The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	41607	50035	1931144		Synechococcus_phage(33.33%)	7	NA	NA
WP_004218736.1|41607_43062_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	3.7e-54
WP_002986701.1|43089_44112_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	6.9e-63
WP_002986700.1|44279_44834_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_002986697.1|45017_46565_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	9.8e-45
WP_111713102.1|46623_47748_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_111713103.1|48000_49266_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|49543_50035_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	168436	251566	1931144	holin,tRNA,capsid,tail,transposase,protease,integrase,head,terminase,portal	Streptococcus_phage(41.67%)	93	188035:188052	232608:232625
WP_002986372.1|168436_170938_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.7	0.0e+00
WP_002986370.1|171244_172678_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002986367.1|172748_173027_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002986362.1|173149_173635_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002986359.1|173725_174388_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002987909.1|174392_175256_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002987910.1|175257_175962_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002986350.1|176286_177933_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_002986347.1|178185_179277_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002986345.1|179765_180962_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	4.0e-30
WP_002986341.1|180977_182705_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_111713128.1|182835_185478_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	35.9	2.5e-64
WP_002986334.1|185664_186120_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002986328.1|186171_186639_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_014635671.1|186764_187898_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
188035:188052	attL	GCTGAGGGCTATTTTTAT	NA	NA	NA	NA
WP_011054151.1|188067_188931_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002986319.1|189149_190292_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	2.9e-86
WP_002987947.1|190509_190821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986314.1|190824_191364_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002986311.1|191503_192283_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002992549.1|192282_192798_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_020833235.1|193411_194644_-	S-layer protein	NA	NA	NA	NA	NA
WP_002986298.1|195019_195721_-|integrase	site-specific integrase	integrase	A0A141E0H2	Streptococcus_phage	65.8	4.1e-83
WP_002986291.1|196288_196822_-	hypothetical protein	NA	A0A1S5SAH9	Streptococcus_phage	55.3	1.3e-20
WP_002986288.1|196833_197214_-	hypothetical protein	NA	Q938N7	Temperate_phage	64.0	1.4e-40
WP_032467305.1|197223_197574_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFC6	Streptococcus_phage	60.3	4.8e-32
WP_002986282.1|197884_198100_+	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	78.6	2.2e-24
WP_002986270.1|198304_199048_+	ORF6C domain-containing protein	NA	A3F617	Streptococcus_phage	86.1	1.5e-120
WP_002986266.1|199123_199336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986264.1|199369_199561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986261.1|199592_199748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986259.1|199749_200292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986256.1|200422_200683_+	hypothetical protein	NA	A0A1S5SAL2	Streptococcus_phage	73.3	1.1e-28
WP_002986254.1|200701_200890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680752.1|200876_202223_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	84.9	9.3e-209
WP_002986249.1|202209_202812_+	hypothetical protein	NA	A0A1P8VVT8	Streptococcus_phage	93.0	1.7e-106
WP_002986245.1|202789_203536_+	conserved phage C-terminal domain-containing protein	NA	A0A1P8VVR3	Streptococcus_phage	96.8	2.2e-135
WP_002986242.1|203536_204361_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	79.6	1.4e-127
WP_002986238.1|204360_204588_+	hypothetical protein	NA	C5J991	Streptococcus_phage	50.7	7.1e-13
WP_111713441.1|204601_204778_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002986233.1|204774_205059_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	93.6	5.9e-41
WP_050452837.1|205061_205700_+	DNA cytosine methyltransferase	NA	A0A140HLV8	Bacillus_phage	65.6	2.7e-65
WP_002986227.1|205687_205843_+	hypothetical protein	NA	A0A1S5SFL7	Streptococcus_phage	60.5	1.6e-08
WP_002986215.1|206869_207202_+	hypothetical protein	NA	A0A1S5SCX1	Streptococcus_phage	57.4	1.2e-32
WP_002986212.1|207194_207524_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVV5	Streptococcus_phage	45.5	3.2e-22
WP_002986209.1|207520_207694_+	hypothetical protein	NA	A0A1J0MGB9	Staphylococcus_phage	46.9	1.1e-05
WP_002986206.1|207696_207945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986201.1|208129_208279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986198.1|208247_208448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986196.1|208471_208891_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SF97	Streptococcus_phage	42.0	1.1e-19
WP_032467304.1|208985_209549_+|integrase	site-specific integrase	integrase	A0A1S5SCL7	Streptococcus_phage	61.5	5.4e-62
WP_002986191.1|209720_210014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986189.1|210010_210340_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	49.5	6.7e-20
WP_002986187.1|210461_210809_+	hypothetical protein	NA	E2ELI1	Clostridium_phage	34.5	4.0e-07
WP_002986185.1|210789_212448_+|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	44.4	4.0e-129
WP_002986182.1|212646_213882_+|portal	phage portal protein	portal	A0A1S7FYX7	Listeria_phage	37.6	3.6e-74
WP_002986180.1|213885_214602_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	42.9	1.4e-38
WP_002986177.1|214637_215831_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	30.8	1.7e-41
