The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	38503	48916	2079953		Microbacterium_phage(16.67%)	7	NA	NA
WP_022554079.1|38503_42229_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.7	9.9e-35
WP_022554080.1|42347_43799_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	4.2e-58
WP_003062570.1|43951_44980_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	3.7e-64
WP_012766414.1|44972_45527_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.1	2.2e-23
WP_015057184.1|45633_46146_+	VanZ family protein	NA	NA	NA	NA	NA
WP_022554084.1|46164_47709_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.4	3.7e-76
WP_003055557.1|47788_48916_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	9.1e-08
>prophage 2
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	242213	292092	2079953	tRNA,integrase,transposase	Streptococcus_phage(26.67%)	53	285961:285977	289089:289105
WP_046165987.1|242213_243557_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.5	3.8e-53
WP_003061211.1|243549_243951_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_111711546.1|244067_244394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046165986.1|244393_245098_+	FUSC family protein	NA	NA	NA	NA	NA
WP_014611994.1|245508_246294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003059560.1|246341_247088_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003049554.1|247091_247610_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003059562.1|247708_248569_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.8	2.2e-09
WP_012766535.1|248703_249402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003049560.1|249398_249605_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	56.1	2.3e-10
WP_111711711.1|249742_250711_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.1	8.0e-37
WP_002982710.1|251000_251447_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002982716.1|251467_251860_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_017285260.1|251992_253147_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.0	9.8e-50
WP_017285259.1|253198_253717_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000005472.1|253864_254146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017285258.1|254154_254994_+	phage replisome organizer N-terminal domain-containing protein	NA	Q7Y4K5	Streptococcus_phage	57.1	1.8e-48
WP_017285257.1|254986_255346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001220782.1|255353_255686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469564.1|255666_255861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017284979.1|256376_256826_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_111711547.1|256845_259068_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.2	4.5e-59
WP_170960988.1|259762_260389_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_017285454.1|260400_260739_+	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	34.3	3.4e-11
WP_003053795.1|261244_262462_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014612278.1|262765_263995_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.3	3.6e-34
WP_003053786.1|264102_264327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022554211.1|264323_266228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022554212.1|266239_268744_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003053802.1|268788_269199_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_003053785.1|269201_269426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022554213.1|269429_270440_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_003053793.1|271014_271245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022554216.1|271264_272491_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_022554217.1|272546_272801_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003053797.1|272793_273060_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003056467.1|275027_275489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003056470.1|275507_275804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111711548.1|276620_276962_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	51.5	8.5e-10
WP_014612001.1|277165_277471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003053656.1|277505_277865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046166169.1|278025_278886_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003053651.1|278894_279578_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAF1	Streptococcus_phage	49.2	2.6e-58
WP_014612002.1|279839_279944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022554225.1|282918_284196_+	lanthionine synthetase C family protein	NA	A0A2H4PQH9	Staphylococcus_phage	24.8	6.4e-18
WP_046159778.1|284225_285491_+	MFS transporter	NA	NA	NA	NA	NA
WP_100206393.1|285528_286236_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
285961:285977	attL	CTTGAAAATAATATTGT	NA	NA	NA	NA
WP_065354888.1|286591_287746_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	33.2	1.6e-44
WP_022554230.1|287799_288318_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044565573.1|288668_289367_+	ATP-dependent DNA helicase	NA	A0A1B3AYT3	Gordonia_phage	36.3	2.3e-30
