The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	96129	106253	1906873	tRNA	Streptococcus_phage(50.0%)	18	NA	NA
WP_032463306.1|96129_96789_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	29.7	1.6e-12
WP_021775568.1|96951_97152_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021775570.1|97169_97793_+	hypothetical protein	NA	A0A1W6JPC3	Staphylococcus_phage	43.3	2.2e-40
WP_000648623.1|97819_98062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285318.1|98304_98487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021775546.1|98498_98831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172450317.1|98827_98968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680741.1|98948_99146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|99157_99487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|99489_99762_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_023609951.1|99762_100629_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.1	4.0e-120
WP_111680742.1|100640_102035_+	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	7.7e-49
WP_022555265.1|102327_102582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022555266.1|102578_102752_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	5.6e-10
WP_022555267.1|102757_102940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680743.1|103013_103502_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	58.0	1.3e-48
WP_111680744.1|103888_104251_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_111680745.1|104993_106253_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.7	1.5e-72
>prophage 2
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	173223	255028	1906873	tRNA,protease,portal,integrase,terminase,holin,capsid,tail,head	Streptococcus_phage(41.67%)	92	191496:191513	236070:236087
WP_002986372.1|173223_175725_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.7	0.0e+00
WP_002986370.1|176031_177465_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002986367.1|177535_177814_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002986362.1|177936_178422_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002986359.1|178512_179175_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002987909.1|179179_180043_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002987910.1|180044_180749_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_172450320.1|181073_182720_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_002986347.1|182972_184064_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002986345.1|184552_185749_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	4.0e-30
WP_002986341.1|185764_187492_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002986338.1|187622_190265_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	35.9	2.5e-64
WP_002986334.1|190451_190907_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002986328.1|190958_191426_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
191496:191513	attL	GCTGAGGGCTATTTTTAT	NA	NA	NA	NA
WP_002986324.1|191528_192392_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002986319.1|192610_193753_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	2.9e-86
WP_002986316.1|193970_194282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986314.1|194285_194825_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002986311.1|194964_195744_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002992549.1|195743_196259_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_002986305.1|196872_198105_-	S-layer protein/peptidoglycan endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_111680920.1|198480_199182_-|integrase	site-specific integrase	integrase	A0A141E0H2	Streptococcus_phage	65.4	1.6e-82
WP_002986291.1|199749_200283_-	hypothetical protein	NA	A0A1S5SAH9	Streptococcus_phage	55.3	1.3e-20
WP_002986288.1|200294_200675_-	hypothetical protein	NA	Q938N7	Temperate_phage	64.0	1.4e-40
WP_032467305.1|200684_201035_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFC6	Streptococcus_phage	60.3	4.8e-32
WP_002986282.1|201345_201561_+	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	78.6	2.2e-24
WP_002986270.1|201765_202509_+	ORF6C domain-containing protein	NA	A3F617	Streptococcus_phage	86.1	1.5e-120
WP_002986266.1|202584_202797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986264.1|202830_203022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986261.1|203053_203209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986259.1|203210_203753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986256.1|203883_204144_+	hypothetical protein	NA	A0A1S5SAL2	Streptococcus_phage	73.3	1.1e-28
WP_002986254.1|204162_204351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680752.1|204337_205684_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	84.9	9.3e-209
WP_002986249.1|205670_206273_+	hypothetical protein	NA	A0A1P8VVT8	Streptococcus_phage	93.0	1.7e-106
WP_002986245.1|206250_206997_+	conserved phage C-terminal domain-containing protein	NA	A0A1P8VVR3	Streptococcus_phage	96.8	2.2e-135
WP_002986242.1|206997_207822_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	79.6	1.4e-127
WP_002986238.1|207821_208049_+	hypothetical protein	NA	C5J991	Streptococcus_phage	50.7	7.1e-13
