The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483345	Streptococcus pyogenes strain NCTC8231 chromosome 1	1796043	36639	48953	1796043		Synechococcus_phage(28.57%)	8	NA	NA
WP_047235603.1|36639_40365_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.9	4.6e-40
WP_047235604.1|40525_41980_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	1.7e-54
WP_111690694.1|42007_43030_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	2.4e-63
WP_002987709.1|43197_43752_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_023612984.1|43935_45483_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_002986694.1|45541_46666_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_032467308.1|46918_48184_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48461_48953_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483345	Streptococcus pyogenes strain NCTC8231 chromosome 1	1796043	956453	1043257	1796043	transposase,tail,integrase,capsid,head,terminase	Streptococcus_phage(65.38%)	84	998274:998295	1040483:1040504
WP_002987950.1|956453_957587_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_042769855.1|958593_959256_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_002989951.1|959245_959587_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_002989953.1|959583_960453_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_111690765.1|960452_964556_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_111690766.1|965034_965667_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002984852.1|965666_966431_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_011527617.1|966430_967183_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_002989962.1|967192_968323_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_023611160.1|968385_969027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184463.1|969150_970506_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_047235836.1|970559_971516_-	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_002989969.1|971512_972364_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_023611114.1|972470_973814_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_020905130.1|973813_974605_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_111690767.1|974714_975704_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	23.9	1.8e-12
WP_111690768.1|975936_978354_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_111690878.1|978635_978725_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_111690770.1|979028_980792_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.1	7.5e-33
WP_111690771.1|981122_982532_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_002989981.1|982716_983715_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002989983.1|983773_984742_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_011184455.1|985027_986935_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	3.4e-55
WP_002989987.1|986980_987307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235841.1|987336_988122_-	esterase family protein	NA	NA	NA	NA	NA
WP_002984872.1|988254_989916_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002989991.1|990119_990878_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
WP_011017706.1|990874_991744_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011184452.1|992089_993088_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047235843.1|993441_995094_+	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_002984878.1|995152_996400_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002984879.1|996389_997571_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002984880.1|997628_998105_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
998274:998295	attL	AAAGAACCTTGTCATATCAACG	NA	NA	NA	NA
WP_010922229.1|998708_999419_-	streptococcal pyrogenic exotoxin SpeH	NA	NA	NA	NA	NA
WP_047373492.1|999444_1000122_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
WP_011284838.1|1000395_1001730_-	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_002990010.1|1001841_1002027_-	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_002990012.1|1002023_1002320_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_111679824.1|1002329_1002941_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	95.1	1.7e-85
WP_047235845.1|1002943_1003372_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	82.9	4.0e-57
WP_111679823.1|1003380_1005264_-	gp58-like family protein	NA	Q938J9	Temperate_phage	75.9	4.5e-185
WP_011888927.1|1005278_1006394_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	74.9	1.6e-142
WP_011888928.1|1006390_1008370_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.8	0.0e+00
WP_111690772.1|1008379_1009222_-|tail	phage tail protein	tail	A7J2A6	Streptococcus_phage	97.5	2.5e-156
WP_047235850.1|1009233_1013616_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	75.9	3.0e-224
WP_011054867.1|1013630_1013864_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
WP_023079225.1|1013938_1014394_-	phage protein	NA	A7J2A3	Streptococcus_phage	98.7	1.2e-75
WP_011054869.1|1014447_1015047_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054870.1|1015058_1015418_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011106640.1|1015421_1015766_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054872.1|1015762_1016041_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011054873.1|1016051_1016408_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	100.0	4.6e-59
WP_002983429.1|1016419_1017307_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011054874.1|1017319_1017889_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	99.5	7.4e-83
WP_011054875.1|1018056_1018323_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
WP_011054876.1|1018327_1018516_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_011054877.1|1018543_1019992_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.6	1.3e-277
WP_111690773.1|1021500_1022778_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	98.4	1.4e-243
WP_111690774.1|1022767_1023220_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	99.3	1.5e-75
WP_002988747.1|1023309_1023726_-	DUF722 domain-containing protein	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
WP_002988743.1|1023722_1023914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023613218.1|1024064_1024331_-	hypothetical protein	NA	A7J287	Streptococcus_phage	62.9	3.5e-19
WP_002988735.1|1024327_1024495_-	hypothetical protein	NA	A7J285	Streptococcus_phage	94.5	1.9e-23
