The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	36649	49035	1915789		Synechococcus_phage(28.57%)	8	NA	NA
WP_111688390.1|36649_40375_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	2.7e-40
WP_009880323.1|40608_42063_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_023610840.1|42090_43113_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	9.0e-63
WP_023079049.1|43280_43835_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	4.0e-25
WP_085614048.1|44018_45566_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_010921776.1|45623_46748_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_076634015.1|47000_48266_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_023079042.1|48543_49035_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	1.4e-18
>prophage 2
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	88237	104581	1915789	integrase,tRNA,holin	Streptococcus_phage(66.67%)	25	83611:83625	99663:99677
83611:83625	attL	TTTATCAAAAACACA	NA	NA	NA	NA
WP_002986585.1|88237_88957_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.3e-15
WP_002987764.1|88949_89765_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002986580.1|89804_90188_-	HIT family protein	NA	NA	NA	NA	NA
WP_111688593.1|90351_91497_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	49.7	1.9e-98
WP_011185066.1|91813_91957_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003058809.1|92807_93575_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|93728_93935_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_002992502.1|93968_94169_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	56.7	3.4e-11
WP_011185070.1|94189_94597_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	68.7	8.5e-49
WP_111688392.1|94610_95240_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	43.0	9.5e-31
WP_021775546.1|95484_95817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021775572.1|95813_96035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021775551.1|96037_96229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|96240_96570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051914.1|96572_96845_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_021775562.1|96845_97703_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	74.8	1.5e-124
WP_021775541.1|97671_99360_+	nucleoside triphosphatase	NA	A0A1X9I717	Streptococcus_phage	82.3	1.1e-259
WP_000694576.1|99646_99820_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	4.3e-10
99663:99677	attR	TTTATCAAAAACACA	NA	NA	NA	NA
WP_168389368.1|99825_99999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021775557.1|100000_100510_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	62.5	1.6e-28
WP_002992480.1|100583_101072_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	1.4e-45
WP_020905578.1|101471_101834_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_020905579.1|101808_102186_+	phage encoded transcriptional regulator, ArpU family	NA	Q938L8	Temperate_phage	41.7	3.7e-14
WP_085613994.1|102322_103063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085613995.1|103321_104581_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.0	9.0e-73
>prophage 3
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	348426	394460	1915789	portal,tail,terminase,capsid,holin,integrase,head	Streptococcus_phage(81.63%)	54	351334:351351	389892:389909
WP_002983122.1|348426_348918_+	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.7e-59
WP_002983142.1|349082_349322_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002983144.1|349454_350111_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983147.1|350242_351187_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
351334:351351	attL	TTTTTGTTATAATATAAG	NA	NA	NA	NA
WP_047149517.1|351430_352528_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	94.8	1.7e-197
WP_047149516.1|352703_353255_-	hypothetical protein	NA	A7J267	Streptococcus_phage	92.3	9.0e-86
WP_047149515.1|353265_353649_-	phage protein	NA	A7J268	Streptococcus_phage	98.4	1.5e-68
WP_011184049.1|353662_354013_-	helix-turn-helix transcriptional regulator	NA	M1I9X0	Streptococcus_phage	85.3	1.2e-48
WP_001283052.1|354653_354845_+	hypothetical protein	NA	A7J270	Streptococcus_phage	100.0	7.3e-27
WP_047149514.1|354865_355096_+	hypothetical protein	NA	A7J271	Streptococcus_phage	89.3	6.5e-30
WP_047149513.1|355183_355441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611037.1|355469_355640_+	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_047149512.1|355632_355836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047149511.1|355832_356219_+	hypothetical protein	NA	A7J274	Streptococcus_phage	86.6	4.0e-56
WP_030127426.1|356364_356568_+	hypothetical protein	NA	A7J276	Streptococcus_phage	89.6	3.7e-29
WP_030127427.1|356655_356955_+	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	3.7e-41
WP_011888943.1|356954_358112_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_086934854.1|358120_358684_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_111688400.1|358726_360649_+	DNA polymerase	NA	A7J280	Streptococcus_phage	98.9	0.0e+00
WP_111688401.1|360653_363038_+	DNA primase	NA	A7J282	Streptococcus_phage	98.0	2.6e-286
WP_023613183.1|363404_363680_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	97.8	1.3e-45