WP_032467330.1|208062_208239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986233.1|208235_208520_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	93.6	5.9e-41
WP_050452837.1|208522_209161_+	DNA cytosine methyltransferase	NA	A0A140HLV8	Bacillus_phage	65.6	2.7e-65
WP_002986227.1|209148_209304_+	hypothetical protein	NA	A0A1S5SFL7	Streptococcus_phage	60.5	1.6e-08
WP_002986215.1|210330_210663_+	hypothetical protein	NA	A0A1S5SCX1	Streptococcus_phage	57.4	1.2e-32
WP_002986212.1|210655_210985_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVV5	Streptococcus_phage	45.5	3.2e-22
WP_002986209.1|210981_211155_+	hypothetical protein	NA	A0A1J0MGB9	Staphylococcus_phage	46.9	1.1e-05
WP_002986206.1|211157_211406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986201.1|211590_211740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986198.1|211708_211909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986196.1|211932_212352_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SF97	Streptococcus_phage	42.0	1.1e-19
WP_032467304.1|212446_213010_+|integrase	site-specific integrase	integrase	A0A1S5SCL7	Streptococcus_phage	61.5	5.4e-62
WP_002986191.1|213181_213475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986189.1|213471_213801_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	49.5	6.7e-20
WP_002986187.1|213922_214270_+	hypothetical protein	NA	E2ELI1	Clostridium_phage	34.5	4.0e-07
WP_002986185.1|214250_215909_+|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	44.4	4.0e-129
WP_002986182.1|216107_217343_+|portal	phage portal protein	portal	A0A1S7FYX7	Listeria_phage	37.6	3.6e-74
WP_002986180.1|217346_218063_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	42.9	1.4e-38
WP_002986177.1|218098_219292_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	30.8	1.7e-41
WP_002986176.1|219306_219594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986174.1|219613_219907_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_111680753.1|219908_220286_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_002986170.1|220257_220629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986168.1|220637_221060_+	hypothetical protein	NA	A0A1S7FZ20	Listeria_phage	48.5	3.1e-25
WP_002986166.1|221070_221658_+	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	36.4	1.1e-28
WP_002986164.1|221678_222050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986162.1|222085_222244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986160.1|222317_225719_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	58.8	9.5e-93
WP_111680754.1|225718_226426_+|tail	phage tail family protein	tail	A0A1B1P761	Bacillus_phage	35.2	1.3e-28
WP_002986155.1|226422_228471_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	44.0	2.2e-121
WP_111680755.1|228470_229493_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	87.0	2.5e-158
WP_111680756.1|229503_231519_+	gp58-like family protein	NA	Q938J9	Temperate_phage	75.0	3.4e-183
WP_002987513.1|231530_231962_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	100.0	1.1e-73
WP_111680757.1|231964_232582_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	90.2	2.8e-80
WP_111680758.1|232591_233047_+|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	80.1	2.6e-62
WP_002986150.1|233158_234364_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	84.5	3.1e-208
WP_032467302.1|234479_235652_-	streptodornase Sda1	NA	A7J2B8	Streptococcus_phage	49.5	1.4e-75
WP_002986147.1|235890_236073_+	hypothetical protein	NA	A3F673	Streptococcus_phage	80.0	1.1e-19
WP_002986145.1|236122_236314_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
236070:236087	attR	ATAAAAATAGCCCTCAGC	NA	NA	NA	NA
WP_002986141.1|236986_237691_+	streptococcal pyrogenic exotoxin SpeG	NA	NA	NA	NA	NA
WP_011888573.1|238146_239496_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002986134.1|239843_241352_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002986126.1|242039_242711_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002986125.1|242809_243709_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.2	9.6e-77
WP_002986123.1|243741_244758_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002986120.1|245055_245505_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002986117.1|245497_247204_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-36
WP_002986115.1|247206_248991_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.3e-44
WP_002986113.1|249108_249876_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_002986111.1|249985_250432_+	dUTP diphosphatase	NA	A0A1P8BLJ0	Lactococcus_phage	52.8	4.5e-35
WP_002986109.1|250512_251874_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_002993284.1|252062_252560_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_002986107.1|252690_253401_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_002986105.1|253582_255028_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L481	Tupanvirus	31.2	6.8e-08
>prophage 3
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	449019	509236	1906873	tRNA,terminase,portal,holin,capsid,tail,head	Streptococcus_phage(79.17%)	67	NA	NA
WP_002983351.1|449019_450297_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.0	4.7e-93
