The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	36529	48842	1851237		Synechococcus_phage(28.57%)	8	NA	NA
WP_032467026.1|36529_40255_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	7.8e-40
WP_111676024.1|40415_41870_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	3.7e-54
WP_111676026.1|41897_42920_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	1.4e-63
WP_002986700.1|43087_43642_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_111676028.1|43825_45373_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_111676030.1|45430_46555_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	2.6e-07
WP_111676032.1|46807_48073_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48350_48842_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	668674	744716	1851237	transposase,protease	Bacillus_phage(41.67%)	55	NA	NA
WP_014407658.1|668674_669484_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010922414.1|669628_670126_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002984073.1|670125_671796_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.6	5.1e-47
WP_012560785.1|671891_672095_+	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
WP_002984078.1|672069_673011_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_111676271.1|673214_675593_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002989292.1|676129_677326_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
WP_002989295.1|677499_678759_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_111676272.1|679116_680106_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_032464424.1|680343_680886_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002989302.1|680894_682178_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002984100.1|682193_683054_+	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002984102.1|683055_684021_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_172449895.1|684131_685415_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_009880588.1|685407_685899_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011284919.1|686106_687558_+	LCP family protein	NA	NA	NA	NA	NA
WP_168435457.1|687639_689271_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	99.1	4.3e-253
WP_109991670.1|689289_689571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111676274.1|689658_690438_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	33.7	6.5e-13
WP_109991668.1|690434_691286_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	35.5	4.3e-34
WP_111676275.1|691765_693550_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_047926369.1|693713_694025_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012679256.1|694028_694244_+	conjugative transfer protein	NA	NA	NA	NA	NA
WP_109991666.1|694263_695130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109991682.1|695149_695413_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109991665.1|695416_695806_+	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	81.5	8.1e-49
WP_111676276.1|695717_698144_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_109991664.1|698147_700265_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_109991663.1|700277_700517_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_111676277.1|700491_701958_+	DUF4366 domain-containing protein	NA	NA	NA	NA	NA
WP_109991661.1|703659_705195_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_109991660.1|712827_714735_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	25.6	6.9e-24
WP_145959537.1|715432_716758_+	helicase	NA	NA	NA	NA	NA
WP_109991681.1|716800_717472_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_109991659.1|717641_718709_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_111676281.1|718701_720936_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_109991657.1|721020_721695_+	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_111676283.1|726118_727828_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	9.8e-38
WP_111676933.1|729306_730008_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_111676285.1|730032_730629_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_111676287.1|730887_731298_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_168410084.1|731780_731948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111676289.1|732017_733697_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	29.4	7.4e-38
WP_111676291.1|734697_735153_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_111676293.1|735106_736591_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_111676295.1|736964_738185_+	MFS transporter	NA	NA	NA	NA	NA
WP_002984124.1|738304_738670_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_053308406.1|738784_739516_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_023611383.1|739532_739646_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023080007.1|739685_739856_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.3	2.6e-07
WP_031577484.1|739901_740255_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.2	9.1e-07
WP_020837336.1|740287_740581_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002984130.1|740658_741969_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_002992869.1|742192_743065_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_172450033.1|743364_744716_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.4	4.4e-65
>prophage 3
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	1014506	1070983	1851237	head,capsid,tRNA,terminase,portal,holin,protease,integrase,tail	Streptococcus_phage(51.85%)	70	1013360:1013410	1056631:1056681
1013360:1013410	attL	CGTTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_047373492.1|1014506_1015184_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
WP_011284838.1|1015457_1016792_-	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_003058873.1|1016908_1017136_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_011017397.1|1017132_1017405_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_111676423.1|1017416_1018049_-	hypothetical protein	NA	Q938J7	Temperate_phage	59.0	2.9e-43
