The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483315	Streptococcus pyogenes strain NCTC12059 chromosome 1	1808384	36316	48629	1808384		Synechococcus_phage(28.57%)	8	NA	NA
WP_111704475.1|36316_40042_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.7	7.3e-38
WP_023611320.1|40202_41657_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	1.7e-54
WP_002987707.1|41684_42707_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	4.0e-63
WP_002987709.1|42874_43429_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_111704476.1|43612_45160_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_002987712.1|45216_46341_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_021775344.1|46593_47859_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_111704477.1|48137_48629_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	1.1e-18
>prophage 2
NZ_LS483315	Streptococcus pyogenes strain NCTC12059 chromosome 1	1808384	627839	667855	1808384	integrase,terminase,tail,holin,capsid,portal	Streptococcus_phage(70.0%)	58	630448:630467	665622:665641
WP_002983913.1|627839_628691_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_021340995.1|628683_629526_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_111704584.1|629503_630091_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|630189_630465_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
630448:630467	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_003051793.1|630553_631696_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_010922481.1|631819_632338_-	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
WP_010922480.1|632349_633105_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922479.1|633306_633519_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922478.1|633788_634100_+	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922477.1|634101_634287_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
WP_011017564.1|634790_635177_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_010922205.1|635157_635391_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
WP_002988354.1|635387_635528_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988357.1|635536_635743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528796.1|635798_636128_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	84.4	7.1e-46
WP_011054700.1|636130_637057_+	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_000594115.1|637053_637254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111704585.1|637246_638044_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	83.4	3.9e-130
WP_011054698.1|638408_638804_+	hypothetical protein	NA	A8ATL9	Listeria_phage	52.3	1.4e-19
WP_011054697.1|638800_640147_+	PcfJ domain-containing protein	NA	A8ATM0	Listeria_phage	49.4	1.0e-122
WP_011184741.1|640157_640490_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	67.0	8.8e-36
WP_011054695.1|640486_640999_+	hypothetical protein	NA	M1PFM2	Streptococcus_phage	85.9	1.7e-78
WP_011054694.1|641034_641352_+	DUF1372 family protein	NA	A1EAD7	Streptococcus_phage	71.4	9.0e-30
WP_011054693.1|641348_641504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054692.1|641500_641752_+	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	1.6e-18
WP_011528791.1|641827_642247_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	6.7e-57
WP_011054690.1|642354_642699_+	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	3.2e-41
WP_002994106.1|642846_643203_+	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_011017979.1|643199_644468_+|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.2	2.4e-190
WP_011017978.1|644460_645954_+	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.6	3.7e-89
WP_002994100.1|645959_646184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032461150.1|646233_646413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986828.1|646405_646672_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011888764.1|646673_646910_+	hypothetical protein	NA	M1IRA5	Streptococcus_phage	80.3	1.2e-31
WP_111704586.1|646991_648407_+|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	73.8	2.1e-211
WP_053308482.1|648487_648952_+	DUF4355 domain-containing protein	NA	A0A141E167	Streptococcus_phage	57.8	6.3e-40
WP_053308481.1|648955_649849_+|capsid	phage major capsid protein	capsid	A0A126GGI3	Streptococcus_phage	77.4	6.3e-129
WP_109828577.1|649999_650422_+	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.9	4.8e-47
WP_011054681.1|650381_650720_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_111704587.1|650712_650952_+	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	65.8	6.3e-20
WP_000573598.1|650952_651288_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_011054679.1|651303_651894_+	hypothetical protein	NA	M1PKG8	Streptococcus_phage	62.5	1.1e-60
WP_010922455.1|651904_652168_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
WP_011054678.1|652182_652554_+	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	62.4	1.7e-35
WP_111704588.1|652553_654917_+	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.1	1.1e-132
WP_111704589.1|654913_655609_+	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	32.2	4.7e-07
WP_168388764.1|655590_657564_+|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.6	2.0e-98
WP_111703211.1|657563_658673_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	67.8	1.3e-115
WP_111704590.1|658687_660469_+	hypothetical protein	NA	Q938J9	Temperate_phage	40.1	5.7e-65
WP_011528780.1|660477_660906_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	87.9	3.7e-63
WP_011528779.1|660908_661541_+	hypothetical protein	NA	Q938J7	Temperate_phage	50.5	4.0e-45
WP_011017397.1|661552_661825_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_003058873.1|661821_662049_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_014635574.1|662167_663385_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.1	1.1e-163
WP_002985327.1|663453_664161_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_111704591.1|664271_665030_-	DNase Mf2	NA	NA	NA	NA	NA