WP_002986176.1|215845_216133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986174.1|216152_216446_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_111680753.1|216447_216825_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_002986170.1|216796_217168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986168.1|217176_217599_+	hypothetical protein	NA	A0A1S7FZ20	Listeria_phage	48.5	3.1e-25
WP_002986166.1|217609_218197_+	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	36.4	1.1e-28
WP_002986164.1|218217_218589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986162.1|218624_218783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111713129.1|218856_222258_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	58.8	9.5e-93
WP_111680754.1|222257_222965_+|tail	phage tail family protein	tail	A0A1B1P761	Bacillus_phage	35.2	1.3e-28
WP_002986155.1|222961_225010_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	44.0	2.2e-121
WP_111713130.1|225009_226026_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	86.7	1.2e-157
WP_111713131.1|226041_228057_+	gp58-like family protein	NA	Q938J9	Temperate_phage	74.1	3.6e-180
WP_111713132.1|228068_228500_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	99.3	4.0e-73
WP_111713133.1|228502_229120_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.8	8.3e-80
WP_002986151.1|229129_229585_+|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	80.8	8.9e-63
WP_002986150.1|229696_230902_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	84.5	3.1e-208
WP_032467302.1|231017_232190_-	streptodornase Sda1	NA	A7J2B8	Streptococcus_phage	49.5	1.4e-75
WP_002986147.1|232428_232611_+	hypothetical protein	NA	A3F673	Streptococcus_phage	80.0	1.1e-19
WP_002986145.1|232660_232852_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
232608:232625	attR	ATAAAAATAGCCCTCAGC	NA	NA	NA	NA
WP_010921857.1|233523_234228_+	streptococcal pyrogenic exotoxin SpeG	NA	NA	NA	NA	NA
WP_014635263.1|234683_236033_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_111713134.1|236381_237890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011017305.1|238577_239249_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002986125.1|239347_240247_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	9.6e-77
WP_002986123.1|240279_241296_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_111713135.1|241593_242043_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031488680.1|242035_243742_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-36
WP_002986115.1|243744_245529_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.3e-44
WP_011054158.1|245646_246414_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_111713136.1|246523_246970_+	dUTP diphosphatase	NA	A0A1P8BLJ0	Lactococcus_phage	53.5	1.5e-35
WP_002986109.1|247050_248412_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_111713137.1|248600_249098_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_011017311.1|249228_249939_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_111684545.1|250120_251566_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L481	Tupanvirus	31.2	6.8e-08
>prophage 3
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	377507	383539	1931144		Streptococcus_phage(100.0%)	9	NA	NA
WP_032464192.1|377507_378143_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	1.2e-65
WP_111713154.1|378160_379036_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.9	4.1e-72
WP_032467296.1|379054_379294_+	Tpl protein	NA	NA	NA	NA	NA
WP_002985838.1|379697_380021_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002985836.1|380025_380889_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985833.1|380915_381308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985831.1|381354_381984_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_111713155.1|382281_382638_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	1.1e-39
WP_111713156.1|382711_383539_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.1	3.2e-127
>prophage 4
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	563960	573629	1931144	transposase,tRNA	Streptococcus_phage(50.0%)	7	NA	NA
WP_111713180.1|563960_566456_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.3	1.1e-202
WP_111713181.1|566392_567373_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.7e-32
WP_002985439.1|567882_569076_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002985437.1|569096_570443_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_002985434.1|570856_571747_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_011017561.1|571743_572721_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	1.2e-138
WP_063631823.1|572717_573629_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.7e-105
>prophage 5
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	657559	668162	1931144		Streptococcus_phage(57.14%)	9	NA	NA
WP_111713196.1|657559_659770_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.2	1.3e-268
WP_002985142.1|659877_661041_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|661037_661724_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985136.1|661817_662984_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_111713197.1|663044_663386_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.3	5.0e-18
WP_002985132.1|663606_664959_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
WP_002990257.1|665046_666315_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_032467286.1|666344_666785_-	membrane protein	NA	NA	NA	NA	NA
WP_002985123.1|667019_668162_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
>prophage 6
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	759944	872310	1931144	holin,tRNA,capsid,tail,transposase,integrase,terminase,portal	Streptococcus_phage(38.33%)	110	774247:774297	816381:816431
WP_032461034.1|759944_760844_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_010922191.1|760916_762155_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002990114.1|762147_762783_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_111713215.1|762797_763727_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_111713216.1|763726_764491_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_111713217.1|764487_766698_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.0	1.1e-70