WP_002983467.1|1018051_1018483_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_111676425.1|1018494_1020381_-	gp58-like family protein	NA	Q938J9	Temperate_phage	84.9	1.1e-210
WP_111676427.1|1020395_1021514_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	76.6	4.2e-146
WP_111676429.1|1021513_1023655_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	93.7	0.0e+00
WP_014411854.1|1023651_1024359_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.1	1.7e-92
WP_111676431.1|1024358_1028282_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.9	7.8e-240
WP_021299462.1|1028294_1028444_-	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_021733367.1|1028491_1028818_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	6.4e-39
WP_021341058.1|1028870_1029482_-|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	73.0	1.8e-74
WP_021341057.1|1029498_1029924_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.8	2.9e-68
WP_111676433.1|1029920_1030298_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	74.4	1.3e-46
WP_029714354.1|1030294_1030642_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	84.5	2.1e-48
WP_111676435.1|1030638_1030941_-|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.8	3.3e-42
WP_111676437.1|1031085_1032270_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.1	4.4e-162
WP_109820930.1|1032294_1032960_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.1	2.1e-92
WP_111676439.1|1032937_1034158_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	9.0e-187
WP_111676441.1|1034339_1034612_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	95.4	8.5e-37
WP_168388874.1|1034604_1034775_-	hypothetical protein	NA	J7KK43	Streptococcus_phage	56.2	3.9e-08
WP_111676941.1|1034771_1036526_-|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	98.3	0.0e+00
WP_111676442.1|1036529_1036760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111676444.1|1036762_1037230_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	96.1	1.6e-80
WP_063632710.1|1037400_1037739_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	97.2	2.4e-57
WP_002987622.1|1037988_1038426_-	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.0e-76
WP_002987471.1|1038697_1039333_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	67.9	5.5e-87
WP_002987468.1|1039332_1039734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023611433.1|1039924_1040407_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	82.5	9.3e-79
WP_111676446.1|1040409_1040682_-	hypothetical protein	NA	A7J287	Streptococcus_phage	61.1	2.1e-19
WP_010922069.1|1040684_1040906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111676449.1|1040902_1041298_-	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	65.6	7.2e-45
WP_010922067.1|1041290_1041509_-	hypothetical protein	NA	A0A1S5SEA6	Streptococcus_phage	64.3	1.3e-16
WP_111676451.1|1041786_1044060_-	AAA family ATPase	NA	Q5YA88	Bacillus_phage	64.2	1.5e-280
WP_010922065.1|1044049_1044679_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	43.1	9.1e-42
WP_111676453.1|1044688_1046272_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	77.4	1.7e-233
WP_010922063.1|1046271_1046907_-	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	46.7	4.3e-31
WP_111676455.1|1046928_1047663_-	hypothetical protein	NA	Q0R597	Streptococcus_phage	60.9	6.6e-76
WP_010922061.1|1047664_1048087_-	hypothetical protein	NA	M1I9V9	Streptococcus_phage	59.9	4.2e-35
WP_010922060.1|1048126_1049218_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	52.0	1.0e-96
WP_063632644.1|1049232_1050552_-	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	63.6	1.1e-150
WP_063632643.1|1050535_1050781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063632642.1|1050782_1051001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111676457.1|1050981_1051122_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	82.9	5.9e-10
WP_063632641.1|1051123_1051435_-	hypothetical protein	NA	A1EAC3	Streptococcus_phage	85.4	3.8e-49
WP_011889039.1|1051541_1051724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023610918.1|1051864_1052626_-	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	61.9	3.6e-85
WP_014411882.1|1052636_1052876_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	98.7	1.4e-35
WP_001008979.1|1052927_1053569_+	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_021733129.1|1053667_1053826_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	1.7e-21
WP_111676459.1|1054198_1054987_+	phage repressor protein	NA	A0A1S5SD15	Streptococcus_phage	63.0	2.0e-86
WP_011106738.1|1054996_1055302_+	membrane protein	NA	NA	NA	NA	NA
WP_002990094.1|1055425_1056565_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	3.4e-119
WP_111676461.1|1056658_1057699_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.9e-68
1056631:1056681	attR	CGTTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_002990099.1|1057942_1058536_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_011284728.1|1058535_1059405_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.6	2.4e-101
WP_111676463.1|1059462_1060569_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_111676465.1|1060608_1061397_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_111676467.1|1061386_1062073_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_014407519.1|1062144_1062801_-	endonuclease III	NA	NA	NA	NA	NA
WP_111676469.1|1062797_1063481_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	1.7e-09
WP_002990109.1|1063561_1064080_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_111676471.1|1064229_1066440_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	3.9e-71
WP_002984893.1|1066436_1067201_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009881223.1|1067200_1068130_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_111676473.1|1068144_1068780_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_032464325.1|1068772_1070011_-	GTPase HflX	NA	NA	NA	NA	NA
WP_111676475.1|1070083_1070983_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	1161593	1172196	1851237		Streptococcus_phage(57.14%)	9	NA	NA
WP_011054352.1|1161593_1162736_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
WP_011017641.1|1162970_1163411_+	membrane protein	NA	NA	NA	NA	NA