WP_002983353.1|450688_451048_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_002983356.1|451161_452073_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002983360.1|452089_452899_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002983363.1|452987_453980_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_111680773.1|454331_455144_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002983366.1|455408_456869_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.3	1.9e-37
WP_002983367.1|457022_457484_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002983369.1|457458_457983_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002983372.1|457991_459275_+	LCP family protein	NA	NA	NA	NA	NA
WP_002983373.1|459385_459742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002983376.1|459738_460158_-	HIT family protein	NA	NA	NA	NA	NA
WP_002983379.1|460229_460955_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-20
WP_002983381.1|460957_461992_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002983385.1|462055_462847_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_002983387.1|462846_463482_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_111680774.1|464879_465737_-	DNA adenine methylase	NA	A0A2H4UUI2	Bodo_saltans_virus	29.3	9.9e-15
WP_111680775.1|465793_467497_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002983397.1|467621_468008_-	ImmA/IrrE family metallo-endopeptidase	NA	Q7Y4M1	Streptococcus_phage	58.4	1.3e-38
WP_002983399.1|468011_468359_-	helix-turn-helix transcriptional regulator	NA	A0A126GGQ7	Streptococcus_phage	73.5	1.5e-41
WP_002983400.1|468651_468861_+	helix-turn-helix transcriptional regulator	NA	M1Q1B4	Streptococcus_phage	53.6	7.7e-14
WP_032467257.1|468919_469195_+	DNA-binding phage protein	NA	A7J272	Streptococcus_phage	95.6	1.7e-45
WP_002983403.1|469191_469362_+	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	2.0e-20
WP_002983404.1|469354_469561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983405.1|469557_469941_+	hypothetical protein	NA	A7J274	Streptococcus_phage	100.0	7.2e-66
WP_002983406.1|469937_470090_+	hypothetical protein	NA	A7J275	Streptococcus_phage	100.0	4.4e-19
WP_002983407.1|470086_470290_+	hypothetical protein	NA	A7J276	Streptococcus_phage	100.0	9.4e-33
WP_002983408.1|470377_470677_+	hypothetical protein	NA	A7J277	Streptococcus_phage	92.9	1.0e-38
WP_002983409.1|470676_471834_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	99.7	1.7e-219
WP_111680776.1|471847_472411_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	1.9e-51
WP_002983411.1|472453_474385_+	DNA polymerase	NA	A7J280	Streptococcus_phage	87.8	0.0e+00
WP_002983412.1|474389_476774_+	DNA primase	NA	A7J282	Streptococcus_phage	97.6	8.8e-287
WP_002983413.1|477140_477416_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	8.6e-45
WP_111680777.1|477412_478735_+	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.7	1.3e-252
WP_002983415.1|478735_478897_+	hypothetical protein	NA	A7J285	Streptococcus_phage	94.3	1.2e-22
WP_032467258.1|478899_479166_+	hypothetical protein	NA	A7J287	Streptococcus_phage	60.0	7.3e-17
WP_002983418.1|479298_479712_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	64.2	5.8e-45
WP_032467259.1|479807_480260_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	93.3	1.0e-71
WP_002983420.1|480249_481527_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	98.1	3.5e-242
WP_002983421.1|481541_483074_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	98.2	4.3e-287
WP_002983422.1|483033_484479_+|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	96.7	4.5e-270
WP_002983423.1|484509_484698_+	hypothetical protein	NA	A7J294	Streptococcus_phage	98.4	1.4e-22
WP_002983424.1|484700_484967_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	85.2	1.1e-33
WP_002983425.1|485127_485697_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	97.4	1.0e-79
WP_002983429.1|485709_486597_+	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_002983431.1|486608_486965_+|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	98.3	2.5e-57
WP_000639437.1|486975_487254_+	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_050317072.1|487250_487595_+	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	96.5	5.1e-55
WP_002983439.1|487598_487958_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	100.0	2.1e-59
WP_002983441.1|487969_488569_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	100.0	2.2e-93
WP_111680778.1|488622_489078_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	99.3	3.1e-76
WP_002983445.1|489152_489386_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	100.0	4.4e-34
WP_002983447.1|489400_493426_+	tape measure protein	NA	A7J2A5	Streptococcus_phage	98.9	5.5e-241
WP_002983449.1|493437_494280_+|tail	phage tail family protein	tail	A7J2A6	Streptococcus_phage	98.6	5.5e-159
WP_111680779.1|494289_496329_+|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	91.1	0.0e+00
WP_111680780.1|496328_497450_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	71.2	1.6e-126
WP_111680781.1|497462_499481_+	gp58-like family protein	NA	Q938J9	Temperate_phage	69.4	6.1e-172
WP_002983467.1|499492_499924_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_002983470.1|499926_500559_+	hypothetical protein	NA	Q938J7	Temperate_phage	51.9	4.3e-47
WP_002983475.1|500569_501025_+|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	3.0e-63
WP_002983479.1|502594_503389_+	DNA/RNA non-specific endonuclease	NA	A7J2B8	Streptococcus_phage	35.6	8.9e-26