289089:289105	attR	CTTGAAAATAATATTGT	NA	NA	NA	NA
WP_022554232.1|289620_289785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022554233.1|290163_290979_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_172449177.1|291069_292092_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.7	3.1e-39
>prophage 3
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	376502	386067	2079953		Streptococcus_phage(81.82%)	14	NA	NA
WP_022554291.1|376502_377267_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	7.2e-17
WP_171841621.1|377272_377977_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.4	3.0e-17
WP_003059946.1|378021_378684_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	57.4	1.2e-60
WP_012766617.1|378770_379406_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.3	1.8e-69
WP_012766618.1|379421_380294_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	41.4	7.7e-55
WP_003058683.1|380290_381091_+	signal peptidase II	NA	NA	NA	NA	NA
WP_003058686.1|381083_381407_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	64.2	7.0e-30
WP_003058668.1|381412_382276_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	76.0	3.5e-116
WP_003062448.1|382302_382695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111711556.1|382741_383371_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_022554295.1|383487_384579_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	62.8	1.2e-129
WP_111711557.1|384604_385156_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	53.0	6.8e-49
WP_003058665.1|385216_385714_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	52.9	1.4e-40
WP_022554296.1|385710_386067_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	6.3e-40
>prophage 4
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	401939	493384	2079953	portal,protease,terminase,capsid,tail,bacteriocin,tRNA,integrase	Temperate_phage(37.1%)	113	387458:387474	428533:428549
387458:387474	attL	TAACCACTGAAATAGTT	NA	NA	NA	NA
WP_022554308.1|401939_403937_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.7	7.8e-87
WP_003055629.1|404469_405483_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.4	2.9e-98
WP_003055616.1|405486_405960_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	F8WQ19	Bacillus_phage	37.8	3.7e-11
WP_022554309.1|405943_408130_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.0	2.4e-166
WP_003055639.1|408427_409762_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_041788838.1|410156_410510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022554314.1|410858_411095_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_003054338.1|411087_411786_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_003049859.1|411782_412025_+	DUF3977 family protein	NA	NA	NA	NA	NA
WP_012766632.1|412042_412492_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003054341.1|412493_413453_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_111711559.1|413786_415124_+	MFS transporter	NA	NA	NA	NA	NA
WP_003061627.1|415295_416678_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	35.6	1.6e-30
WP_003059987.1|416708_417263_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003054365.1|417263_417515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003054376.1|417532_418228_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_003059888.1|418300_418948_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003054333.1|419093_420026_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003054363.1|420090_420816_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.8	8.1e-18
WP_003054335.1|420816_421665_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012766633.1|421795_422602_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	37.8	2.1e-22
WP_111711560.1|422953_424120_-|integrase	tyrosine-type recombinase/integrase	integrase	C5J953	Streptococcus_phage	41.9	4.6e-79
WP_111711561.1|424426_425236_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	35.8	5.0e-24
WP_111711562.1|425248_426016_-	helix-turn-helix domain-containing protein	NA	A0A1X9I5R4	Streptococcus_phage	60.6	1.0e-79
WP_023078399.1|426399_426537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023078407.1|426516_426897_-	DUF2513 domain-containing protein	NA	A0A1S5SCT1	Streptococcus_phage	56.7	1.9e-34
WP_111711563.1|426955_427114_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	94.2	1.5e-22
WP_030127422.1|427144_427744_-	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	99.5	9.1e-108
WP_001157159.1|427796_428003_+	helix-turn-helix domain-containing protein	NA	A0A1X9I5S3	Streptococcus_phage	64.7	1.1e-17
WP_111711564.1|428042_428759_+	phage antirepressor KilAC domain-containing protein	NA	U6E9A9	Streptococcus_phage	87.7	2.0e-117
428533:428549	attR	AACTATTTCAGTGGTTA	NA	NA	NA	NA
WP_080937585.1|428768_428990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153276795.1|428986_429145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111711713.1|429245_429497_+	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	96.4	6.8e-41
