The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	1070819	1084002	4705041		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1070819_1071581_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1071574_1072201_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1072340_1073480_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1073542_1074535_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1074628_1075993_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1076081_1076858_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1076862_1077501_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1077497_1078760_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_000847985.1|1078756_1079665_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1079860_1080628_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141320.1|1080678_1081335_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	6.6e-51
WP_001272928.1|1081440_1084002_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	1119083	1225885	4705041	tRNA,tail,lysis,terminase,plate,portal,transposase,head,integrase,capsid	Salmonella_phage(65.45%)	111	1157658:1157706	1187415:1187463
WP_000047184.1|1119083_1121714_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1121948_1122134_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273290.1|1123592_1124159_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|1124155_1124584_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1124656_1126213_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_073528328.1|1126362_1126878_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1126941_1128480_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1128496_1129669_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1129795_1130326_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119763.1|1130416_1130752_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445651.1|1130741_1131479_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_111732402.1|1131602_1132787_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216525.1|1132978_1133971_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774988.1|1134028_1135093_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|1135085_1136288_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|1136641_1137601_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246527.1|1137610_1139755_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080947.1|1139727_1140138_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1140134_1140380_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1140627_1140957_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1141108_1141453_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1141489_1141939_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1142607_1143012_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_073528330.1|1143058_1143583_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1143592_1143892_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1144074_1144233_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|1144316_1144766_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1144766_1145429_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_111732404.1|1145449_1146850_-	GABA permease	NA	NA	NA	NA	NA
WP_001087611.1|1147087_1148368_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_073528332.1|1148381_1149830_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271971.1|1149852_1151121_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001315804.1|1151139_1152117_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_071998707.1|1152453_1154355_-	alpha amylase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_073528333.1|1154373_1154706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|1155134_1156286_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
1157658:1157706	attL	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001547641.1|1157823_1158849_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.4e-193
WP_023352525.1|1158850_1159483_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	6.9e-106
WP_000063849.1|1159602_1159851_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
WP_023135813.1|1159883_1160393_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_000956182.1|1160400_1160601_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_071987435.1|1160564_1160906_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	92.0	6.9e-52
WP_001244212.1|1160973_1161207_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000752613.1|1161206_1161434_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_032176111.1|1161430_1162288_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	1.3e-160
WP_111732406.1|1162284_1164699_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154434.1|1164852_1165041_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1165051_1165285_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_021539285.1|1165670_1166711_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.4	4.5e-171
WP_001098431.1|1166710_1168477_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_111732408.1|1168619_1169453_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	2.2e-123
WP_000742511.1|1169469_1170528_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059204.1|1170531_1171182_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_016237793.1|1171277_1171742_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	2.4e-76
WP_000868175.1|1171741_1171945_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1171948_1172164_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_016237794.1|1172144_1172657_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	2.0e-87
WP_000727853.1|1172658_1173036_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_016237795.1|1173032_1173461_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	9.3e-46
WP_001039935.1|1173556_1173988_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_023352536.1|1173980_1174427_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_000993775.1|1174495_1175074_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177597.1|1175070_1175430_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_060615096.1|1175416_1176325_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	3.0e-142
WP_001086833.1|1176317_1176923_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_060615094.1|1178310_1178742_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.3	7.4e-19
WP_060615093.1|1178713_1179145_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	57.9	1.4e-38
WP_165843458.1|1179148_1179547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111732410.1|1179661_1180834_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	1.3e-203