WP_111688402.1|363676_364999_+	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.0	2.8e-250
WP_011054883.1|364999_365170_+	hypothetical protein	NA	A7J285	Streptococcus_phage	94.2	3.1e-21
WP_011054882.1|365162_365435_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054881.1|365567_365984_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_111688403.1|366101_366524_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	99.3	1.1e-67
WP_011054879.1|366513_367791_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	100.0	1.1e-246
WP_038433243.1|367806_369339_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.8	4.5e-292
WP_032465703.1|369298_370747_+|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.8	1.2e-278
WP_011054876.1|370774_370963_+	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_011888934.1|370967_371234_+	hypothetical protein	NA	Q938K9	Temperate_phage	96.6	2.9e-37
WP_011888933.1|371395_371965_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	100.0	1.9e-83
WP_002983429.1|371977_372865_+	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011888932.1|372876_373233_+|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	99.2	7.9e-59
WP_011054872.1|373243_373522_+	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011106640.1|373518_373863_+	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054870.1|373866_374226_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011054869.1|374237_374837_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011888931.1|374890_375346_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	99.3	5.3e-76
WP_011888930.1|375420_375654_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	98.7	1.3e-33
WP_111688404.1|375668_380051_+	tape measure protein	NA	A7J2A5	Streptococcus_phage	74.2	1.2e-225
WP_011054865.1|380062_380905_+	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.9	8.8e-157
WP_011888928.1|380914_382894_+|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.8	0.0e+00
WP_011888927.1|382890_384006_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	74.9	1.6e-142
WP_011017395.1|384020_385925_+	gp58-like family protein	NA	Q938J9	Temperate_phage	83.7	1.1e-210
WP_002988448.1|385936_386365_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_046735270.1|386367_387006_+	hypothetical protein	NA	A3F662	Streptococcus_phage	52.7	2.0e-44
WP_011017397.1|387017_387290_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_029714020.1|387286_387514_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	2.2e-30
WP_047149505.1|387636_388842_+	glucosaminidase domain-containing protein	NA	A7J2B5	Streptococcus_phage	82.8	1.5e-202
WP_047149504.1|389538_389721_+	hypothetical protein	NA	A3F673	Streptococcus_phage	73.3	1.7e-17
WP_032465207.1|389947_392776_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	7.7e-306
389892:389909	attR	TTTTTGTTATAATATAAG	NA	NA	NA	NA
WP_023078663.1|392890_393964_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	32.2	1.3e-16
WP_002988493.1|393998_394460_+	hypothetical protein	NA	F8WPT6	Bacillus_phage	55.1	1.1e-33
>prophage 4
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	554630	616545	1915789	tRNA,portal,tail,terminase,capsid,holin,integrase	Streptococcus_pyogenes_phage(56.45%)	72	551570:551585	621407:621422
551570:551585	attL	CAGATAGTCAAGAAGT	NA	NA	NA	NA
WP_085613764.1|554630_555566_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
WP_085613763.1|555555_556878_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002983660.1|556915_557656_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_111688421.1|557652_559551_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	B5LWE2	Feldmannia_species_virus	30.3	5.4e-21
WP_011054833.1|559673_560366_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002991890.1|560362_561367_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002983671.1|561359_562001_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085613761.1|562037_563438_+	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	43.5	2.4e-26
WP_023610575.1|563437_563815_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085613760.1|563832_564774_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	76.9	5.1e-129
WP_032465870.1|564901_565534_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	54.3	1.9e-63
WP_076634161.1|565589_566915_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	51.1	1.8e-116
WP_111688422.1|566886_567552_+	ComF family protein	NA	NA	NA	NA	NA
WP_002988974.1|567631_568180_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002983693.1|575772_576306_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_009880741.1|576385_577162_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_009880742.1|577309_578476_-|integrase	tyrosine-type recombinase/integrase	integrase	C5J953	Streptococcus_phage	42.2	7.0e-80
WP_011018151.1|578653_580075_-	DUF4041 domain-containing protein	NA	M1PLF9	Streptococcus_phage	74.5	7.4e-140
WP_032463929.1|580089_580476_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	77.6	8.3e-54
WP_011888679.1|580459_580801_-	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_014635614.1|580998_581211_+	DNA-binding protein	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