WP_021340647.1|429527_429668_+	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	93.3	1.5e-16
WP_111711565.1|429677_429887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012560974.1|430010_430190_+	hypothetical protein	NA	A0A1X9I5M8	Streptococcus_phage	65.5	1.2e-12
WP_111711566.1|430361_430805_+	hypothetical protein	NA	G4KNN0	Staphylococcus_phage	32.0	7.7e-11
WP_111711567.1|430920_431745_+	DnaD domain protein	NA	L0P704	Lactobacillus_phage	58.8	1.4e-34
WP_111711568.1|431725_431959_+	hypothetical protein	NA	Q938N1	Temperate_phage	72.7	4.1e-24
WP_011284979.1|431955_432096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046176837.1|432104_432311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046176835.1|432472_432955_+	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	73.1	2.7e-54
WP_111711569.1|432955_433630_+	ERF family protein	NA	A0A097PBE8	Streptococcus_pyogenes_phage	90.6	1.4e-109
WP_111711570.1|433622_434015_+	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	76.3	3.9e-51
WP_022554788.1|434029_434308_+	hypothetical protein	NA	A3F625	Streptococcus_phage	96.7	1.6e-43
WP_111711571.1|434322_434508_+	hypothetical protein	NA	A3F626	Streptococcus_phage	94.7	1.7e-12
WP_003059068.1|434504_434774_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	94.4	6.4e-45
WP_111711572.1|434783_435068_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	90.4	2.1e-38
WP_111711573.1|435068_435974_+	N-6 DNA methylase	NA	A0A0M3LQ47	Mannheimia_phage	58.8	1.6e-76
WP_111711574.1|435970_436642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111711575.1|436642_437368_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111711576.1|437613_438054_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	97.9	5.5e-78
WP_111711577.1|438559_439036_+|terminase	terminase	terminase	A0A1S5SA53	Streptococcus_phage	73.1	9.0e-58
WP_076636817.1|439074_440325_+|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	94.4	4.7e-215
WP_111711578.1|440338_441841_+|portal	phage portal protein	portal	Q938L2	Temperate_phage	95.6	1.6e-270
WP_111711579.1|441845_443342_+|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	77.0	6.2e-206
WP_111679809.1|443338_443566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111711580.1|444043_444658_+	hypothetical protein	NA	Q938K8	Temperate_phage	97.0	1.1e-95
WP_111679812.1|444661_445480_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	96.0	1.5e-140
WP_111679813.1|445533_445950_+	hypothetical protein	NA	Q938K7	Temperate_phage	89.2	1.1e-51
WP_111679814.1|445939_446272_+|capsid	minor capsid protein	capsid	Q79S86	Temperate_phage	94.5	2.6e-56
WP_111679815.1|446271_446628_+|capsid	capsid protein	capsid	Q79S88	Temperate_phage	96.6	6.5e-61
WP_111679816.1|446624_447023_+|capsid	capsid protein	capsid	Q79S87	Temperate_phage	96.2	3.0e-67
WP_111711581.1|447022_447508_+|tail	phage tail protein	tail	Q938K6	Temperate_phage	76.2	6.8e-61
WP_111711582.1|447553_447988_+	hypothetical protein	NA	Q938K5	Temperate_phage	75.0	2.5e-51
WP_111679819.1|447996_448578_+	hypothetical protein	NA	Q938K4	Temperate_phage	72.0	5.6e-78
WP_111711583.1|448567_451828_+	tape measure protein	NA	Q938K3	Temperate_phage	97.8	0.0e+00
WP_111711584.1|451824_452541_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	94.1	1.1e-131
WP_111711585.1|452537_454685_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	92.1	0.0e+00
WP_065354790.1|454681_455737_+	hyaluronoglucosaminidase	NA	A3F657	Streptococcus_phage	82.1	2.6e-129
WP_111711586.1|455736_456378_+	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	71.9	3.2e-82
WP_065354792.1|456388_458299_+	gp58-like family protein	NA	A7J2A9	Streptococcus_phage	66.0	2.8e-102
WP_003055326.1|458311_458743_+	DUF1617 family protein	NA	A3F661	Streptococcus_phage	97.1	1.3e-68
WP_065354793.1|458745_459354_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	86.6	7.2e-76
WP_023077839.1|459364_459664_+	hypothetical protein	NA	Q938J6	Temperate_phage	92.7	2.1e-41
WP_011184796.1|459660_459846_+	hypothetical protein	NA	Q938J5	Temperate_phage	98.4	6.6e-25
WP_111711587.1|459956_461153_+	streptodornase Sda1	NA	Q938J4	Temperate_phage	82.2	1.5e-194
WP_032465096.1|461342_461885_+	SocA family protein	NA	Q938J3	Temperate_phage	51.1	2.2e-44
WP_111711588.1|461888_462725_+	hypothetical protein	NA	Q938J2	Temperate_phage	51.3	3.6e-62
WP_111711589.1|462785_463775_-	DNA/RNA non-specific endonuclease	NA	A7J2B8	Streptococcus_phage	99.3	5.3e-169
WP_111711590.1|464007_464190_+	Paratox	NA	A3F673	Streptococcus_phage	78.3	3.1e-19
WP_044565581.1|464276_466685_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	50.9	1.2e-86
WP_002990803.1|466754_467108_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_003049875.1|467350_467776_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003049876.1|467881_468571_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_111711591.1|468845_469196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003049878.1|469463_470192_+	UMP kinase	NA	NA	NA	NA	NA