WP_002984891.1|766847_767366_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.9	1.7e-30
WP_002984890.1|767446_768130_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_010922193.1|768126_768783_+	endonuclease III	NA	NA	NA	NA	NA
WP_002990104.1|768854_769541_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002984887.1|769530_770319_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_032462948.1|770358_771465_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010922195.1|771522_772392_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	3.2e-101
WP_002984882.1|772391_772985_+	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	H9NC63	Sphingomonas_phage	29.5	1.3e-08
WP_023612000.1|773228_774269_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
774247:774297	attL	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG	NA	NA	NA	NA
WP_111713218.1|774351_775491_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.1	1.3e-118
WP_023613222.1|775610_776468_-	DNA adenine methylase	NA	A0A2H4UUI2	Bodo_saltans_virus	29.7	8.1e-17
WP_023613205.1|776506_778171_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_111690776.1|778172_778556_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	76.0	1.2e-52
WP_011888679.1|778539_778881_-	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_014635614.1|779078_779291_+	DNA-binding protein	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
WP_111713219.1|779318_780038_+	phage antirepressor KilAC domain-containing protein	NA	M1Q1T4	Streptococcus_phage	70.7	1.5e-88
WP_110410816.1|780041_780392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032461901.1|780366_780681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111713220.1|780831_781017_+	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	82.0	6.8e-22
WP_014411880.1|781095_781407_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_011888947.1|781408_781579_+	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_000049475.1|781571_781775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983407.1|782301_782505_+	hypothetical protein	NA	A7J276	Streptococcus_phage	100.0	9.4e-33
WP_002988708.1|782592_782892_+	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_011888943.1|782891_784049_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_086934854.1|784057_784621_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_015898617.1|784663_786586_+	DNA polymerase	NA	A7J280	Streptococcus_phage	98.9	0.0e+00
WP_111713221.1|786590_788975_+	DNA primase	NA	A7J282	Streptococcus_phage	97.6	2.8e-285
WP_023613183.1|789340_789616_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	97.8	1.3e-45
WP_111694889.1|789612_790935_+	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.7	3.0e-252
WP_164972002.1|790935_791106_+	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_011054882.1|791098_791371_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054881.1|791503_791920_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_111713222.1|792039_792735_+|terminase	terminase	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	34.5	3.4e-29
WP_165363098.1|792727_794023_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	85.0	7.8e-221
WP_111713223.1|794036_795539_+|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.4	3.8e-280
WP_111694888.1|795543_797022_+|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	99.6	9.0e-274
WP_002986829.1|796993_797233_+	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
WP_111694887.1|797294_797561_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
WP_010922079.1|797686_798301_+	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
WP_010922080.1|798304_799123_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_010922081.1|799176_799593_+	hypothetical protein	NA	Q938K7	Temperate_phage	99.1	4.3e-56
WP_010922082.1|799582_799915_+	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_010922083.1|799914_800271_+	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_011018121.1|800267_800666_+|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	99.2	1.3e-70
WP_111713224.1|800665_801127_+|tail	phage tail protein	tail	Q938K6	Temperate_phage	78.8	1.4e-60
WP_111713225.1|801170_801605_+	hypothetical protein	NA	Q938K5	Temperate_phage	98.6	5.5e-70
WP_111713226.1|801608_802190_+	hypothetical protein	NA	Q938K4	Temperate_phage	98.4	1.6e-104
WP_111713227.1|802179_805440_+	tape measure protein	NA	Q938K3	Temperate_phage	99.3	0.0e+00
WP_011888697.1|805436_806153_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	99.2	1.2e-135
WP_111713228.1|806149_808297_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	93.2	0.0e+00
WP_111713229.1|808296_809415_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	78.3	1.5e-135
WP_111713230.1|809429_811316_+	gp58-like family protein	NA	Q938J9	Temperate_phage	84.4	1.9e-215
WP_063662164.1|811327_811759_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	96.5	1.4e-70
WP_111713231.1|811761_812373_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	92.6	1.0e-82
WP_011017397.1|812384_812657_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_003058873.1|812653_812881_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_015898599.1|812997_814332_+	lysin	NA	Q5MY96	Streptococcus_phage	93.2	5.9e-248
WP_080286815.1|814605_815283_+	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.0	1.2e-26
WP_002984880.1|816623_817100_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
816381:816431	attR	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG	NA	NA	NA	NA
WP_111713232.1|817157_818339_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_111713233.1|818328_819576_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_111713234.1|819634_821287_-	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_111713235.1|821640_822639_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168389613.1|822589_822808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002989993.1|822983_823853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002989991.1|823849_824608_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
WP_002984872.1|824811_826473_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002984871.1|826605_827391_+	esterase family protein	NA	NA	NA	NA	NA