WP_001207660.1|1180843_1181359_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281007.1|1181413_1181716_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
WP_000763311.1|1181730_1181850_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_111732412.1|1181842_1184920_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.6	0.0e+00
WP_000980394.1|1184916_1185402_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001011796.1|1185398_1186499_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980501.1|1186567_1186786_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_048231062.1|1186812_1187295_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.7	6.0e-17
WP_000162574.1|1187995_1188478_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1187415:1187463	attR	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600190.1|1188609_1189086_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1189075_1189366_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1189427_1189769_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1189917_1191579_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1191664_1192543_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1192665_1193259_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1193313_1194600_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1194620_1195412_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1195578_1196940_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1197188_1197437_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1197455_1198004_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1198034_1198802_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1198843_1199191_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589847.1|1199266_1199749_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|1199764_1200991_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1200980_1201499_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1201648_1202014_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168037.1|1202223_1203294_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|1203304_1204426_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1204468_1205629_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001700969.1|1205727_1205775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1205878_1206220_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197673.1|1206490_1207228_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|1207362_1208343_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040169.1|1208339_1209071_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1209200_1211774_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1217629_1218928_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_064735377.1|1218924_1219248_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1219293_1220649_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_073528338.1|1220762_1223423_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001300438.1|1223454_1224153_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1224221_1224641_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1224847_1225885_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	1325016	1336711	4705041		Escherichia_phage(57.14%)	8	NA	NA
WP_111732416.1|1325016_1328283_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	45.8	6.4e-264
WP_038988925.1|1328275_1329142_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_052246280.1|1329222_1331115_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	41.9	3.4e-124
WP_038988934.1|1331122_1334155_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	43.4	3.6e-216
WP_032083459.1|1334963_1335503_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	93.9	8.4e-44
WP_001295476.1|1335518_1336037_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|1336349_1336541_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|1336558_1336711_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 4
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	1738163	1747605	4705041		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1738163_1739090_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1739094_1739826_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1739806_1739914_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1739973_1740705_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1740926_1742612_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1742608_1743328_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1743374_1743845_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1743885_1744347_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1744471_1746472_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001373529.1|1746468_1747605_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 5
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	2303696	2376930	4705041	transposase,integrase	Acinetobacter_phage(20.0%)	56	2303629:2303688	2355346:2356609
2303629:2303688	attL	GATTGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGG	NA	NA	NA	NA
WP_085947771.1|2303696_2304858_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000248952.1|2306258_2307443_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779017.1|2307439_2308123_+	YecA family protein	NA	NA	NA	NA	NA
WP_001077330.1|2308175_2311460_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.0	8.1e-65
WP_001291050.1|2311456_2312212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_111732493.1|2312520_2313081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542728.1|2313177_2313510_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001140767.1|2313683_2314187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211440.1|2314179_2316717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169430.1|2316713_2318384_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_111732495.1|2318519_2319667_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	3.0e-147
WP_111732497.1|2319980_2321303_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|2321302_2321569_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_111732688.1|2321791_2323192_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	2.4e-106
WP_000113145.1|2327741_2329334_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154339.1|2329412_2330366_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194860.1|2330614_2332150_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
WP_000911184.1|2332143_2333172_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|2333171_2334164_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172488.1|2334175_2335198_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_111732500.1|2335224_2336100_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_111732502.1|2336123_2336414_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|2336470_2337229_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|2337232_2338147_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854633.1|2338353_2339805_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001191019.1|2341090_2341450_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|2341449_2342376_-	glutaminase B	NA	NA	NA	NA	NA