WP_002983481.1|503455_503635_+	hypothetical protein	NA	A3F673	Streptococcus_phage	79.7	5.2e-19
WP_002983483.1|503879_504416_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002983485.1|504590_505748_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002983486.1|505763_506060_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002983488.1|506052_506355_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002983491.1|506374_509236_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.2	4.5e-19
>prophage 4
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	748136	853285	1906873	protease,transposase,terminase,portal,integrase,holin,capsid,tail,head	Erysipelothrix_phage(35.29%)	103	740958:740973	851547:851562
740958:740973	attL	TGGTTTAGCGATTGAT	NA	NA	NA	NA
WP_002984013.1|748136_748832_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002987363.1|750216_751530_-	chloride channel protein	NA	NA	NA	NA	NA
WP_002987365.1|751504_752464_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
WP_002984018.1|752796_754956_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	64.0	8.6e-265
WP_002989242.1|754975_755194_-	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
WP_002984031.1|755586_755850_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002984033.1|755854_757588_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_002984035.1|757772_759200_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032467267.1|759294_760569_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_111680795.1|760679_761765_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	1.2e-33
WP_002984060.1|761862_762489_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_002984063.1|762568_762832_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002984066.1|762884_763694_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002987482.1|763888_765022_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_009881127.1|765163_765661_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_111680796.1|765660_767331_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.5	2.3e-47
WP_172450324.1|767425_767629_+	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
WP_002984078.1|767603_768545_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_002984080.1|768748_771127_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002989292.1|771663_772860_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
WP_002984086.1|773033_774293_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002984090.1|774649_775387_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002984095.1|775624_776167_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002984098.1|776175_777459_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002984100.1|777474_778335_+	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002984102.1|778336_779302_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002984103.1|779412_780696_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002984106.1|780688_781180_+	shikimate kinase	NA	NA	NA	NA	NA
WP_002984109.1|781387_782839_+	LCP family protein	NA	NA	NA	NA	NA
WP_111680797.1|782887_784288_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	97.6	2.8e-256
WP_111680798.1|784423_785242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070606647.1|785299_786274_+	DNA cytosine methyltransferase	NA	V5URQ5	Oenococcus_phage	60.6	2.9e-103
WP_063633225.1|786310_786853_-	Bsp6I family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_036755888.1|786856_787078_-	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	59.2	7.2e-18
WP_070606650.1|787089_789669_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_111680922.1|790161_790779_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_019116101.1|790871_791066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680799.1|791068_791347_+	hypothetical protein	NA	S5M5X1	Brevibacillus_phage	58.8	1.4e-07
WP_111680800.1|791339_792479_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	75.1	2.2e-166
WP_111680801.1|792480_793029_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	83.1	9.9e-85
WP_172450325.1|793208_795197_+	hypothetical protein	NA	A0A2K5B2B0	Erysipelothrix_phage	69.0	1.8e-272
WP_172450326.1|795292_795439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680802.1|795413_796088_+	Rha family transcriptional regulator	NA	A0A2K5B268	Erysipelothrix_phage	63.0	9.7e-82
WP_092086173.1|796080_796458_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	51.3	1.7e-27
WP_111680803.1|796444_798682_+	primase C-terminal domain-containing protein	NA	A0A1B0RXC5	Streptococcus_phage	46.6	9.7e-195
WP_111680804.1|798805_799087_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	56.7	2.6e-20
WP_111680805.1|799067_800411_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	73.9	3.1e-172
WP_111680806.1|800459_800930_+	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	40.8	1.3e-19
WP_111680807.1|801042_801402_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	53.8	2.3e-34
WP_026064997.1|801535_802108_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	46.9	1.3e-42
WP_019116087.1|802113_802896_+	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_172450334.1|803675_804845_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.2	4.5e-50
WP_111680808.1|805634_807227_+	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	37.6	1.7e-31