WP_111676511.1|1163440_1164709_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_111676513.1|1164796_1166149_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-29
WP_002985134.1|1166369_1166711_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_002990262.1|1166771_1167938_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1168031_1168718_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_111676515.1|1168714_1169878_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	2.6e-143
WP_109991880.1|1169985_1172196_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	8.5e-268
>prophage 5
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	1306736	1344812	1851237	capsid,portal,tail	Streptococcus_phage(55.32%)	55	NA	NA
WP_002985529.1|1306736_1308536_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	36.8	2.9e-109
WP_111676570.1|1308834_1310037_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	98.2	5.0e-238
WP_111676573.1|1310147_1310333_-	hypothetical protein	NA	Q938J5	Temperate_phage	96.7	1.1e-24
WP_023078532.1|1310329_1310626_-	hypothetical protein	NA	Q938J6	Temperate_phage	99.0	2.9e-46
WP_063629046.1|1310636_1311269_-	hypothetical protein	NA	Q938J7	Temperate_phage	48.1	2.9e-43
WP_111676575.1|1311271_1311700_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	87.9	8.3e-63
WP_111676577.1|1311708_1313649_-	gp58-like family protein	NA	Q938J9	Temperate_phage	59.2	1.2e-124
WP_111676579.1|1313658_1314774_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	67.5	6.0e-129
WP_168422323.1|1314773_1316741_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	38.1	3.4e-103
WP_111676584.1|1316722_1317418_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	31.3	6.2e-07
WP_111676586.1|1317414_1319778_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.6	1.3e-133
WP_111676588.1|1319777_1320149_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	60.8	2.4e-34
WP_111676590.1|1320163_1320427_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	54.7	1.1e-17
WP_011888768.1|1320437_1321016_-	hypothetical protein	NA	A0A1X9I5X2	Streptococcus_phage	62.9	2.9e-58
WP_000573598.1|1321027_1321363_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_111676592.1|1321363_1321600_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	1.1e-21
WP_011054681.1|1321592_1321931_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_021733479.1|1321890_1322313_-	phage protein Gp19/Gp15/Gp42	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
WP_010922460.1|1322322_1322523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063631463.1|1322522_1323434_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	4.9e-113
WP_032461147.1|1323458_1323920_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	52.6	2.2e-37
WP_063631462.1|1323990_1325406_-	hypothetical protein	NA	A0A0B5A091	Streptococcus_phage	74.6	9.1e-215
WP_011888764.1|1325487_1325724_-	hypothetical protein	NA	M1IRA5	Streptococcus_phage	80.3	1.2e-31
WP_002986828.1|1325725_1325992_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_032461150.1|1325984_1326164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994100.1|1326213_1326438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017978.1|1326443_1327937_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.6	3.7e-89
WP_011017979.1|1327929_1329198_-|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.2	2.4e-190
WP_002994106.1|1329194_1329551_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_063629033.1|1329699_1330044_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	4.2e-41
WP_010922470.1|1330150_1330570_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	8.7e-57
WP_046159671.1|1330644_1330896_-	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	2.1e-18
WP_111676594.1|1330892_1331618_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	44.8	2.4e-25
WP_111676596.1|1331614_1331908_-	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	96.9	1.8e-48
WP_172450060.1|1331955_1332720_-	site-specific DNA-methyltransferase	NA	Q9MCL7	Streptococcus_virus	89.0	3.7e-130
WP_109991512.1|1332709_1333192_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	91.2	1.3e-85
WP_063631460.1|1333195_1333465_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.0	4.3e-25
WP_032463367.1|1333641_1334154_-	phage protein	NA	Q708P9	Streptococcus_phage	78.0	5.6e-66
WP_011888757.1|1334150_1334492_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	3.1e-12
WP_011888756.1|1334688_1335717_-	DUF1351 domain-containing protein	NA	E8ZD61	Streptococcus_phage	65.9	9.5e-121
WP_111676599.1|1335726_1336518_-	phage recombination protein Bet	NA	A0A1S5SFP4	Streptococcus_phage	81.6	8.9e-119
WP_063629030.1|1336520_1336850_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	85.3	6.4e-47
WP_011017565.1|1336905_1337112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017992.1|1337120_1337261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988350.1|1337257_1337491_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	1.8e-35
WP_011017564.1|1337471_1337858_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_111676603.1|1338360_1338546_-	hypothetical protein	NA	Q938N3	Temperate_phage	93.4	2.8e-23
WP_111676605.1|1338778_1338961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922479.1|1339129_1339342_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_111676607.1|1339543_1340299_+	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	61.2	3.3e-78
WP_111676609.1|1340310_1340829_+	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	2.1e-31
WP_111676611.1|1340960_1342418_+	recombinase family protein	NA	Q38184	Lactococcus_phage	50.7	1.5e-132
WP_002990551.1|1342768_1343152_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_020833361.1|1343135_1343639_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002985536.1|1343963_1344812_+	glycoside hydrolase family 25 protein	NA	A0A223LJI5	Bacillus_phage	31.3	1.9e-18
>prophage 6
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	1406165	1442252	1851237	tRNA,transposase,bacteriocin	Bacillus_phage(30.0%)	36	NA	NA
WP_111676646.1|1406165_1408109_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.7	3.1e-120