WP_073528457.1|2342439_2343828_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|2343928_2344810_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000210799.1|2346151_2347342_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|2347366_2348032_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|2348243_2348678_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2348697_2349081_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|2349112_2349331_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087214.1|2349361_2350261_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054207.1|2350455_2351643_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|2351769_2351865_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592802.1|2352083_2352974_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
WP_000671737.1|2353228_2353621_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_085947771.1|2354174_2355337_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_024223630.1|2356101_2357268_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
2355346:2356609	attR	CCTCTGACTGAGAGTTTACTCACTTAGCCGCGTGTCCACTATTGCTGGGTAAGATCAATCCTGCCAGACATCCGAAATGTACTTGAGGAACAGCATGGTAAGGATAAAGTCTTTGTAAGTATCAGCACTGATGGTACCACGGAACGTATCGCACGCGGCCCACAGGGCTTTGTTGATCGTGTCCTGACTGATTTTGTCGTTCATGAATCATCCTGGTATGAAGAAAACCATACGATGTGTTGTATTCATCGTAGAAAATTTGGTGCAGATAATACCTTAAGGTGCGTCTTCAGGCACGTCAAAGCCGCATCGTTCGAAGTGGATTTTTCCTGAGGGGAATAGGACTCTTTTTTCCCGTAATGTGGTGGACTGGTTGATGAAACAAACACTAACGCGCGGCTTGGTACTGGATTGACCTGCTCCCCGTGATATCAATACACCCTACCCCAGTGACGCTAAAACGCATTTTACAACCTTTTATTACATTGGGAATGGTCCAAGATTAAGCTGTCAGGAAATACTCATAAGAGGTGCATTTCCTGTTAGTTCATGAAGTACTCTTGAAGTGATTTCATCTTTCTATTAAAAATATCTTTCAAAGCAATGAAATATGTACCATATGGTTTATGAACTGAACTCTTACACAACATAAGAGCCATCCATTATCGCCGCGCGCTGCACCTTGTCAGCAACCTCAGGGGCAAAATGCCCCTGTTGCAACCATCATCTCACACTAATCGACGTTATGGCGGCAGATTACACAATCGCCTCACCTTCATACGCCTGACGATAGAGTTCGATAACCTGCTCTTTCGTCGCTTTTCGTGGATTCGTCAGTTGGCACACATCTTTCTTCGCATTTTCAGCCATCACAGCAAAGTCTTCCGGTTTAACGCCCAGGCTCTTGAGATCTTTCGGGATCCCGACTTGTTTACCCAAACGCTGGATAGCGCTAATCGCTTTGAGCGCCGCTTCATCTGTCGATAGACCCGCGACATTTTCCCCCATTGCTTCAGCGATATCCCTGAACCGATTTAAGTTGCCAATTAAATTAAATGATTCTACATACGGCAGCAGAATGGCATTACATACGCCATGCGGTAAATTATAAAAGCCGCCTAATTGGTGCGCCATCGCGTGCACATAACCTAACGACGCATTATTGAAGGCAATACCGGCCAGATATTGCGCATAGGCCATATTATCTCTGGCCTTCATATATTCACCGTTAGCAACTGCTTTCGGCAAATATTGCGTGATCATT	NA	NA	NA	NA
WP_172452804.1|2357355_2358324_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	6.7e-185
WP_001289134.1|2358641_2359352_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_000799244.1|2359469_2360054_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000994520.1|2360195_2360912_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001283944.1|2360973_2361624_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000055502.1|2361638_2362613_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000813719.1|2362603_2365090_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000820820.1|2365101_2365803_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000756958.1|2365996_2366605_-	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_001542733.1|2368012_2368309_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001542734.1|2368888_2372422_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000248889.1|2372405_2373185_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_000770925.1|2373840_2374677_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000665639.1|2374673_2376323_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_166739806.1|2376591_2376930_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	100.0	4.7e-37
>prophage 6
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	2591464	2647124	4705041	protease,tail,terminase,plate,holin	Salmonella_phage(39.22%)	77	NA	NA
WP_000422045.1|2591464_2592514_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|2592733_2593492_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278907.1|2593488_2594079_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|2594118_2594994_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001301109.1|2595206_2597102_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2597129_2597750_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2597746_2598628_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2598765_2598810_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194582.1|2598901_2600464_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2600463_2602059_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983865.1|2602059_2603421_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	2.5e-36
WP_000209520.1|2603432_2604626_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2604625_2605432_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2605812_2605992_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|2606077_2606578_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079505.1|2606623_2607130_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|2607189_2607828_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_001619373.1|2608184_2608928_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_073528508.1|2608957_2609497_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|2609601_2610000_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_001360141.1|2610039_2610759_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_032169930.1|2610982_2611279_+	YciI family protein	NA	NA	NA	NA	NA
WP_000639140.1|2611397_2611946_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
WP_060615094.1|2612360_2612792_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.3	7.4e-19
WP_060615093.1|2612763_2613195_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	57.9	1.4e-38
WP_111732528.1|2613198_2613834_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	50.9	3.5e-17
WP_057688092.1|2613833_2614514_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	80.1	1.0e-107
WP_053275101.1|2614510_2615710_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	84.2	5.2e-187
WP_053271600.1|2615710_2616064_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	3.8e-45
WP_053271601.1|2616066_2616720_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	2.6e-63
WP_145958853.1|2616938_2617184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053271603.1|2617321_2617678_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_053271604.1|2617674_2618745_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	66.7	4.1e-135