WP_002984870.1|827420_827747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984869.1|827792_829700_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	2.6e-55
WP_002989983.1|829984_830953_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_111713447.1|831011_832010_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_111713236.1|832194_833604_+	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_002989978.1|833931_835695_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.5	1.2e-33
WP_111713237.1|836367_838647_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_002992006.1|838879_839869_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	25.2	8.2e-13
WP_010922242.1|839977_840769_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_172452788.1|840768_842112_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_002984858.1|842218_843070_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_002989967.1|843066_844023_+	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_010922245.1|844076_845432_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_111713239.1|845565_846207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111713240.1|846269_847400_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_111713241.1|847409_848162_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_002984852.1|848161_848926_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_014635437.1|848925_849558_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_111713243.1|852664_854497_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
WP_172452797.1|854781_855729_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_111713245.1|855914_856352_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_111713246.1|856481_857501_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_111713247.1|857707_858133_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002989934.1|858159_858651_+	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_002984844.1|858667_859477_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002989931.1|859473_860301_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002984838.1|860436_862086_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.3	1.8e-12
WP_002984836.1|862089_862878_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011017728.1|862871_863918_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_111688298.1|864039_865437_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002984829.1|865538_867335_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002989923.1|867519_868122_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_111713248.1|868246_869656_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_111713249.1|869723_871100_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_111713250.1|871302_872310_+|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.1e-32
>prophage 7
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	1017924	1100891	1931144	tRNA,capsid,tail,transposase,protease,integrase,head,terminase,portal	Streptococcus_phage(51.56%)	96	1052366:1052425	1097519:1097596
WP_002989678.1|1017924_1018809_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_009880635.1|1018924_1020265_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_002984488.1|1020361_1021318_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002993908.1|1021328_1021925_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_111713274.1|1022016_1024653_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_030126662.1|1024667_1025369_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_002984482.1|1025486_1026029_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984480.1|1026171_1026813_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002994467.1|1026975_1027464_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|1027474_1027675_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984475.1|1027715_1028255_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|1028267_1028456_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984470.1|1028466_1029078_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|1029114_1029363_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_111713275.1|1029724_1032043_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	2.1e-131
WP_111713276.1|1032154_1033165_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.1e-32
WP_002984465.1|1033657_1034980_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_011017829.1|1035099_1036335_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_002984462.1|1036704_1037478_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_002984460.1|1037847_1038684_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023612213.1|1038699_1039329_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.7e-27
WP_002984455.1|1039338_1039980_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002984453.1|1040086_1040422_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011284834.1|1040617_1042432_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.2e-97
WP_002984449.1|1042607_1043165_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002984447.1|1043382_1044885_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984444.1|1044947_1045961_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002984441.1|1046040_1049151_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.8	1.4e-119
WP_002989617.1|1049335_1049707_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984437.1|1049706_1050405_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002984433.1|1050414_1051200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002989607.1|1051330_1051945_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
1052366:1052425	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
WP_011054546.1|1052535_1052724_-	hypothetical protein	NA	A3F673	Streptococcus_phage	84.7	1.2e-21
WP_021340779.1|1052838_1053627_-	streptococcal pyrogenic exotoxin SpeL	NA	Q938J1	Temperate_phage	41.4	9.1e-47
WP_014635497.1|1053908_1054622_-	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	59.5	9.0e-78
WP_011054729.1|1054925_1055792_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
