.1|1763842_1764304_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002991299.1|1764499_1764703_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	80.0	6.1e-24
1765269:1765294	attL	ATTTGCCCACCATTTGCCCACCAACT	NA	NA	NA	NA
WP_063629765.1|1765292_1766363_-|integrase	site-specific integrase	integrase	A0A1P8VVR7	Streptococcus_phage	48.3	9.6e-92
WP_111685849.1|1766490_1766793_-	hypothetical protein	NA	A0A1S5SAH9	Streptococcus_phage	53.6	1.5e-21
WP_063629763.1|1766785_1767172_-	hypothetical protein	NA	Q938N7	Temperate_phage	61.6	2.4e-37
WP_063629762.1|1767175_1767526_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8C4	Streptococcus_phage	70.6	8.1e-40
WP_111685850.1|1767922_1768132_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVQ4	Streptococcus_phage	88.2	3.0e-26
WP_063629760.1|1768131_1768494_+	hypothetical protein	NA	A0A1P8VVU1	Streptococcus_phage	68.8	6.6e-37
WP_063629759.1|1768515_1768800_+	hypothetical protein	NA	B3GVX8	Streptococcus_phage	81.9	3.5e-41
WP_063629758.1|1768826_1769045_+	hypothetical protein	NA	A0A1P8VVV1	Streptococcus_phage	83.3	3.9e-24
WP_111685851.1|1769053_1770400_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	83.7	9.3e-209
WP_111685852.1|1770386_1771133_+	conserved phage C-terminal domain-containing protein	NA	A0A1P8VVR3	Streptococcus_phage	96.0	3.5e-133
WP_111685853.1|1771133_1771955_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	95.2	1.1e-148
WP_063629755.1|1771954_1772182_+	hypothetical protein	NA	C5J991	Streptococcus_phage	46.6	1.3e-11
WP_168388561.1|1772195_1772366_+	hypothetical protein	NA	Q938M0	Temperate_phage	96.8	2.5e-10
WP_109982045.1|1772362_1772632_+	hypothetical protein	NA	A7J287	Streptococcus_phage	77.5	1.4e-28
WP_111685854.1|1772634_1773384_+	site-specific DNA-methyltransferase	NA	Q9MCL7	Streptococcus_virus	89.5	7.3e-131
WP_111685855.1|1774189_1774408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032460876.1|1774404_1774797_+	single-stranded DNA-binding protein	NA	A0A1P8VVS8	Streptococcus_phage	71.7	4.1e-48
WP_029713970.1|1774810_1775089_+	hypothetical protein	NA	A3F632	Streptococcus_phage	96.7	9.6e-44
WP_063629751.1|1775183_1775411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063629750.1|1775382_1775847_+	hypothetical protein	NA	A0A1P8VVT5	Streptococcus_phage	92.2	5.8e-78
WP_063629749.1|1775956_1776499_+|integrase	site-specific integrase	integrase	A0A1S5SCL7	Streptococcus_phage	98.9	8.3e-100
WP_063629748.1|1776668_1776851_+	hypothetical protein	NA	A0A1S5SAV8	Streptococcus_phage	51.7	6.5e-09
WP_111685856.1|1777116_1777434_+	HNH endonuclease	NA	A0A1S5SD32	Streptococcus_phage	90.5	6.4e-52
WP_000601034.1|1777551_1778037_+	hypothetical protein	NA	A0A1S5SCZ6	Streptococcus_phage	98.1	3.2e-79
WP_111685857.1|1778029_1779742_+|terminase	terminase large subunit	terminase	A0A1S5SCW2	Streptococcus_phage	97.0	0.0e+00
WP_111685858.1|1779750_1780893_+|portal	phage portal protein	portal	A0A1P8VVT4	Streptococcus_phage	98.2	5.3e-213
WP_063629746.1|1780943_1781486_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1P8VVX2	Streptococcus_phage	96.7	6.8e-94
WP_063629745.1|1781496_1782759_+|capsid	phage major capsid protein	capsid	A0A1P8VVT0	Streptococcus_phage	85.6	5.8e-197
WP_032460894.1|1782778_1783117_+	hypothetical protein	NA	A0A1P8VVS7	Streptococcus_phage	80.6	1.2e-45
WP_032460893.1|1783113_1783419_+|head,tail	head-tail adaptor protein	head,tail	A0A1P8VVX4	Streptococcus_phage	84.2	5.4e-40
WP_032460892.1|1783418_1783766_+	hypothetical protein	NA	A0A1P8VVS6	Streptococcus_phage	92.2	3.6e-56
WP_063629744.1|1783752_1784097_+	hypothetical protein	NA	A0A1P8VVU6	Streptococcus_phage	92.1	8.8e-55
WP_063629743.1|1784111_1784783_+|tail	phage tail protein	tail	A0A1P8VVR1	Streptococcus_phage	89.9	7.6e-111
WP_063629742.1|1784786_1785260_+	hypothetical protein	NA	A0A0A0YX24	Streptococcus_phage	90.4	9.2e-79
WP_111685860.1|1785449_1788185_+|tail	phage tail tape measure protein	tail	A0A1P8VVW8	Streptococcus_phage	90.5	4.7e-244
WP_063629740.1|1788181_1788904_+	hypothetical protein	NA	A0A1P8VVR4	Streptococcus_phage	90.0	1.7e-124
WP_111685880.1|1788928_1790848_+|tail	phage tail protein	tail	A0A1P8VVT1	Streptococcus_phage	64.6	5.2e-181