WP_003054381.1|470220_470778_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_044565584.1|470886_471744_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003054395.1|471816_472326_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003054340.1|472322_472538_+	YozE family protein	NA	NA	NA	NA	NA
WP_022554322.1|472697_473918_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	38.7	2.9e-15
WP_046166056.1|474228_476001_+	oleate hydratase	NA	NA	NA	NA	NA
WP_003054347.1|476161_477223_+	PhoH family protein	NA	W8D063	Erwinia_phage	48.6	3.2e-47
WP_015057373.1|477269_477845_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_022554325.1|478003_478501_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003054389.1|478481_478889_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_022554327.1|479009_479906_+	GTPase Era	NA	NA	NA	NA	NA
WP_022554331.1|481841_482078_-|bacteriocin	bacteriocin processing peptidase	bacteriocin	NA	NA	NA	NA
WP_022554332.1|482379_482607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002994587.1|482655_482973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003054359.1|483380_483620_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003054392.1|483633_483819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992578.1|484501_485251_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014635339.1|485251_486586_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011017462.1|486732_486858_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_046166193.1|486934_488299_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_081308277.1|488309_489470_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.3	8.4e-33
WP_002992018.1|490748_490976_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003060803.1|490988_491189_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_022554340.1|491483_491678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012766654.1|492203_492614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080147981.1|493081_493384_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	761934	822151	2079953	tRNA,protease,transposase	Streptococcus_phage(16.67%)	55	NA	NA
WP_022554244.1|761934_763068_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_022554486.1|763232_764375_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_111711613.1|764376_765591_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_046159370.1|765731_766925_+	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	31.2	9.9e-37
WP_014611920.1|767044_768067_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	4.8e-40
WP_111711614.1|768086_769097_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	31.6	3.9e-34
WP_002985116.1|769401_769716_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003053756.1|769727_770054_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002985110.1|770081_770375_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_022554489.1|771709_772624_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.9	2.1e-07
WP_003056252.1|772620_773079_+	signal peptidase II	NA	NA	NA	NA	NA
WP_046166058.1|773068_773962_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003056327.1|774088_774703_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	37.2	2.9e-24
WP_003050221.1|774981_775503_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003056248.1|775518_776778_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.9	9.3e-62
WP_022554492.1|776838_777771_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	31.2	2.7e-26
WP_003056272.1|777805_778897_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.4	2.6e-60
WP_003056346.1|779148_782325_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_065355119.1|782546_783809_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003056319.1|783808_784519_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	7.6e-37
WP_003056250.1|784530_785751_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003062097.1|785743_786361_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	51.5	5.1e-45
WP_046166059.1|786435_788178_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_003056242.1|788304_788577_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003050244.1|788586_788826_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_022554498.1|789091_790549_+	cell wall surface anchor family protein	NA	NA	NA	NA	NA
WP_022554499.1|790924_791443_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003056334.1|791432_792164_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_022554500.1|792163_793156_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.9	3.7e-29
WP_022554501.1|793344_794403_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_022554502.1|794415_795339_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_111711715.1|795573_796287_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003056325.1|796283_797195_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_022554504.1|797191_799138_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003059798.1|799229_799829_+	glycoside hydrolase family 73 protein	NA	Q332B8	Clostridium_botulinum_C_phage	32.9	2.3e-10
WP_014612206.1|799988_800696_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	41.1	5.5e-11