WP_011018149.1|581238_581958_+	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	69.2	2.8e-87
WP_021340237.1|582367_582619_+	DNA-binding protein	NA	A0A1P8VVV6	Streptococcus_phage	96.4	4.4e-40
WP_111688423.1|582799_583114_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	94.2	5.9e-50
WP_009881060.1|583127_583958_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5S918	Streptococcus_phage	54.7	6.4e-67
WP_111688424.1|583944_584727_+	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	97.7	4.6e-144
WP_011285580.1|584717_584855_+	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	78.4	2.7e-07
WP_011285579.1|584867_585221_+	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
WP_021341161.1|585201_585456_+	hypothetical protein	NA	Q938N0	Temperate_phage	97.6	6.3e-42
WP_011018142.1|585477_585960_+	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
WP_111688425.1|585960_586635_+	ERF family protein	NA	Q938M8	Temperate_phage	97.3	8.4e-102
WP_011018140.1|586627_587047_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	99.3	2.1e-71
WP_011106686.1|587052_587256_+	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011018139.1|587255_587696_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	98.6	1.6e-80
WP_111688426.1|587692_588049_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	91.5	6.9e-55
WP_011018137.1|588273_588558_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	97.9	2.7e-49
WP_111688427.1|588554_588968_+	hypothetical protein	NA	Q938M1	Temperate_phage	62.4	1.2e-34
WP_011017570.1|588964_589249_+	hypothetical protein	NA	A3F628	Streptococcus_phage	79.8	4.6e-33
WP_111688428.1|589252_589735_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	96.2	1.4e-90
WP_172451638.1|589724_590489_+	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	92.3	1.6e-133
WP_032460172.1|590536_590830_+	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	99.0	2.7e-49
WP_021340586.1|591194_591632_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
WP_011285571.1|592106_592487_+	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
WP_009880266.1|592476_593751_+|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	100.0	1.1e-251
WP_009880265.1|593750_595076_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	100.0	7.4e-243
WP_009880264.1|595044_595953_+|capsid	minor capsid protein	capsid	A0A097PBF2	Streptococcus_pyogenes_phage	100.0	4.2e-88
WP_011054805.1|595959_596226_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	100.0	2.6e-38
WP_011054804.1|596375_596948_+	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	100.0	1.2e-72
WP_111688430.1|596965_597856_+|capsid	phage capsid protein	capsid	A0A097PAW2	Streptococcus_pyogenes_phage	98.8	5.5e-85
WP_009880260.1|597868_598162_+	Rho termination factor N-terminal domain-containing protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	100.0	2.0e-47
WP_009880259.1|598175_598520_+	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	100.0	1.1e-54
WP_111688431.1|598516_598828_+	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	98.1	1.0e-49
WP_009880257.1|598824_599220_+	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	100.0	1.8e-59
WP_009880256.1|599221_599632_+	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	100.0	1.4e-70
WP_009880255.1|599643_600150_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	100.0	2.6e-79
WP_009880254.1|600162_600480_+	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	100.0	4.9e-52
WP_009880253.1|600452_600911_+	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	100.0	2.3e-82
WP_011054802.1|600903_602709_+|tail	tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	99.7	8.8e-263
WP_111688432.1|602709_604194_+|tail	phage tail family protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	99.6	1.3e-291
WP_011054801.1|604194_607635_+|tail	phage tail protein	tail	A0A097PBF5	Streptococcus_pyogenes_phage	99.9	0.0e+00
WP_111688433.1|607639_609502_+	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	100.0	0.0e+00
WP_009880247.1|609512_609860_+	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	100.0	3.5e-59
WP_015055952.1|610009_610333_+	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	100.0	7.7e-53
WP_011054798.1|610332_610665_+|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	100.0	5.7e-51
WP_011054797.1|610666_611431_+	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	100.0	1.5e-150
WP_111688434.1|611442_612045_+	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.3	1.3e-90
WP_011054795.1|612055_612829_+	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	100.0	3.9e-135
WP_009880241.1|612838_613060_+	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
WP_009880240.1|613059_613719_+	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	100.0	8.5e-123
WP_009880239.1|613840_614596_-	streptococcal pyrogenic exotoxin SpeA	NA	A0A097PAT7	Streptococcus_pyogenes_phage	100.0	2.2e-143
WP_011054793.1|614816_614999_+	hypothetical protein	NA	J7KBZ4	Streptococcus_phage	81.4	1.1e-19
WP_085613935.1|615189_616545_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.4	2.3e-74
621407:621422	attR	CAGATAGTCAAGAAGT	NA	NA	NA	NA
>prophage 5