WP_111680809.1|807301_807940_+	virulence protein	NA	A0A2K5B280	Erysipelothrix_phage	49.8	2.1e-49
WP_111680810.1|807941_808172_+	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	62.9	1.5e-18
WP_111680811.1|808161_808335_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_111680812.1|808441_808687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680813.1|808688_808967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680814.1|809055_810648_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	81.8	4.5e-263
WP_111680815.1|810773_810983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680816.1|811049_812378_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	71.4	3.1e-172
WP_172450327.1|812295_813036_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	60.9	8.2e-66
WP_111680817.1|813041_814223_+|capsid	phage major capsid protein	capsid	M1Q1R5	Streptococcus_phage	49.9	8.7e-102
WP_111680818.1|814245_814524_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXE3	Streptococcus_phage	43.5	2.2e-11
WP_111680819.1|814523_814856_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_028077999.1|814852_815233_+	HK97 gp10 family phage protein	NA	Q6DMT7	Streptococcus_phage	38.5	2.8e-14
WP_111680820.1|815225_815558_+	hypothetical protein	NA	M1Q1Z4	Streptococcus_phage	45.5	1.8e-20
WP_111680821.1|815547_816138_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	49.5	2.5e-41
WP_111680822.1|816149_816515_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	34.2	3.8e-08
WP_111680823.1|817039_818383_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_111680824.1|818464_821290_+|tail	phage tail tape measure protein	tail	Q6DMT2	Streptococcus_phage	39.0	1.7e-58
WP_111680825.1|821292_821964_+	hypothetical protein	NA	A0A2K9V3E8	Faecalibacterium_phage	29.7	7.5e-18
WP_111680826.1|821964_824790_+|tail	phage tail protein	tail	H7BV46	unidentified_phage	30.4	1.5e-115
WP_111680827.1|824801_824984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680828.1|824964_825240_+	toxin	NA	NA	NA	NA	NA
WP_111680829.1|825251_825548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680830.1|825547_825763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680831.1|826381_826906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063633073.1|826907_827318_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	67.6	5.2e-46
WP_111680832.1|827310_828297_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2K9V338	Faecalibacterium_phage	54.0	3.5e-48
WP_111680833.1|828472_828883_+	helix-turn-helix domain-containing protein	NA	A0A1B0RXC6	Streptococcus_phage	41.4	6.4e-20
WP_111680834.1|828869_829082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680835.1|829143_830709_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	49.4	2.6e-138
WP_111680836.1|830705_831116_+	hypothetical protein	NA	A0A2K5B2B3	Erysipelothrix_phage	39.0	2.2e-20
WP_111680837.1|831118_832705_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	61.7	1.1e-152
WP_172450334.1|832879_834049_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.2	4.5e-50
WP_111680838.1|834345_835338_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172450328.1|835498_837253_+	ABC transporter ATP-binding protein	NA	F2Y352	Organic_Lake_phycodnavirus	35.1	4.0e-26
WP_111680840.1|837236_838958_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.4e-28
WP_111680841.1|838968_839550_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_111680842.1|839549_840239_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_111680843.1|840232_841597_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	34.1	1.4e-18
WP_002984115.1|843178_843580_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_011888813.1|843684_845169_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_011284908.1|845542_846763_+	MFS transporter	NA	NA	NA	NA	NA
WP_002984124.1|846882_847248_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_014407646.1|847362_848094_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_172450329.1|848110_848434_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1P8CWQ3	Bacillus_phage	46.2	3.3e-19
WP_002987502.1|848479_848833_-|transposase	transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	30.8	1.6e-06
WP_002987505.1|848865_849159_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002984130.1|849236_850547_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_002992869.1|850770_851643_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
851547:851562	attR	TGGTTTAGCGATTGAT	NA	NA	NA	NA
WP_168389357.1|851942_853285_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.4	1.8e-63
>prophage 5
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	886172	968079	1906873	tRNA,transposase,integrase,terminase,holin,capsid,tail,head	Streptococcus_phage(38.71%)	101	886035:886094	934629:934724
886035:886094	attL	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGA	NA	NA	NA	NA
WP_002984265.1|886172_887261_-|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.4	4.2e-204
WP_002984270.1|887510_888320_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	35.8	3.8e-24
WP_002984272.1|888332_889070_-	helix-turn-helix domain-containing protein	NA	A0A1S5S8T5	Streptococcus_phage	63.9	2.7e-77