WP_003061502.1|800746_801268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003056276.1|801339_801720_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_003056308.1|801719_802568_+	DegV family protein	NA	NA	NA	NA	NA
WP_012766833.1|802687_803896_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.0	9.0e-38
WP_022554508.1|803892_805770_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.9e-63
WP_012766835.1|805877_807623_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.3	6.9e-39
WP_003061906.1|807622_809395_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.6e-51
WP_111711615.1|809584_810934_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_022554510.1|811058_811469_+	peptide deformylase	NA	NA	NA	NA	NA
WP_015057505.1|811656_813681_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_002984988.1|813899_814550_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002984985.1|814552_815221_+	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	23.0	5.6e-05
WP_010922165.1|815229_816462_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_065354866.1|816755_817634_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_022554513.1|817615_818560_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_022554514.1|818552_819566_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003056340.1|819552_820545_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_022554517.1|821289_821493_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_111711616.1|821530_822151_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	828359	858323	2079953	integrase,protease,transposase	Bacillus_phage(22.22%)	29	847194:847209	862046:862061
WP_111711618.1|828359_829379_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	3.9e-34
WP_111711619.1|829889_830994_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.6	2.2e-70
WP_065354824.1|831745_833023_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_022554538.1|833003_834185_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003054196.1|834402_835242_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.2	9.2e-82
WP_003054187.1|835322_835820_+	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	28.2	8.3e-14
WP_003054200.1|835839_836010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022554539.1|836123_837353_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.5	2.1e-138
WP_003061604.1|837362_837962_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_022554540.1|838105_838849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015057518.1|838905_841005_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.8	1.6e-119
WP_003050354.1|842407_842908_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003043797.1|842972_843338_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_111711620.1|843715_844842_-|transposase	IS3 family transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.0	7.4e-10
WP_001032085.1|845347_846103_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000215991.1|846329_846755_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_000686148.1|846787_847303_+	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
847194:847209	attL	CGTTGATTCAAAAAAT	NA	NA	NA	NA
WP_003061771.1|847313_848246_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_022554543.1|848248_849229_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_022554544.1|849464_850298_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_001078262.1|850334_850652_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_022554545.1|850651_852337_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003060941.1|852433_853840_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003061839.1|853864_854143_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_003061760.1|854165_855053_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_022554547.1|855241_855466_+	helix-turn-helix transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	42.6	1.4e-05
WP_022554548.1|855735_855984_+	DUF3173 family protein	NA	NA	NA	NA	NA
WP_037590019.1|855979_857191_+|integrase	site-specific integrase	integrase	U3PJ31	Staphylococcus_phage	22.0	4.4e-08
WP_015016706.1|857459_858323_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
862046:862061	attR	CGTTGATTCAAAAAAT	NA	NA	NA	NA
>prophage 7
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	1867532	1921447	2079953	tRNA,protease,transposase,holin	Bacillus_phage(22.22%)	51	NA	NA
WP_003053389.1|1867532_1868207_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_022555174.1|1868203_1868731_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_111711692.1|1869271_1870870_-	fibronectin binding protein	NA	NA	NA	NA	NA
WP_111711721.1|1871199_1872174_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.3	1.2e-37
WP_046166201.1|1872499_1874005_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003058267.1|1874118_1875243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003058263.1|1875278_1875776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111711693.1|1876002_1876992_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.6	3.8e-34