WP_014635572.1|665269_665452_+	hypothetical protein	NA	A3F673	Streptococcus_phage	80.0	1.7e-20
WP_111704592.1|665992_667855_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	5.4e-90
665622:665641	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
>prophage 3
NZ_LS483315	Streptococcus pyogenes strain NCTC12059 chromosome 1	1808384	702072	774165	1808384	protease,tRNA,transposase	Enterococcus_phage(21.43%)	60	NA	NA
WP_111704605.1|702072_704691_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	1.1e-61
WP_002989220.1|705051_705267_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002995753.1|705263_706025_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002989227.1|706043_706739_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_111704606.1|708125_709439_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002987365.1|709413_710373_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
WP_002989239.1|710705_712865_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.4	2.3e-262
WP_002989242.1|712884_713103_-	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
WP_002984031.1|713495_713759_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002984033.1|713763_715497_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_011284931.1|715681_717109_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_111704608.1|718588_719674_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.2e-33
WP_002984060.1|719771_720398_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_002989257.1|720477_720741_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002989260.1|720793_721603_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_009881127.1|721747_722245_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_111704609.1|722244_723930_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.6	6.7e-47
WP_111704485.1|724199_725333_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002992607.1|725474_725678_+	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
WP_002989286.1|725652_726594_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_111704610.1|726797_729176_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002989292.1|729711_730908_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
WP_002989295.1|731081_732341_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_111704611.1|732697_733603_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_110002905.1|733840_734383_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002989302.1|734391_735675_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002984100.1|735690_736551_+	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_014407653.1|736552_737518_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_172449841.1|737628_738912_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002989310.1|738904_739396_+	shikimate kinase	NA	NA	NA	NA	NA
WP_002984109.1|739603_741055_+	LCP family protein	NA	NA	NA	NA	NA
WP_038434139.1|741103_742495_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	99.4	1.5e-262
WP_002984115.1|743511_743913_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_111704614.1|744017_745502_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_002989519.1|745875_747096_+	MFS transporter	NA	NA	NA	NA	NA
WP_002984124.1|747215_747581_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_012560779.1|747694_748426_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_172449807.1|748474_749817_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.2	6.7e-66
WP_002984145.1|750058_750187_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_111688271.1|750243_751557_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_002984154.1|751625_751784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030125894.1|751788_752484_-	nicotinamide riboside transporter PnuC	NA	NA	NA	NA	NA
WP_111704615.1|754118_755213_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_111704616.1|755318_757313_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002984171.1|757335_757647_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002989549.1|757649_757985_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_014407638.1|757981_758431_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002989555.1|758608_759988_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002989558.1|759984_760137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111704617.1|760185_761691_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	91.3	4.7e-254
WP_002984187.1|761848_762589_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.5e-35
WP_002989566.1|762588_764763_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002989569.1|764955_766947_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002984200.1|767210_767354_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_111704618.1|767365_768904_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.2	5.0e-41
WP_002994626.1|768900_770157_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_002984216.1|770174_770414_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_111704619.1|770406_771657_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_002989577.1|771687_772671_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172449809.1|773184_774165_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.8	1.1e-38
>prophage 4
NZ_LS483315	Streptococcus pyogenes strain NCTC12059 chromosome 1	1808384	1028214	1070514	1808384	integrase,terminase,tail,capsid,portal,head	Streptococcus_phage(72.92%)	50	1027070:1027118	1067742:1067790
1027070:1027118	attL	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_047373492.1|1028214_1028892_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
WP_011284838.1|1029165_1030500_-	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_111704668.1|1030611_1030797_-	hypothetical protein	NA	Q938J5	Temperate_phage	93.4	9.5e-24
WP_002990012.1|1030793_1031090_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_111704669.1|1031099_1031717_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.3	2.7e-78