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	696904	805062	1915789	tRNA,portal,tail,terminase,capsid,protease,integrase,head	Streptococcus_phage(47.06%)	113	719184:719203	763943:763962
WP_032465122.1|696904_699706_+|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	27.0	1.4e-70
WP_002983878.1|699970_700273_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_085613970.1|700323_700779_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_111688441.1|700906_703189_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.4e-124
WP_002983885.1|703486_703717_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_023610107.1|703843_704530_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989107.1|704529_705264_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_002993337.1|705412_706822_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	5.7e-60
WP_002993334.1|706999_708694_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_010922486.1|708901_709756_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_085613971.1|709908_711249_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	1.4e-39
WP_002983901.1|711226_711442_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_111688442.1|711441_712314_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_085613972.1|712306_713134_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_014407685.1|713120_713591_+	arginine repressor	NA	NA	NA	NA	NA
WP_085613973.1|713612_715274_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_085613974.1|715445_716360_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983913.1|716575_717427_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_168393021.1|717419_718262_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989129.1|718239_718827_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|718925_719201_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
719184:719203	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_111688443.1|719290_720433_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.6	3.7e-174
WP_011285632.1|720556_720823_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_002994744.1|720834_721215_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	61.1	8.0e-41
WP_011285631.1|721218_721566_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SEQ8	Streptococcus_phage	71.8	3.6e-40
WP_020837421.1|721988_722084_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002993390.1|722719_722911_+	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
WP_011285630.1|722922_723639_+	phage antirepressor KilAC domain-containing protein	NA	C9WB91	Streptococcus_virus	87.7	6.8e-118
WP_010922204.1|723670_723937_+	hypothetical protein	NA	A0A1S5SC19	Streptococcus_phage	66.3	1.1e-23
WP_011285629.1|723871_724678_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	82.1	7.9e-123
WP_011284879.1|724819_725059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054585.1|725225_725411_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_047149513.1|725487_725745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611037.1|725773_725944_+	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_047149512.1|725936_726140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047149511.1|726136_726523_+	hypothetical protein	NA	A7J274	Streptococcus_phage	86.6	4.0e-56
WP_030127426.1|726668_726872_+	hypothetical protein	NA	A7J276	Streptococcus_phage	89.6	3.7e-29
WP_030127427.1|726959_727259_+	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	3.7e-41
WP_011888943.1|727258_728416_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_086934854.1|728424_728988_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_111688400.1|729030_730953_+	DNA polymerase	NA	A7J280	Streptococcus_phage	98.9	0.0e+00
WP_111688444.1|730957_733342_+	DNA primase	NA	A7J282	Streptococcus_phage	94.8	1.7e-277
WP_011054885.1|733727_734003_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
WP_111688445.1|733999_735322_+	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.3	1.3e-250
WP_164972002.1|735322_735493_+	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_011054882.1|735485_735758_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054881.1|735890_736307_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_111688446.1|736397_736850_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	91.4	1.8e-63
WP_111688447.1|736827_738135_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	76.0	9.0e-185
WP_002984369.1|738146_739649_+|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.9e-141
WP_002988386.1|739629_741192_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	1.6e-47
WP_002988389.1|741195_741381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011284859.1|741450_741765_+	hypothetical protein	NA	M1PLI3	Streptococcus_phage	72.8	6.8e-38
WP_032462876.1|741767_742034_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	71.6	6.6e-26
WP_014635511.1|742177_742711_+	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	84.2	1.2e-15
WP_063632936.1|742720_743101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023078263.1|743103_744186_+|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	56.9	2.2e-104
WP_011284854.1|744195_744438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984392.1|744451_744805_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