WP_011017840.1|1055779_1056304_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_111713277.1|1056443_1057640_-	streptodornase Sda1	NA	Q938J4	Temperate_phage	84.2	1.8e-200
WP_111713278.1|1057750_1057936_-	hypothetical protein	NA	Q938J5	Temperate_phage	96.7	1.1e-24
WP_111713279.1|1057932_1058232_-	hypothetical protein	NA	Q938J6	Temperate_phage	79.2	6.7e-35
WP_111713280.1|1058242_1058860_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	90.7	1.5e-81
WP_002987513.1|1058862_1059294_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	100.0	1.1e-73
WP_111713281.1|1059305_1061342_-	gp58-like family protein	NA	Q938J9	Temperate_phage	71.4	9.1e-184
WP_111713282.1|1061351_1062359_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	62.3	7.6e-107
WP_111713283.1|1062355_1064500_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	90.9	0.0e+00
WP_111688276.1|1064496_1065204_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	69.8	1.1e-91
WP_111713284.1|1065203_1069127_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.6	5.0e-239
WP_021299462.1|1069139_1069289_-	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_011017586.1|1069336_1069663_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	8.3e-39
WP_011017585.1|1069715_1070324_-	hypothetical protein	NA	J7KKC8	Streptococcus_phage	71.9	6.7e-74
WP_011017584.1|1070339_1070765_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	84.4	7.2e-67
WP_003055321.1|1070761_1071139_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	76.0	1.5e-47
WP_003055344.1|1071135_1071483_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	80.9	2.6e-46
WP_021340811.1|1071479_1071782_-|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	88.8	3.0e-43
WP_021340812.1|1071926_1073111_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.6	1.5e-162
WP_032465106.1|1073135_1073801_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	77.7	1.9e-90
WP_111688275.1|1073778_1074999_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	5.8e-186
WP_002985363.1|1075032_1075257_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_002985365.1|1075249_1075420_-	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_021340859.1|1075416_1077171_-|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.1	0.0e+00
WP_002985371.1|1077185_1077653_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_029714359.1|1077821_1078163_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	89.8	9.6e-54
WP_001132273.1|1078398_1078584_+	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_002987543.1|1078635_1079013_+	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_002990048.1|1079328_1079541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284864.1|1079630_1080545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017866.1|1081465_1081906_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_021340848.1|1082178_1082814_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.4	2.5e-87
WP_002987468.1|1082813_1083215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340166.1|1083312_1083540_-	hypothetical protein	NA	A3F630	Streptococcus_phage	76.0	1.9e-26
WP_021340844.1|1083543_1084029_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	4.6e-94
WP_032459898.1|1084032_1084317_-	hypothetical protein	NA	A3F628	Streptococcus_phage	91.5	8.6e-40
WP_021340843.1|1084313_1084727_-	hypothetical protein	NA	Q938M1	Temperate_phage	63.8	2.4e-35
WP_011018137.1|1084723_1085008_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	97.9	2.7e-49
WP_032459900.1|1085249_1085606_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	96.6	4.6e-59
WP_032459901.1|1085589_1085910_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	94.3	5.5e-51
WP_021340849.1|1086569_1088045_-	nucleoside triphosphatase	NA	A0A1P8VVM0	Streptococcus_phage	87.1	2.0e-249
WP_014411877.1|1088034_1088847_-	bifunctional DNA primase/polymerase	NA	A0A1P8VVM6	Streptococcus_phage	97.4	1.3e-152
WP_002995969.1|1088849_1089308_-	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	100.0	3.8e-82
WP_021340851.1|1089323_1090553_-	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	99.8	1.3e-236
WP_002995975.1|1090654_1091335_-	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
WP_021340846.1|1091335_1091818_-	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	98.8	7.9e-78
WP_021340847.1|1092046_1092361_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	95.2	1.2e-50
WP_165357622.1|1092376_1092514_-	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	91.1	5.4e-16
WP_111713286.1|1092510_1092807_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	99.0	1.4e-48
WP_011054585.1|1092885_1093071_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1093237_1093477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1093626_1093836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340169.1|1094051_1094291_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	97.5	3.1e-35
WP_111688274.1|1094340_1094847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340823.1|1094843_1094990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340822.1|1095164_1095953_+	peptidase S24	NA	A0A1S5SD15	Streptococcus_phage	62.6	2.9e-85
WP_011106738.1|1095962_1096268_+	membrane protein	NA	NA	NA	NA	NA
WP_011054595.1|1096387_1097476_+|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	4.7e-203
WP_002989605.1|1097749_1098370_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
1097519:1097596	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTT	NA	NA	NA	NA
WP_111713287.1|1098626_1100891_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
>prophage 8
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	1214149	1255275	1931144	holin,tail,integrase,terminase,portal	Streptococcus_phage(70.83%)	60	1216355:1216374	1252648:1252667
WP_002983921.1|1214149_1216012_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	1.1e-90
1216355:1216374	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_011017964.1|1216543_1216726_-	hypothetical protein	NA	A3F673	Streptococcus_phage	76.7	1.4e-19
WP_011285611.1|1216964_1217765_+	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011017966.1|1218035_1218470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111713311.1|1218539_1219748_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	84.6	4.1e-208