WP_021340823.1|889229_889376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023605145.1|889372_889855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984281.1|889928_890156_+	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	57.3	2.9e-14
WP_011017884.1|890263_890773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|891031_891241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984301.1|891413_891650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032461902.1|891774_891960_+	helix-turn-helix transcriptional regulator	NA	J7KH19	Streptococcus_phage	85.2	4.7e-23
WP_014411880.1|892038_892350_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_012560974.1|892616_892796_+	hypothetical protein	NA	A0A1X9I5M8	Streptococcus_phage	65.5	1.2e-12
WP_000370473.1|892968_893241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568478.1|893230_893611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560973.1|893666_894110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340639.1|894225_895029_+	DnaD domain protein	NA	A0A2P0VI76	Streptococcus_phage	53.8	2.4e-63
WP_021341158.1|895015_895798_+	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	98.1	2.7e-144
WP_011018145.1|895788_895926_+	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	78.4	2.7e-07
WP_021341157.1|895936_896293_+	HTH domain-containing protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	99.2	3.0e-50
WP_011018143.1|896273_896528_+	hypothetical protein	NA	Q938N0	Temperate_phage	98.8	3.7e-42
WP_111680846.1|896549_897032_+	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	98.8	1.6e-49
WP_111680847.1|897032_897707_+	ERF family protein	NA	Q938M8	Temperate_phage	96.4	1.3e-102
WP_021340323.1|897699_898119_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	96.4	1.5e-69
WP_011106686.1|898124_898328_+	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_011285574.1|898327_898768_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
WP_111680848.1|898764_899121_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	96.6	1.4e-58
WP_020905119.1|899347_899632_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	98.9	2.0e-49
WP_047235252.1|899628_899898_+	hypothetical protein	NA	Q938M2	Temperate_phage	87.6	2.5e-41
WP_011889038.1|900098_900383_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	88.3	1.0e-37
WP_011017571.1|900386_900869_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
WP_002987468.1|901059_901461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002987471.1|901460_902096_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	67.9	5.5e-87
WP_003052405.1|902364_902802_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	100.0	3.6e-77
WP_172450334.1|903010_904180_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.2	4.5e-50
WP_011284864.1|905206_906121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990048.1|906210_906423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002987543.1|906739_907117_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
WP_001132273.1|907168_907354_-	type II toxin-antitoxin system HicA family toxin	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
WP_047235590.1|907416_907884_+|terminase	terminase small subunit	terminase	A0A141E1Y3	Streptococcus_phage	70.8	1.9e-52
WP_047235253.1|907861_909169_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.0	8.5e-183
WP_172450334.1|910042_911212_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.2	4.5e-50
WP_002984371.1|912146_913772_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	43.8	1.1e-46
WP_010922213.1|913762_913942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984375.1|914001_914271_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	84.1	2.3e-34
WP_011017861.1|914366_914546_+	hypothetical protein	NA	M1NRK8	Streptococcus_phage	79.7	2.6e-18
WP_002984380.1|914660_914909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984382.1|914910_915654_+	phage repressor protein/antirepressor Ant	NA	M1PKL6	Streptococcus_phage	56.9	5.3e-73
WP_002984384.1|915765_916299_+	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	83.9	1.4e-14
WP_002984386.1|916308_916689_+	phage protein	NA	A0A0K2CNR0	Brevibacillus_phage	37.9	5.2e-08
WP_002984388.1|916688_917765_+|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	56.0	5.5e-103
WP_002984390.1|917774_918017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984392.1|918030_918384_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
WP_002984393.1|918380_918689_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	5.7e-13
WP_002984399.1|918669_919035_+	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	7.7e-17
WP_002984401.1|919031_919421_+	hypothetical protein	NA	Q38611	Lactococcus_phage	68.2	3.5e-44
WP_164552684.1|919430_920078_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	52.0	1.4e-40
WP_002984405.1|920130_920490_+	hypothetical protein	NA	D7RWD6	Brochothrix_phage	44.5	4.3e-20
WP_002984407.1|920531_920861_+	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	41.5	2.0e-11
WP_047235256.1|920875_924142_+	tape measure protein	NA	U6E979	Streptococcus_phage	30.4	1.6e-04
WP_002984411.1|924173_924953_+|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	55.5	1.9e-68
WP_111677295.1|924949_927001_+|tail	phage tail protein	tail	A3F656	Streptococcus_phage	84.6	0.0e+00
WP_047235257.1|926997_928005_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	71.7	1.4e-137