WP_002994187.1|1408530_1409865_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985678.1|1409866_1410865_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002985680.1|1410995_1411997_-	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.5	6.1e-24
WP_031488434.1|1412170_1413256_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002985684.1|1413304_1413970_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002985686.1|1413980_1414358_+	VOC family protein	NA	NA	NA	NA	NA
WP_011017477.1|1414502_1415429_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.5	2.0e-77
WP_012560521.1|1415639_1416323_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_111676648.1|1416322_1417249_+	DUF979 family protein	NA	NA	NA	NA	NA
WP_002994169.1|1417298_1417946_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_111676650.1|1418063_1418783_-	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_002994152.1|1418788_1419256_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.0	5.7e-41
WP_111676652.1|1419258_1421592_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.4	2.6e-89
WP_002985700.1|1421685_1421922_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002990729.1|1421967_1422114_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_111676654.1|1422110_1423304_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_111676656.1|1423425_1424928_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.3	1.1e-74
WP_063629109.1|1425117_1425711_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002990742.1|1425707_1426535_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.5	5.1e-16
WP_002990747.1|1426706_1427573_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128650799.1|1427661_1427730_+	peptide pheromone SHP2	NA	NA	NA	NA	NA
WP_020833327.1|1428643_1428913_+	quorum-sensing system protein StcA	NA	NA	NA	NA	NA
WP_168690190.1|1429260_1429659_-	histidine kinase	NA	NA	NA	NA	NA
WP_047235194.1|1431072_1431474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111676660.1|1431667_1431949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990768.1|1431998_1432193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003060803.1|1432486_1432687_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_042361549.1|1432699_1432927_-|bacteriocin	bacteriocin BlpM	bacteriocin	NA	NA	NA	NA
WP_111676662.1|1433213_1435367_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.1	2.8e-42
WP_111676664.1|1435377_1436742_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_011017462.1|1436818_1436944_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_080147975.1|1437091_1438426_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_030126108.1|1438426_1439176_-	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	27.5	3.1e-20
WP_111676666.1|1441113_1442022_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.3	8.5e-49
WP_110407836.1|1441970_1442252_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	1496296	1502337	1851237		Streptococcus_phage(100.0%)	8	NA	NA
WP_111676702.1|1496296_1497124_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
WP_014407341.1|1497197_1497554_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_009880724.1|1497859_1498489_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023609786.1|1498535_1498928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111676704.1|1498954_1499818_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	8.5e-115
WP_002985838.1|1499822_1500146_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_010921931.1|1500808_1501684_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_014635306.1|1501701_1502337_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.0e-65
>prophage 8
NZ_LS483334	Streptococcus pyogenes strain NCTC12050 chromosome 1	1851237	1817044	1843528	1851237	tRNA,integrase	Streptococcus_phage(90.48%)	27	1809003:1809017	1831555:1831569
1809003:1809017	attL	AATAAAAAGAAAGAA	NA	NA	NA	NA
WP_111674761.1|1817044_1817458_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	70.7	1.3e-20
WP_111676909.1|1817459_1818566_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_002992310.1|1818622_1819486_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001291561.1|1819811_1821029_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|1821110_1821314_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_000857133.1|1821774_1822005_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|1822001_1822424_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001227347.1|1822928_1823282_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000336323.1|1823341_1823509_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_000691736.1|1823627_1825547_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_001814923.1|1825562_1825679_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224318.1|1825923_1826856_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.4	3.1e-171
WP_000769868.1|1826852_1827854_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_000804748.1|1827850_1830028_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000331160.1|1830030_1832478_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
1831555:1831569	attR	TTCTTTCTTTTTATT	NA	NA	NA	NA
WP_000506270.1|1832461_1832968_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|1832942_1833440_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|1833556_1833778_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|1833820_1835026_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_031764745.1|1835048_1835201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813488.1|1835203_1836589_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|1836617_1837004_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|1837019_1837334_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_111676911.1|1837727_1839209_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.7	2.6e-95
WP_002991455.1|1839516_1840539_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002982011.1|1840957_1841830_+	YitT family protein	NA	NA	NA	NA	NA
WP_002981986.1|1841908_1843528_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.3	1.2e-45