WP_011018112.1|1031719_1032148_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	78.6	1.9e-54
WP_111704670.1|1032159_1034049_-	gp58-like family protein	NA	Q938J9	Temperate_phage	75.1	2.6e-180
WP_111704671.1|1034058_1035081_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	85.2	5.8e-155
WP_111704672.1|1037919_1042302_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	75.9	4.6e-225
WP_011888930.1|1042316_1042550_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	98.7	1.3e-33
WP_011888931.1|1042624_1043080_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	99.3	5.3e-76
WP_011054869.1|1043133_1043733_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054870.1|1043744_1044104_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011106640.1|1044107_1044452_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054872.1|1044448_1044727_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011888932.1|1044737_1045094_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	99.2	7.9e-59
WP_002983429.1|1045105_1045993_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011888933.1|1046005_1046575_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	100.0	1.9e-83
WP_011888934.1|1046736_1047003_-	hypothetical protein	NA	Q938K9	Temperate_phage	96.6	2.9e-37
WP_011054876.1|1047007_1047196_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_032465703.1|1047223_1048672_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.8	1.2e-278
WP_038433243.1|1048631_1050164_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.8	4.5e-292
WP_111704673.1|1050179_1051457_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	99.8	1.8e-246
WP_011106637.1|1051446_1051899_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_011054881.1|1051988_1052405_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_011054882.1|1052537_1052810_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_164972002.1|1052802_1052973_-	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_038433239.1|1052973_1054296_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.7	5.1e-252
WP_111704674.1|1054292_1054568_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	8.6e-45
WP_111704675.1|1054953_1057338_-	DNA primase	NA	A7J282	Streptococcus_phage	94.4	5.3e-276
WP_111704676.1|1057342_1059265_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.9	0.0e+00
WP_086934854.1|1059307_1059871_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1059879_1061037_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_030127427.1|1061036_1061336_-	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	3.7e-41
WP_030127426.1|1061423_1061627_-	hypothetical protein	NA	A7J276	Streptococcus_phage	89.6	3.7e-29
WP_111704677.1|1061773_1062160_-	hypothetical protein	NA	A7J274	Streptococcus_phage	88.2	2.3e-56
WP_000049475.1|1062156_1062360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888947.1|1062352_1062523_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_023613185.1|1062524_1062836_-	hypothetical protein	NA	A1EAC3	Streptococcus_phage	85.3	1.4e-48
WP_063632639.1|1063252_1063963_-	phage antirepressor KilAC domain-containing protein	NA	M1Q1T4	Streptococcus_phage	78.2	1.5e-101
WP_063629025.1|1063974_1064166_-	hypothetical protein	NA	A7J270	Streptococcus_phage	88.9	2.2e-23
WP_063632638.1|1064186_1064546_-	hypothetical protein	NA	Q9AZZ9	Lactococcus_phage	50.0	2.2e-08
WP_063632637.1|1064873_1065224_+	helix-turn-helix transcriptional regulator	NA	M1I9X0	Streptococcus_phage	69.8	3.1e-39
WP_023079223.1|1065237_1065621_+	hypothetical protein	NA	A7J268	Streptococcus_phage	99.2	9.1e-69
WP_012767059.1|1065631_1066054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063632653.1|1066158_1066425_+	hypothetical protein	NA	M1PF81	Streptococcus_phage	87.1	1.2e-08
WP_011888953.1|1066545_1067685_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	1.2e-119
WP_111704678.1|1067767_1068808_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.6	4.2e-68
1067742:1067790	attR	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_002990099.1|1069051_1069645_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_010922195.1|1069644_1070514_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	3.2e-101
>prophage 5
NZ_LS483315	Streptococcus pyogenes strain NCTC12059 chromosome 1	1808384	1172525	1183128	1808384		Streptococcus_phage(57.14%)	9	NA	NA
WP_011184383.1|1172525_1173668_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
WP_111701983.1|1173902_1174343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990257.1|1174372_1175641_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_111704696.1|1175728_1177081_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	9.2e-31
WP_002990260.1|1177301_1177643_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_002990262.1|1177703_1178870_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1178963_1179650_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_111704697.1|1179646_1180810_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.9	1.0e-142
WP_111704698.1|1180917_1183128_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	5.0e-268
>prophage 6
NZ_LS483315	Streptococcus pyogenes strain NCTC12059 chromosome 1	1808384	1468134	1474176	1808384		Streptococcus_phage(100.0%)	8	NA	NA
WP_111704761.1|1468134_1468962_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.1	8.4e-128
WP_111704762.1|1469035_1469392_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	9.1e-39
WP_111704763.1|1469697_1470327_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1470373_1470766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985836.1|1470792_1471656_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985838.1|1471660_1471984_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_010921931.1|1472647_1473523_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_002990917.1|1473540_1474176_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