WP_000609113.1|1219863_1220091_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_002987582.1|1220087_1220363_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_010922094.1|1220372_1220990_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.3	1.1e-76
WP_111713312.1|1220992_1221424_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	95.8	3.9e-68
WP_111713313.1|1221435_1223220_-	hypothetical protein	NA	Q938J9	Temperate_phage	47.3	4.1e-95
WP_023079488.1|1223234_1224236_-	hyaluronidase HylP	NA	Q938K0	Temperate_phage	71.6	2.3e-127
WP_010922451.1|1224235_1226194_-|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.2	5.3e-96
WP_010922452.1|1226190_1226886_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	7.6e-05
WP_010922453.1|1226882_1229240_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.6	6.5e-141
WP_010922454.1|1229239_1229611_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	62.4	2.9e-35
WP_111713314.1|1229900_1230494_-|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	62.5	2.7e-59
WP_000573598.1|1230505_1230841_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_010922457.1|1230841_1231078_-	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	71.4	2.5e-21
WP_011285617.1|1231070_1231409_-	hypothetical protein	NA	M1PFF8	Streptococcus_phage	70.3	2.2e-42
WP_010922459.1|1231368_1231791_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	70.8	3.7e-47
WP_010922460.1|1231800_1232001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922462.1|1232937_1233399_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	4.5e-38
WP_011285619.1|1233479_1234895_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	2.9e-213
WP_010922464.1|1235004_1235271_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	86.4	7.3e-33
WP_015055972.1|1235263_1235443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922466.1|1235492_1235717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922467.1|1235722_1237216_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
WP_010922468.1|1237208_1238477_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
WP_002994106.1|1238473_1238830_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_010922469.1|1238978_1239323_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	5.5e-41
WP_010922470.1|1239431_1239851_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	8.7e-57
WP_010922070.1|1240118_1240754_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	69.4	2.0e-89
WP_002988369.1|1240755_1241025_-	hypothetical protein	NA	A7J287	Streptococcus_phage	71.9	9.6e-25
WP_002988366.1|1241108_1241621_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	78.0	2.3e-67
WP_020837403.1|1241617_1241959_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	1.1e-12
WP_011285624.1|1242136_1242304_-	hypothetical protein	NA	A0A1S5SEF3	Streptococcus_phage	51.9	3.3e-07
WP_011285625.1|1242313_1243111_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	84.5	6.0e-131
WP_011285626.1|1243107_1244037_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	72.2	1.1e-91
WP_002988359.1|1244039_1244369_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	83.5	2.1e-45
WP_011017565.1|1244424_1244631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017992.1|1244639_1244780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985387.1|1244776_1245010_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_011285627.1|1244990_1245380_-	DnaD domain protein	NA	Q938N2	Temperate_phage	81.4	9.3e-45
WP_011285628.1|1245863_1246049_-	hypothetical protein	NA	Q938N3	Temperate_phage	88.5	5.8e-21
WP_002990080.1|1246050_1246362_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.4	4.1e-43
WP_011054585.1|1246439_1246625_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1246791_1247031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285629.1|1247172_1247979_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	82.1	7.9e-123
WP_010922204.1|1247913_1248180_-	hypothetical protein	NA	A0A1S5SC19	Streptococcus_phage	66.3	1.1e-23
WP_111713315.1|1248211_1248928_-	phage antirepressor KilAC domain-containing protein	NA	C9WB91	Streptococcus_virus	87.3	5.8e-117
WP_002993390.1|1248939_1249131_-	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
WP_020837421.1|1249766_1249862_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_011285631.1|1250284_1250632_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SEQ8	Streptococcus_phage	71.8	3.6e-40
WP_002994744.1|1250635_1251016_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	61.1	8.0e-41
WP_011285632.1|1251027_1251294_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_003051793.1|1251417_1252560_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1252649_1252925_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1252648:1252667	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_111713316.1|1253023_1253611_-	YpmS family protein	NA	NA	NA	NA	NA
WP_172450323.1|1253588_1254431_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002983913.1|1254423_1255275_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
>prophage 9
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	1260625	1268430	1931144	transposase	Klosneuvirus(16.67%)	6	NA	NA
WP_011017997.1|1260625_1261966_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
WP_010922486.1|1262118_1262973_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_032467264.1|1263180_1264875_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.2	4.5e-128
WP_111713318.1|1265130_1266129_+|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.7e-32
WP_002983891.1|1266138_1267548_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	4.4e-60
WP_002983889.1|1267695_1268430_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	6.3e-34
>prophage 10
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	1492776	1594827	1931144	holin,tRNA,capsid,tail,transposase,integrase,head,terminase,portal	Streptococcus_phage(35.29%)	109	1545063:1545080	1591903:1591920