WP_053271605.1|2618748_2619054_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	46.5	3.3e-21
WP_053271606.1|2619053_2619629_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.7	2.0e-59
WP_053271607.1|2619628_2621608_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	45.2	2.1e-153
WP_053271608.1|2621788_2622214_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	2.5e-35
WP_053271609.1|2622217_2622658_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	78.1	4.4e-59
WP_053271610.1|2622669_2624160_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.6	4.4e-127
WP_057688090.1|2624163_2624706_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.1	5.4e-51
WP_053271612.1|2624698_2625085_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	68.0	3.9e-43
WP_053271613.1|2625084_2625591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111732530.1|2625587_2625995_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	55.4	7.5e-29
WP_053271615.1|2625963_2626329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053271616.1|2626366_2627311_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	60.5	2.2e-108
WP_053271617.1|2627322_2627841_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	45.9	4.6e-31
WP_111732532.1|2627852_2629106_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	45.7	4.0e-81
WP_053271619.1|2629273_2629471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053271620.1|2629508_2630042_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	57.6	3.6e-47
WP_053271621.1|2630103_2631582_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	54.2	1.8e-149
WP_111732534.1|2631594_2632800_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4JCM3	uncultured_Caudovirales_phage	65.1	3.3e-149
WP_053275098.1|2632835_2633543_-|terminase	terminase small subunit	terminase	A0A1I9KFG9	Aeromonas_phage	54.2	1.0e-09
WP_111732536.1|2633679_2633940_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	60.5	1.5e-22
WP_053271625.1|2634587_2634980_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	57.8	6.5e-30
WP_111732539.1|2634976_2635513_-	lysozyme	NA	K7PM52	Enterobacteria_phage	88.0	5.9e-90
WP_053271627.1|2635512_2635728_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	84.5	9.7e-28
WP_053271628.1|2636235_2637066_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	81.9	1.9e-127
WP_053271629.1|2637062_2637203_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	71.1	3.0e-06
WP_053271630.1|2637199_2637562_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	80.3	1.1e-50
WP_053271631.1|2637558_2637849_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	2.4e-45
WP_053271632.1|2637851_2638058_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	63.2	6.4e-21
WP_053271633.1|2638057_2638657_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	90.5	4.4e-102
WP_053271634.1|2638691_2638940_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	97.6	8.8e-41
WP_000861984.1|2639057_2639291_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	100.0	2.3e-38
WP_111732541.1|2639782_2640388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053271635.1|2640568_2640766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053271636.1|2641045_2641426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053271637.1|2641670_2641784_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	71.4	2.2e-07
WP_053271638.1|2642798_2643137_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	44.6	2.5e-14
WP_029403925.1|2643139_2644051_-	replication protein	NA	H6WRX7	Salmonella_phage	72.5	1.2e-119
WP_001472167.1|2644135_2644693_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	41.1	6.4e-23
WP_001568772.1|2644704_2644923_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_001472166.1|2644995_2645415_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	77.1	3.1e-46
WP_001767223.1|2645479_2645761_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	75.3	2.2e-32
WP_001767222.1|2645998_2646289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567552.1|2646744_2646951_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	97.1	7.3e-33
WP_001472162.1|2646962_2647124_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	55.8	1.0e-10
>prophage 7
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	3134972	3140101	4705041	integrase,tail	Enterobacteria_phage(37.5%)	9	3132136:3132150	3140175:3140189
3132136:3132150	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_032249878.1|3134972_3135557_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	5.4e-105
WP_124063797.1|3135556_3136690_-|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	57.2	1.8e-40
WP_000548531.1|3136768_3136960_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077250124.1|3136970_3137252_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_000763367.1|3137350_3137572_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001348592.1|3137782_3138385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3138627_3138795_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3138834_3139053_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_095784519.1|3139030_3140101_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	5.6e-201
3140175:3140189	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	3598462	3661826	4705041	holin,lysis,tail,transposase	Enterobacteria_phage(42.86%)	54	NA	NA
WP_000131044.1|3598462_3600496_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3600624_3601212_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_111732609.1|3601225_3602698_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3602711_3604382_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_032279632.1|3604594_3605263_+	membrane protein	NA	NA	NA	NA	NA
WP_000370307.1|3605505_3606201_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3606193_3607621_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3607631_3608351_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3608876_3609731_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3609956_3611282_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3611390_3611627_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3611638_3612232_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_053273336.1|3612821_3613673_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020219.1|3613812_3618069_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3619183_3619285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3619648_3619912_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3619911_3620052_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3620086_3620314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3621137_3621680_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3621754_3622342_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3622399_3623068_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_073528135.1|3623093_3625619_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001310578.1|3625608_3627252_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|3627220_3627931_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3628243_3628573_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024238330.1|3628584_3628815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|3628819_3629434_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070679.1|3629850_3630540_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643325.1|3630536_3631493_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_001619173.1|3631489_3633688_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