WP_003058262.1|1877123_1878473_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_022555182.1|1878712_1879294_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_012767582.1|1879408_1880029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046166190.1|1880113_1880818_-	exotoxin	NA	NA	NA	NA	NA
WP_022555184.1|1881231_1884840_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_003055452.1|1884963_1885242_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_022555186.1|1885265_1885541_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_014612600.1|1885564_1885840_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_003055447.1|1885853_1886549_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_003055472.1|1886558_1888217_-	acetaldehyde dehydrogenase (acetylating)	NA	A0A1X9I5D4	Streptococcus_phage	27.7	6.2e-05
WP_022555187.1|1888240_1888846_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003055458.1|1888861_1889494_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003055449.1|1889509_1889806_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_003055455.1|1889817_1890660_-	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
WP_014612602.1|1890646_1891279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022555188.1|1891362_1892493_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014612603.1|1892489_1892936_-	EutP/PduV family GTP-binding protein	NA	NA	NA	NA	NA
WP_003055479.1|1892932_1893280_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_046166074.1|1893292_1894282_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_111711694.1|1894343_1896890_-|holin	choline trimethylamine-lyase	holin	Q70BG9	Salmonella_phage	38.7	6.6e-06
WP_022555192.1|1896950_1898306_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003053467.1|1898321_1898630_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003053490.1|1898641_1898941_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_003053465.1|1898955_1899240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003053492.1|1899243_1900251_-	DMT family transporter	NA	NA	NA	NA	NA
WP_022555193.1|1900284_1900572_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_044565536.1|1901083_1901959_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022555195.1|1903192_1903444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111711695.1|1903498_1904719_+	S-layer protein	NA	NA	NA	NA	NA
WP_022555197.1|1904820_1905348_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_022555198.1|1905347_1906127_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003062556.1|1906266_1906806_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_044565538.1|1906809_1907121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022555199.1|1907325_1908468_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	2.2e-86
WP_003061926.1|1908687_1909554_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_022555200.1|1909674_1910142_-	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_003055717.1|1910208_1910649_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_046166078.1|1910855_1913498_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	34.7	7.0e-51
WP_015017457.1|1913644_1915372_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_111711696.1|1915389_1916586_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.7	1.5e-29
WP_003055714.1|1917016_1917928_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.7	1.8e-14
WP_003052974.1|1918140_1919232_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_111678988.1|1920099_1921447_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.6	1.9e-60
>prophage 8
NZ_LS483318	Streptococcus dysgalactiae subsp. equisimilis strain NCTC5370 chromosome 1	2079953	2032959	2042055	2079953	integrase	Streptococcus_phage(75.0%)	13	2030513:2030535	2042106:2042128
2030513:2030535	attL	AAAAAGCCCACTGTTGTAGGCTT	NA	NA	NA	NA
WP_003057164.1|2032959_2033490_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	55.9	2.5e-48
WP_000694575.1|2033510_2033684_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	78.9	1.8e-16
WP_003058303.1|2034019_2035522_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	37.2	2.0e-63
WP_003058307.1|2035541_2036411_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	75.4	1.8e-125
WP_047207332.1|2036545_2036827_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	65.9	3.2e-23
WP_003045763.1|2036829_2037159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011889227.1|2037170_2037362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111711707.1|2037361_2037694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016481383.1|2037964_2038153_-	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	42.6	1.2e-05
WP_111688375.1|2038342_2038963_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003055091.1|2039337_2040342_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	30.4	2.7e-11
WP_003055128.1|2040341_2040794_+	Fic family protein	NA	NA	NA	NA	NA
WP_172449188.1|2040882_2042055_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	74.7	9.3e-165
2042106:2042128	attR	AAAAAGCCCACTGTTGTAGGCTT	NA	NA	NA	NA