WP_002984393.1|744801_745110_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	5.7e-13
WP_038432514.1|745090_745456_+	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	47.9	3.1e-18
WP_014635506.1|745452_745842_+	hypothetical protein	NA	Q8LTQ5	Lactococcus_phage	69.8	2.2e-46
WP_080465176.1|745896_746502_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	53.0	2.1e-43
WP_023605140.1|746554_746914_+	hypothetical protein	NA	D7RWD6	Brochothrix_phage	45.5	1.5e-20
WP_111681178.1|746955_747285_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	4.3e-11
WP_111688448.1|747299_750935_+	tape measure protein	NA	U6E979	Streptococcus_phage	29.6	5.2e-04
WP_032461961.1|750966_751746_+|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	54.0	2.1e-64
WP_111688449.1|751742_753791_+|tail	phage tail protein	tail	A3F656	Streptococcus_phage	84.0	0.0e+00
WP_111688450.1|753790_754804_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	97.9	2.1e-181
WP_111688451.1|754818_756705_+	gp58-like family protein	NA	Q938J9	Temperate_phage	84.7	3.1e-218
WP_111688452.1|756716_757145_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	88.6	3.7e-63
WP_023611372.1|757147_757780_+	hypothetical protein	NA	Q938J7	Temperate_phage	50.0	2.6e-44
WP_023078532.1|757790_758087_+	hypothetical protein	NA	Q938J6	Temperate_phage	99.0	2.9e-46
WP_011054731.1|758083_758269_+	hypothetical protein	NA	Q938J5	Temperate_phage	100.0	1.7e-25
WP_111688453.1|758379_758937_+	glycoside hydrolase family 73 protein	NA	A7J2B5	Streptococcus_phage	85.9	6.5e-92
WP_011017838.1|761480_762194_+	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	59.8	6.9e-78
WP_011054727.1|762669_763245_+	hypothetical protein	NA	Q938J0	Temperate_phage	100.0	1.7e-111
WP_063632461.1|763590_763773_+	hypothetical protein	NA	A3F673	Streptococcus_phage	78.3	8.2e-20
WP_020837373.1|764303_766166_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	5.4e-90
763943:763962	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_021299339.1|766465_767401_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	4.6e-66
WP_002983928.1|767639_768335_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002983930.1|768442_768964_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002989140.1|769124_769667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002989141.1|769790_770570_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002983939.1|771367_771964_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_023078843.1|772064_773111_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_023078853.1|773309_774701_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_011017956.1|774780_775476_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_111688455.1|775723_777268_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.1e-35
WP_002989158.1|777574_779194_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_085613978.1|779321_781322_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	5.8e-66
WP_002989164.1|781345_781624_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_168393619.1|781613_782468_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_021299345.1|782507_783248_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002995626.1|783447_784110_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_085613979.1|784090_786334_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	58.7	8.8e-55
WP_011888795.1|786404_787445_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_023078860.1|787541_788147_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.7	1.3e-58
WP_023078840.1|788313_788496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023078847.1|788524_788773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085613980.1|789460_790681_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_085613981.1|790687_791716_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_085613982.1|791917_792622_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_085613983.1|792740_793457_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_085613984.1|793751_794714_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_085613985.1|794726_796532_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002995765.1|796907_798104_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_002989211.1|798169_798877_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
WP_085613986.1|798939_799995_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_085613987.1|800381_803000_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	6.7e-62
WP_023078838.1|803359_803575_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002995753.1|803571_804333_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_076634494.1|804351_805062_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	869319	950618	1915789	tRNA,portal,tail,terminase,capsid,holin,integrase,head	Streptococcus_phage(41.54%)	98	872682:872741	917162:917260
WP_076634262.1|869319_871584_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
WP_002989605.1|871840_872461_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
872682:872741	attL	GGTAACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTA	NA	NA	NA	NA