WP_002987337.1|928017_929928_+	gp58-like family protein	NA	Q938J9	Temperate_phage	71.3	6.0e-121
WP_002987333.1|929941_930103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111680849.1|930105_930723_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	87.3	9.5e-76
WP_002987582.1|930732_931008_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_003058873.1|931004_931232_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_002984418.1|931347_932553_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	84.5	2.7e-207
WP_011017966.1|932622_933057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285611.1|933327_934128_-	streptodornase Sda3	NA	NA	NA	NA	NA
WP_002984426.1|934365_934554_+	hypothetical protein	NA	A3F673	Streptococcus_phage	83.1	1.3e-20
WP_002989607.1|935144_935759_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
934629:934724	attR	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGATTACTTACGGTAAGCATTGATGGAGCCGGTGGGAGT	NA	NA	NA	NA
WP_002984433.1|935889_936675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984437.1|936684_937383_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_032467272.1|937382_937754_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111680850.1|937938_941049_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	29.4	8.3e-120
WP_002984444.1|941128_942142_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002984447.1|942204_943707_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984449.1|943924_944482_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002984451.1|944657_946472_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.9	5.2e-98
WP_002984453.1|946667_947003_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002984455.1|947109_947751_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002984457.1|947760_948390_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
WP_002984460.1|948405_949242_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002984462.1|949610_950384_+	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_011017829.1|950753_951989_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_002984465.1|952108_953431_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_002984467.1|953959_956278_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	1.6e-131
WP_002984469.1|956639_956888_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002984470.1|956924_957536_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984473.1|957546_957735_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984475.1|957747_958287_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|958327_958528_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002994467.1|958538_959027_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984480.1|959189_959831_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984482.1|959973_960516_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002989664.1|960633_961335_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_002984487.1|964078_964675_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002984488.1|964685_965642_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002984490.1|965738_967079_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_002984492.1|967194_968079_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	1277158	1287761	1906873		Streptococcus_phage(57.14%)	8	NA	NA
WP_002985123.1|1277158_1278301_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
WP_032467286.1|1278535_1278976_+	membrane protein	NA	NA	NA	NA	NA
WP_002985132.1|1280361_1281714_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
WP_002985134.1|1281934_1282276_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_002985136.1|1282336_1283503_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1283596_1284283_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1284279_1285443_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_011054348.1|1285550_1287761_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
>prophage 7
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	1507649	1564656	1906873	transposase,bacteriocin,protease,tRNA	Streptococcus_phage(35.29%)	55	NA	NA
WP_002985729.1|1507649_1507850_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002992018.1|1507862_1508090_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|1509314_1509497_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002985741.1|1510702_1511179_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1511199_1512096_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1512215_1512623_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985748.1|1512603_1513101_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002985750.1|1513259_1513835_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002985751.1|1513880_1514933_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_032464218.1|1515091_1516864_-	oleate hydratase	NA	NA	NA	NA	NA
WP_002985755.1|1517178_1518360_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	39.6	2.1e-15
WP_002985757.1|1518515_1518731_-	YozE family protein	NA	NA	NA	NA	NA
WP_002985759.1|1518727_1519237_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002985761.1|1519309_1520167_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002985763.1|1520275_1520833_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1520861_1521590_-	UMP kinase	NA	NA	NA	NA	NA