WP_001619172.1|3633697_3634654_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3634632_3635043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073528136.1|3635703_3636447_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001421130.1|3637951_3638533_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	2.1e-101
WP_111732698.1|3638532_3639393_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.4	4.9e-38
WP_073528137.1|3640766_3641459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073528138.1|3641554_3642058_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_073528139.1|3642054_3642588_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	6.4e-97
WP_032264896.1|3642722_3642962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111732613.1|3642958_3643273_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	1.8e-51
WP_000839582.1|3643277_3643493_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592546.1|3645541_3646501_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3646693_3647218_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3647373_3647751_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_073528145.1|3648818_3649865_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	3.4e-33
WP_000081352.1|3649973_3650906_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|3650892_3652296_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000213416.1|3652570_3653782_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001013515.1|3653851_3654865_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
WP_000044265.1|3654861_3655812_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	5.3e-33
WP_000184938.1|3655808_3656618_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000222149.1|3656627_3657494_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001568600.1|3657522_3658485_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_000227970.1|3660749_3661826_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_LS483297	Escherichia coli strain NCTC11023 chromosome 1	4705041	4046386	4094094	4705041	transposase,integrase,holin,portal	Enterobacteria_phage(15.38%)	46	4087056:4087070	4104042:4104056
WP_085949497.1|4046386_4047533_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000394281.1|4047670_4047835_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000199300.1|4048011_4049424_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000181202.1|4049667_4050588_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.6e-61
WP_001529635.1|4051066_4052299_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037419.1|4052339_4053620_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001300012.1|4053735_4054887_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_001301175.1|4054896_4055664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666413.1|4055660_4055918_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001300028.1|4055982_4056843_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141219.1|4056910_4058089_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151855.1|4058101_4058656_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001295597.1|4058905_4059589_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4059585_4060047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568406.1|4060059_4061232_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340764.1|4061296_4062208_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986215.1|4062200_4062593_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4062589_4062673_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_021567758.1|4063264_4064095_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833686.1|4064235_4065009_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208220.1|4065223_4066684_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
WP_000438591.1|4066764_4067949_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558251.1|4068288_4069632_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000832247.1|4069805_4070708_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000870592.1|4070727_4071231_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244826.1|4071243_4071774_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000947148.1|4073363_4074314_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_000951129.1|4074683_4074998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111732637.1|4075720_4076872_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001293435.1|4077025_4079023_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|4079085_4080363_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_109866136.1|4080610_4080829_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172452806.1|4081178_4082392_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	7.9e-167
WP_064669511.1|4083968_4085024_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	8.7e-170
WP_001547634.1|4085027_4085390_+	hypothetical protein	NA	B2ZY70	Ralstonia_phage	43.0	8.7e-13
WP_023203535.1|4085745_4086018_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
WP_047731171.1|4086017_4086779_-	septation initiation protein	NA	NA	NA	NA	NA
4087056:4087070	attL	CGGCTGGCGTTCCAC	NA	NA	NA	NA
WP_111732641.1|4087179_4089852_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.7	1.1e-59
WP_001075576.1|4089848_4090232_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001027148.1|4090228_4090513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111732643.1|4090544_4090904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160371161.1|4090896_4091073_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	54.2	6.5e-06
WP_160371160.1|4091260_4091446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670042.1|4091542_4091773_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_111732645.1|4092162_4092801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096179884.1|4092831_4094094_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.4	8.2e-66
4104042:4104056	attR	GTGGAACGCCAGCCG	NA	NA	NA	NA