WP_011017891.1|872822_873911_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	99.4	4.2e-204
WP_002984270.1|874159_874969_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	35.8	3.8e-24
WP_011284884.1|874981_875725_-	helix-turn-helix domain-containing protein	NA	A0A1S5S8T5	Streptococcus_phage	62.9	2.5e-75
WP_021340643.1|876083_876233_+	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
WP_021341080.1|876218_876434_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
WP_011284883.1|876492_876651_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	8.4e-21
WP_011284882.1|876680_877280_-	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011284881.1|877333_877543_+	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
WP_011054589.1|877531_877918_-	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
WP_002984281.1|877991_878219_+	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	57.3	2.9e-14
WP_011017884.1|878326_878836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|879094_879304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284879.1|879453_879693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054585.1|879859_880045_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011017882.1|880123_880420_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_002984309.1|880416_880554_+	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	97.8	4.9e-17
WP_002984312.1|880634_880964_+	hypothetical protein	NA	A1EAC2	Streptococcus_phage	41.6	2.7e-13
WP_002984315.1|880963_881158_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_002984318.1|881154_881439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984321.1|881435_882119_+	AAA family ATPase	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
WP_075340263.1|882154_883558_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
WP_002984328.1|883562_884045_+	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
WP_111688459.1|884062_885616_+	phage resistance protein	NA	A0A1P8BM51	Lactococcus_phage	70.2	2.8e-209
WP_020833541.1|885882_886752_+	bifunctional DNA primase/polymerase	NA	A0A1P8BME8	Lactococcus_phage	65.2	9.8e-103
WP_002984338.1|886705_887056_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	89.4	2.6e-46
WP_111688460.1|887039_887396_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	90.7	2.6e-54
WP_020833538.1|887620_887896_+	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	73.6	2.9e-32
WP_020833537.1|887892_888162_+	hypothetical protein	NA	Q938M2	Temperate_phage	88.8	1.8e-39
WP_020833536.1|888171_888552_+	hypothetical protein	NA	A3F627	Streptococcus_phage	63.5	2.6e-36
WP_011018134.1|888548_888833_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	87.2	8.9e-37
WP_010922070.1|888834_889470_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	69.4	2.0e-89
WP_011284866.1|889743_890178_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	97.9	6.2e-74
WP_011284864.1|890755_891670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990048.1|891759_891972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002987543.1|892287_892665_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|892716_892902_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_047235590.1|892964_893432_+|terminase	terminase small subunit	terminase	A0A141E1Y3	Streptococcus_phage	70.8	1.9e-52
WP_020833530.1|893409_894717_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.7	2.0e-184
WP_002984369.1|894728_896231_+|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.9e-141
WP_111688462.1|896211_897225_+|capsid	minor capsid protein	capsid	O80166	Streptococcus_virus	44.2	3.6e-48
WP_011184918.1|897169_897775_+	phage protein	NA	NA	NA	NA	NA
WP_002988389.1|897778_897964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111688463.1|898349_898616_+	hypothetical protein	NA	Q938K9	Temperate_phage	94.3	1.2e-35
WP_002992590.1|898759_899293_+	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	82.5	1.8e-14
WP_111688464.1|899302_899683_+|head	head decoration protein	head	A0A286QRN6	Streptococcus_phage	37.8	1.1e-10
WP_111688465.1|899685_900768_+|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	56.6	5.0e-104
WP_111688466.1|900777_901020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111688467.1|901033_901387_+|head,tail	phage head-tail connector protein	head,tail	O80172	Streptococcus_virus	49.6	1.1e-25
WP_002984393.1|901383_901692_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	5.7e-13
WP_002984399.1|901672_902038_+	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	7.7e-17
WP_020833525.1|902034_902424_+	hypothetical protein	NA	B5SP36	Lactococcus_phage	69.0	8.4e-46
WP_168640736.1|902433_903123_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	52.2	4.5e-42
WP_002990023.1|903176_903530_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	48.6	5.5e-20
WP_002988428.1|903571_903901_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	5.7e-11
WP_111688468.1|903915_907551_+	tape measure protein	NA	U6E979	Streptococcus_phage	28.0	4.0e-04
WP_011184914.1|907583_908363_+|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	54.8	1.7e-66
WP_111688469.1|908359_910411_+|tail	phage tail protein	tail	A3F656	Streptococcus_phage	86.8	0.0e+00
WP_010922091.1|910407_911421_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	99.7	2.0e-184