WP_002985768.1|1521911_1522601_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1522706_1523132_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_111680889.1|1523345_1524479_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_010921962.1|1524701_1525055_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002985774.1|1525124_1527530_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.4	2.2e-88
WP_002985776.1|1527746_1528553_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_002985777.1|1528699_1529554_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985780.1|1529554_1530280_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_014407368.1|1530343_1531276_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002985785.1|1531421_1532069_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002985787.1|1532167_1532509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985789.1|1532659_1533355_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002985791.1|1533374_1533626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985793.1|1533625_1534180_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_020833305.1|1534213_1535596_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	6.5e-32
WP_002985796.1|1535769_1537107_-	MFS transporter	NA	NA	NA	NA	NA
WP_111680890.1|1537439_1538399_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002985800.1|1538474_1539173_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.0	5.4e-11
WP_002990844.1|1539165_1539402_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_032467294.1|1540379_1540631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011017434.1|1541045_1541396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985808.1|1541853_1542606_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_002985810.1|1542808_1544989_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.2	7.3e-171
WP_002985812.1|1544955_1545444_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_002985814.1|1545447_1546461_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.0	1.6e-96
WP_111680891.1|1546954_1548955_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.3	2.7e-87
WP_111680889.1|1549235_1550369_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002985820.1|1550520_1551228_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_111680892.1|1552000_1556944_-|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_002985826.1|1557209_1558391_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_002985828.1|1558624_1559452_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	8.4e-128
WP_002985829.1|1559525_1559882_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	4.8e-40
WP_002985831.1|1560179_1560809_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1560855_1561248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985836.1|1561274_1562138_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985838.1|1562142_1562466_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_032467296.1|1562869_1563109_-	Tpl protein	NA	NA	NA	NA	NA
WP_002985844.1|1563127_1564003_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_032464192.1|1564020_1564656_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	1.2e-65
>prophage 8
NZ_LS483298	Streptococcus pyogenes strain NCTC8225 chromosome 1	1906873	1830940	1846660	1906873	tRNA	Streptococcus_phage(61.54%)	22	NA	NA
WP_014411911.1|1830940_1831732_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	48.5	7.5e-09
WP_003045754.1|1831799_1832057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011185070.1|1832111_1832519_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	68.7	8.5e-49
WP_023080068.1|1832532_1833150_+	Rha family transcriptional regulator	NA	A0A159B6D5	Gordonia_phage	38.8	2.2e-11
WP_023611295.1|1833383_1833725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611263.1|1833711_1833933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922764.1|1833935_1834127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|1834138_1834468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|1834470_1834743_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_010922767.1|1834743_1835601_+	replication protein	NA	A0A1X9I6L2	Streptococcus_phage	74.8	4.5e-124
WP_032461241.1|1835569_1837258_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	5.5e-259
WP_000694577.1|1837544_1837718_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_014407944.1|1837723_1837897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611171.1|1837898_1838408_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.1e-29
WP_002992480.1|1838481_1838970_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	1.4e-45
WP_032461242.1|1839369_1839732_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.9	1.3e-05
WP_111677542.1|1839706_1840090_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	41.7	3.7e-14
WP_111677543.1|1840290_1840953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002982175.1|1841349_1843905_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.4	3.0e-43
WP_002982173.1|1843891_1844098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002982171.1|1844240_1844678_-	arginine repressor	NA	NA	NA	NA	NA
WP_002982167.1|1844968_1846660_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.2	1.9e-73