WP_111713344.1|1492776_1494216_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_002983290.1|1494215_1495682_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002988561.1|1495681_1495984_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_002983281.1|1496977_1497532_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	38.5	2.0e-24
WP_002983278.1|1497678_1498461_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_011528914.1|1498677_1499892_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002983265.1|1500122_1500575_+	universal stress protein	NA	NA	NA	NA	NA
WP_111713345.1|1500696_1502085_-	Cof-type HAD-IIB family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	37.1	4.7e-22
WP_002983258.1|1502156_1503122_+	asparaginase	NA	NA	NA	NA	NA
WP_002988556.1|1503470_1504175_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002991995.1|1504187_1505090_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.2	3.9e-38
WP_111713346.1|1505382_1507398_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011285690.1|1507772_1509227_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.2e-12
WP_002983239.1|1509163_1509844_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002983234.1|1509840_1510434_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_014635665.1|1510430_1512101_-	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.1	1.3e-18
WP_111713347.1|1512093_1513857_-	ABC transporter ATP-binding protein/permease	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	5.9e-22
WP_010922614.1|1513853_1514690_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.9e-17
WP_111713348.1|1514686_1515709_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	9.1e-15
WP_111713349.1|1515710_1516595_-	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_011285109.1|1516578_1517454_-	heme-binding protein	NA	NA	NA	NA	NA
WP_111713350.1|1517650_1521478_-	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_002983203.1|1521970_1523482_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_038432480.1|1523568_1524669_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.0	3.3e-31
WP_002983199.1|1524665_1525022_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002983193.1|1525137_1527657_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_111713351.1|1527750_1528734_-|transposase	IS30-like element IS1239 family transposase	transposase	H7BW61	unidentified_phage	35.0	2.1e-32
WP_002983189.1|1528876_1529830_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_023078710.1|1529924_1530809_-	ROK family protein	NA	NA	NA	NA	NA
WP_111713352.1|1531072_1534072_-	endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_002983178.1|1534302_1536186_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_111713353.1|1536427_1537867_+	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_002988504.1|1537871_1538837_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	8.0e-21
WP_002983167.1|1538977_1539430_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002983163.1|1539422_1539812_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002988496.1|1539857_1540415_-	elongation factor P	NA	NA	NA	NA	NA
WP_002988493.1|1540510_1540972_-	hypothetical protein	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
WP_111713354.1|1541006_1542080_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.2	3.0e-16
WP_111713355.1|1542195_1545024_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	1.4e-304
1545063:1545080	attL	CTTATATTATAACAAAAA	NA	NA	NA	NA
WP_011184907.1|1545250_1545433_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.3	4.4e-21
WP_172452791.1|1545670_1546471_+	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011017966.1|1546740_1547175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111713357.1|1547244_1548453_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	85.8	2.6e-210
WP_011054444.1|1548568_1548796_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_011017397.1|1548792_1549065_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_011054443.1|1549076_1549709_-	hypothetical protein	NA	Q938J7	Temperate_phage	49.5	2.0e-44
WP_002988448.1|1549711_1550140_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_011017395.1|1550151_1552056_-	gp58-like family protein	NA	Q938J9	Temperate_phage	83.7	1.1e-210
WP_111713358.1|1552065_1553073_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	63.2	1.3e-109
WP_111713359.1|1553069_1555121_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	85.2	0.0e+00
WP_011284845.1|1555117_1555897_-|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	54.0	1.9e-65
WP_111713360.1|1555928_1559564_-	tape measure protein	NA	U6E979	Streptococcus_phage	44.4	3.0e-04
WP_002984407.1|1559578_1559908_-	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	41.5	2.0e-11
WP_002984405.1|1559949_1560309_-	hypothetical protein	NA	D7RWD6	Brochothrix_phage	44.5	4.3e-20
WP_111713361.1|1560361_1560964_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	52.0	1.5e-41
WP_111713362.1|1561018_1561408_-|capsid	phage capsid protein	capsid	B5SP36	Lactococcus_phage	67.4	9.3e-45
WP_030126607.1|1561404_1561770_-	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	5.9e-17
WP_111713363.1|1561750_1562059_-	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	41.2	3.3e-13
WP_002988412.1|1562055_1562409_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
WP_002988409.1|1562422_1562665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063662363.1|1562674_1563757_-|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	57.4	9.1e-106
WP_002988404.1|1563759_1564140_-|head	head decoration protein	head	A0A0K2CNR0	Brevibacillus_phage	32.5	2.4e-05
WP_032460165.1|1564149_1564683_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	84.2	4.7e-15
WP_002984382.1|1564794_1565538_-	phage repressor protein/antirepressor Ant	NA	M1PKL6	Streptococcus_phage	56.9	5.3e-73
WP_002984380.1|1565539_1565788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017861.1|1565902_1566082_-	hypothetical protein	NA	M1NRK8	Streptococcus_phage	79.7	2.6e-18
WP_002984375.1|1566177_1566447_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	84.1	2.3e-34
WP_010922213.1|1566506_1566686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111713364.1|1566676_1568302_-|capsid	minor capsid protein	capsid	U6E9F1	Streptococcus_phage	44.2	1.7e-47