WP_011054884.1|1024495_1025818_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.3	7.3e-251
WP_023613183.1|1025814_1026090_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	97.8	1.3e-45
WP_111688401.1|1026456_1028841_-	DNA primase	NA	A7J282	Streptococcus_phage	98.0	2.6e-286
WP_111690775.1|1028845_1030768_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.8	0.0e+00
WP_086934854.1|1030810_1031374_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1031382_1032540_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_023613199.1|1032539_1032839_-	hypothetical protein	NA	A7J277	Streptococcus_phage	97.0	2.8e-41
WP_023613207.1|1032927_1033131_-	hypothetical protein	NA	A7J276	Streptococcus_phage	91.0	1.3e-29
WP_000049475.1|1033656_1033860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888947.1|1033852_1034023_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_023613185.1|1034024_1034336_-	hypothetical protein	NA	A1EAC3	Streptococcus_phage	85.3	1.4e-48
WP_011888681.1|1034752_1035472_-	phage antirepressor KilAC domain-containing protein	NA	M1Q1T4	Streptococcus_phage	70.3	7.4e-88
WP_014635614.1|1035499_1035712_-	DNA-binding protein	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
WP_011888679.1|1035909_1036251_+	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_111690776.1|1036234_1036618_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	76.0	1.2e-52
WP_023613205.1|1036619_1038284_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023613222.1|1038322_1039180_+	DNA adenine methylase	NA	A0A2H4UUI2	Bodo_saltans_virus	29.7	8.1e-17
WP_011888953.1|1039299_1040439_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	1.2e-119
WP_002984881.1|1040510_1041551_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
1040483:1040504	attR	CGTTGATATGACAAGGTTCTTT	NA	NA	NA	NA
WP_002990099.1|1041794_1042388_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_002992970.1|1042387_1043257_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
>prophage 3
NZ_LS483345	Streptococcus pyogenes strain NCTC8231 chromosome 1	1796043	1145276	1155881	1796043		Streptococcus_phage(57.14%)	9	NA	NA
WP_111690784.1|1145276_1146419_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.1e-24
WP_011017641.1|1146653_1147094_+	membrane protein	NA	NA	NA	NA	NA
WP_002992648.1|1147123_1148401_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_111690785.1|1148480_1149833_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	3.5e-30
WP_002990260.1|1150054_1150396_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_002990262.1|1150456_1151623_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1151716_1152403_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1152399_1153563_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_042361490.1|1153670_1155881_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	3.2e-267
>prophage 4
NZ_LS483345	Streptococcus pyogenes strain NCTC8231 chromosome 1	1796043	1440757	1446791	1796043		Streptococcus_phage(100.0%)	8	NA	NA
WP_111690815.1|1440757_1441585_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.1	8.4e-128
WP_014407341.1|1441658_1442015_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_111690816.1|1442313_1442943_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_111690817.1|1442989_1443382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017425.1|1443408_1444272_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.3	2.7e-113
WP_002985838.1|1444276_1444600_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_010921931.1|1445262_1446138_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_002990917.1|1446155_1446791_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
>prophage 5
NZ_LS483345	Streptococcus pyogenes strain NCTC8231 chromosome 1	1796043	1714082	1736910	1796043	tRNA,integrase	Streptococcus_phage(44.44%)	29	1717281:1717301	1731456:1731476
WP_047236048.1|1714082_1715303_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.7	7.8e-05
WP_047236089.1|1715313_1717296_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	3.0e-62
1717281:1717301	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_111690858.1|1717390_1718536_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	45.6	6.5e-86
WP_047236050.1|1718793_1719648_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.5	1.0e-56
WP_168681587.1|1719908_1720070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003058809.1|1720460_1721228_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|1721381_1721588_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_080343567.1|1721621_1722389_+	hypothetical protein	NA	A0A0A7S0G2	Clostridium_phage	53.7	5.0e-26
WP_111690859.1|1722398_1723016_+	phage repressor protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	44.0	5.8e-41
WP_000648623.1|1723042_1723285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992497.1|1723541_1723874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080032246.1|1723873_1724065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236052.1|1724076_1724439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236053.1|1724435_1724744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236054.1|1724746_1725019_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	4.7e-19
WP_047236055.1|1725019_1725886_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.1	1.4e-120
WP_011285279.1|1725897_1727292_+	phage protein	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	1.3e-48
WP_001069294.1|1727585_1727840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285281.1|1727836_1728010_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	8.6e-11
WP_047236056.1|1728015_1728189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236057.1|1728190_1728700_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	62.5	4.2e-29
WP_111690860.1|1728773_1729262_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	2.4e-45
WP_003058730.1|1729665_1730028_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.9	8.7e-05
WP_111690861.1|1730002_1730386_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	40.2	8.4e-14
WP_047236060.1|1730550_1731204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111690862.1|1731599_1734155_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.8e-43
1731456:1731476	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_002982173.1|1734141_1734348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002982171.1|1734490_1734928_-	arginine repressor	NA	NA	NA	NA	NA
WP_111690863.1|1735218_1736910_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	7.1e-73