WP_063629043.1|1790844_1791960_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	71.7	1.7e-123
WP_111685861.1|1791974_1793756_+	hypothetical protein	NA	Q938J9	Temperate_phage	42.8	2.0e-73
WP_111685862.1|1793764_1794193_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.3	3.7e-63
WP_111685863.1|1794195_1794834_+	hypothetical protein	NA	A3F662	Streptococcus_phage	53.2	1.2e-44
WP_111685864.1|1794843_1795116_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	89.9	1.6e-35
WP_003058873.1|1795112_1795340_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_111685865.1|1795455_1796673_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.1	3.7e-164
WP_002982304.1|1797551_1798112_+	peroxiredoxin	NA	NA	NA	NA	NA
1796951:1796976	attR	ATTTGCCCACCATTTGCCCACCAACT	NA	NA	NA	NA
WP_023610722.1|1798132_1799665_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	37.5	1.8e-43
WP_172451689.1|1799722_1800988_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_063632876.1|1801279_1803310_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_003058706.1|1803397_1804297_+	glutamate formimidoyltransferase	NA	NA	NA	NA	NA
WP_023610734.1|1804307_1804934_+	cyclodeaminase/cyclohydrolase family protein	NA	NA	NA	NA	NA
WP_023610779.1|1804951_1806625_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_023610736.1|1806646_1807243_+	HutD family protein	NA	NA	NA	NA	NA
WP_023610757.1|1807462_1808806_+	APC family permease	NA	NA	NA	NA	NA
WP_023610706.1|1808816_1810358_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.6	4.0e-99
WP_010922741.1|1810543_1811530_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_023610743.1|1811567_1814642_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002982262.1|1814945_1815713_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_085577423.1|1815846_1816887_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_009880612.1|1817053_1818949_-	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	2.3e-72
WP_023610760.1|1819156_1820785_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_023610715.1|1820851_1822876_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002982243.1|1823086_1823800_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_023610754.1|1824602_1825460_+	VOC family protein	NA	NA	NA	NA	NA
WP_023610692.1|1825501_1826233_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	37.4	3.3e-35
WP_021775544.1|1826406_1827021_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.7	1.1e-52
WP_014407930.1|1827035_1827530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023610759.1|1827538_1828474_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023610752.1|1828502_1828649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002992831.1|1828830_1831029_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.9	2.6e-277
WP_011055088.1|1831125_1832685_-	membrane protein	NA	NA	NA	NA	NA
WP_002982199.1|1833098_1833404_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002982196.1|1833415_1833835_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002982194.1|1833831_1834101_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002982188.1|1834213_1834612_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_023610714.1|1834902_1836039_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	6.1e-121
WP_023610745.1|1836127_1837399_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_023610776.1|1837467_1838028_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002992186.1|1838037_1838634_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002991361.1|1838635_1839856_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.3	2.7e-05
WP_023610727.1|1839866_1841849_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	2.3e-62
WP_023610769.1|1841977_1844533_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.3	5.2e-43
WP_011889237.1|1844519_1844726_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_023610766.1|1844868_1845306_-	arginine repressor	NA	NA	NA	NA	NA
WP_023610730.1|1845596_1847288_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	6.4e-74
WP_002991370.1|1847375_1847684_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