WP_111688470.1|911435_913319_+	gp58-like family protein	NA	Q938J9	Temperate_phage	96.3	2.3e-250
WP_002987513.1|913330_913762_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	100.0	1.1e-73
WP_032461328.1|913764_914382_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.8	1.7e-77
WP_111688471.1|914391_914664_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	4.2e-36
WP_003058873.1|914660_914888_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_111688472.1|915003_916206_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	98.0	2.9e-238
WP_032461628.1|916901_917090_+	hypothetical protein	NA	A3F673	Streptococcus_phage	81.4	6.5e-20
WP_002989607.1|917680_918295_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
917162:917260	attR	GGTAACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGATTACTTACGGTAAGCATTGATGGAGCTGGTGGGAGT	NA	NA	NA	NA
WP_023078569.1|918427_919213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023078568.1|919222_919921_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	5.1e-09
WP_002989617.1|919920_920292_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023078571.1|920476_923587_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	3.7e-120
WP_010922375.1|923666_924680_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002984447.1|924742_926245_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984449.1|926462_927020_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011284834.1|927195_929010_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.2e-97
WP_002989626.1|929205_929541_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002992417.1|929647_930289_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989632.1|930298_930928_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.7e-27
WP_002989634.1|930943_931780_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_085613822.1|932148_932922_+	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_020833513.1|933291_934527_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_002984465.1|934646_935969_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_011284831.1|936497_938816_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	2.7e-131
WP_002984469.1|939179_939428_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002989652.1|939464_940076_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984473.1|940086_940275_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984475.1|940287_940827_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|940867_941068_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002994467.1|941078_941567_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984480.1|941729_942371_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085613823.1|942513_943056_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085613824.1|943173_943875_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	6.4e-36
WP_002989667.1|943889_946526_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002993908.1|946617_947214_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002989673.1|947224_948181_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_111688473.1|948277_949618_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_111688474.1|949733_950618_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	1264275	1274895	1915789		Streptococcus_phage(57.14%)	9	NA	NA
WP_085613704.1|1264275_1265418_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
WP_012560601.1|1265652_1266093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085613705.1|1266122_1267391_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_111688490.1|1267478_1268831_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.2	2.0e-30
WP_023080164.1|1269051_1269393_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_085613707.1|1269453_1270620_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1270713_1271400_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1271413_1272577_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_011054348.1|1272684_1274895_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
>prophage 8
NZ_LS483347	Streptococcus pyogenes strain NCTC8324 chromosome 1	1915789	1843308	1852733	1915789		Streptococcus_phage(85.71%)	11	NA	NA
WP_000051914.1|1843308_1843581_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_111688577.1|1843581_1844448_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.1	3.6e-121
WP_001069294.1|1846147_1846402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000694576.1|1846398_1846572_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	4.3e-10
WP_168389368.1|1846577_1846751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021775557.1|1846752_1847262_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	62.5	1.6e-28
WP_002992480.1|1847335_1847824_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	1.4e-45
WP_020905578.1|1848223_1848586_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_111688579.1|1848560_1848944_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	40.9	1.3e-14
WP_021775534.1|1849148_1849781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085613591.1|1850177_1852733_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.7	1.2e-42