WP_111713365.1|1568282_1569785_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.3	6.0e-140
WP_012560959.1|1569796_1571086_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	74.9	1.7e-183
WP_002990047.1|1571063_1571546_-|terminase	terminase small subunit	terminase	E0Y3R8	Staphylococcus_virus	40.3	3.3e-15
WP_011017866.1|1572020_1572461_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_164997036.1|1572734_1572905_-	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	98.2	1.1e-26
WP_111710973.1|1572901_1573633_-	DUF1642 domain-containing protein	NA	A0A2H4JBN7	uncultured_Caudovirales_phage	38.1	1.4e-25
WP_021299463.1|1573680_1574445_-	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	92.3	4.2e-134
WP_063632581.1|1574434_1574917_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	99.4	5.6e-92
WP_111713366.1|1574904_1575132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111713367.1|1575135_1575408_-	hypothetical protein	NA	A7J287	Streptococcus_phage	64.4	1.7e-21
WP_010922069.1|1575410_1575632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922068.1|1575628_1576024_-	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	65.6	9.4e-45
WP_010922067.1|1576016_1576235_-	hypothetical protein	NA	A0A1S5SEA6	Streptococcus_phage	64.3	1.3e-16
WP_111713368.1|1576512_1578786_-	AAA family ATPase	NA	Q5YA88	Bacillus_phage	64.0	6.4e-279
WP_010922065.1|1578775_1579405_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	43.1	9.1e-42
WP_010922064.1|1579414_1580998_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	77.4	1.3e-233
WP_010922063.1|1580997_1581633_-	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	46.7	4.3e-31
WP_111713369.1|1581654_1582389_-	hypothetical protein	NA	Q0R597	Streptococcus_phage	61.3	1.0e-76
WP_010922061.1|1582390_1582813_-	hypothetical protein	NA	M1I9V9	Streptococcus_phage	59.9	4.2e-35
WP_111713370.1|1582852_1583932_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	52.6	1.8e-98
WP_094398261.1|1583946_1585266_-	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	64.3	2.9e-154
WP_063632643.1|1585249_1585495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094398260.1|1585496_1585715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003056191.1|1585724_1585865_-	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	88.9	2.1e-15
WP_001191791.1|1585894_1586152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021340658.1|1586229_1586415_-	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	83.6	1.4e-22
WP_023078400.1|1586558_1586789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021733331.1|1586914_1587121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164463.1|1587268_1587484_-	helix-turn-helix transcriptional regulator	NA	J7KK54	Streptococcus_phage	98.6	5.0e-32
WP_011017887.1|1587581_1588265_+	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	59.4	1.2e-71
WP_011184610.1|1588391_1588550_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	1.7e-21
WP_111713371.1|1588608_1588824_+	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	8.8e-29
WP_021340643.1|1588809_1588959_-	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
WP_111713372.1|1589318_1590059_+	helix-turn-helix transcriptional regulator	NA	J7KJ52	Streptococcus_phage	92.2	1.3e-127
WP_021340646.1|1590130_1590553_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_023078397.1|1590668_1591823_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	94.8	1.2e-196
WP_002983147.1|1592066_1593011_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
1591903:1591920	attR	CTTATATTATAACAAAAA	NA	NA	NA	NA
WP_002983144.1|1593142_1593799_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983142.1|1593931_1594171_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002983122.1|1594335_1594827_-	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
>prophage 11
NZ_LS483356	Streptococcus pyogenes strain NCTC8230 chromosome 1	1931144	1884391	1897076	1931144	holin,integrase	Streptococcus_phage(61.54%)	24	1873642:1873657	1890270:1890285
1873642:1873657	attL	ACCATCTAGTAATTCT	NA	NA	NA	NA
WP_021299091.1|1884391_1885537_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	2.7e-84
WP_011185066.1|1885739_1885883_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_011529101.1|1886780_1887428_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	28.1	4.4e-15
WP_011529102.1|1887593_1887791_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	72.3	3.7e-18
WP_172452795.1|1887804_1888431_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	41.8	8.8e-37
WP_021299105.1|1888444_1888687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011529105.1|1888942_1889275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011529106.1|1889271_1889493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011529107.1|1889495_1889687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206026.1|1889698_1890061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011529108.1|1890057_1890387_+	hypothetical protein	NA	NA	NA	NA	NA
1890270:1890285	attR	AGAATTACTAGATGGT	NA	NA	NA	NA
WP_011529109.1|1890389_1890662_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	3.6e-19
WP_011529110.1|1890662_1891523_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	72.0	2.5e-119
WP_042769766.1|1891597_1893037_+	DNA primase	NA	Q9AZI5	Lactococcus_phage	38.0	1.1e-69
WP_042769761.1|1893313_1893487_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	3.3e-10
WP_011529113.1|1893492_1893666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011529114.1|1893667_1893934_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	46.2	8.9e-15
WP_111713428.1|1893940_1894099_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_011529116.1|1894199_1894802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880490.1|1894785_1895121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011529118.1|1895255_1895663_+	hypothetical protein	NA	A0A1X9I6S2	Streptococcus_phage	30.8	4.7e-07
WP_012560493.1|1895768_1896182_+	DUF1492 domain-containing protein	NA	A0A1S5S8W3	Streptococcus_phage	30.8	5.1e-09
WP_011529120.1|1896256_1896457_+	hypothetical protein	NA	S6C469	Thermus_phage	43.9	5.1e-07
WP_011285285.1|1896692_1897076_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	41.7	3.7e-14
