The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	1057925	1065065	4705297		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1057925_1058564_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1058560_1059823_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_000847985.1|1059819_1060728_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1060923_1061691_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141320.1|1061741_1062398_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	6.6e-51
WP_001272928.1|1062503_1065065_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	1446928	1487125	4705297	lysis,integrase,protease,tail,holin,coat,portal,head,terminase	Enterobacteria_phage(56.67%)	62	1443238:1443254	1490379:1490395
1443238:1443254	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1446928_1447129_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_111724587.1|1447187_1447355_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.1e-26
WP_111724588.1|1447465_1447960_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	56.0	6.1e-41
WP_111724589.1|1448032_1448539_-	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	78.3	6.0e-60
WP_111724590.1|1448535_1448985_-	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	85.2	1.3e-63
WP_001214456.1|1448981_1449146_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_000753554.1|1449162_1449477_-	hypothetical protein	NA	K7P7J8	Enterobacteria_phage	100.0	1.2e-50
WP_000041326.1|1449488_1449971_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
WP_000065840.1|1449954_1450866_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
WP_111724591.1|1450862_1451171_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	9.6e-53
WP_001243355.1|1451255_1451408_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_032174193.1|1451392_1451524_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	97.7	5.2e-16
WP_111724592.1|1451548_1452517_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_021538741.1|1452698_1453169_-	hypothetical protein	NA	Q9MCQ6	Enterobacteria_phage	98.7	3.1e-87
WP_000915090.1|1453223_1453361_-	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_111724797.1|1453369_1453702_-	antitermination protein	NA	Q716D8	Shigella_phage	98.2	4.2e-54
WP_001519589.1|1454084_1454780_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_000067728.1|1454856_1455072_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_000536663.1|1455188_1455470_+	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	98.9	7.4e-44
WP_000166961.1|1455504_1455666_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_111724593.1|1455652_1456543_+	DNA replication protein	NA	K7PH45	Enterobacterial_phage	99.0	9.9e-159
WP_000131492.1|1456532_1457969_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_096931390.1|1458044_1458251_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	9.0e-31
WP_021571715.1|1458268_1458583_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	71.4	5.9e-34
WP_000814617.1|1458782_1459193_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_001254255.1|1459189_1459366_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_111724594.1|1459368_1459770_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	95.5	2.1e-68
WP_111724595.1|1459729_1459939_+	protein ninF	NA	G9L691	Escherichia_phage	95.7	4.5e-30
WP_001279421.1|1459931_1460201_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_021499323.1|1460200_1460491_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	1.7e-51
WP_021499322.1|1460487_1460850_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994515.1|1460846_1461035_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235464.1|1461031_1461655_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	99.5	5.2e-114
WP_000783734.1|1462088_1462412_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_044307810.1|1462395_1462872_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	2.9e-88
WP_111724596.1|1462868_1463336_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	99.4	1.0e-77
WP_001139680.1|1463323_1463476_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001058931.1|1463680_1464166_+	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_000807785.1|1464413_1464656_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000113731.1|1464658_1465099_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_063119634.1|1465095_1466511_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	5.8e-278
WP_111724597.1|1466512_1468711_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.1	0.0e+00
WP_111724598.1|1468801_1469695_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.0	1.4e-128
WP_111724599.1|1469713_1470967_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	99.8	4.4e-237
WP_001389518.1|1471008_1471197_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_104858431.1|1471177_1471639_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	7.8e-83
WP_097742041.1|1471648_1473067_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.6	4.2e-276
WP_071974538.1|1473066_1473768_+|tail	phage tail protein	tail	A0A2H4FWI9	Salmonella_phage	97.9	3.6e-79
WP_000627625.1|1473767_1474223_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	4.4e-86
WP_052906988.1|1474225_1474918_+	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	99.1	1.1e-117
WP_047661445.1|1474928_1476344_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.7	9.8e-201
WP_097502944.1|1476343_1478182_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	75.5	1.7e-250
WP_000890120.1|1478201_1478531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111724600.1|1478649_1479069_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.1	2.5e-72
WP_000090241.1|1479085_1479337_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000677939.1|1479427_1479589_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_111724601.1|1479657_1480560_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	95.0	8.5e-166
WP_111724602.1|1480660_1483084_+|head	phage head-binding domain-containing protein	head	A0A088CQ58	Enterobacteria_phage	84.9	3.6e-62
WP_097729458.1|1483117_1484539_-	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_097729459.1|1484531_1485455_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	91.4	7.1e-160
WP_000915536.1|1485451_1485814_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	91.7	4.1e-55
WP_097729460.1|1485967_1487125_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	8.2e-222
1490379:1490395	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	1730671	1738980	4705297		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569316.1|1730671_1731598_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|1731602_1732334_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1732314_1732422_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1732481_1733213_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1733434_1735120_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1735116_1735836_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1735882_1736353_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1736393_1736855_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1736979_1738980_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
>prophage 4
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	2140260	2168469	4705297	tRNA,capsid,tail,transposase,terminase	Enterobacteria_phage(71.43%)	32	NA	NA
WP_001144202.1|2140260_2142189_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|2142192_2142735_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2142831_2143029_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2143081_2143438_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2143560_2143605_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_073544585.1|2143887_2144871_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	6.4e-34
WP_000672380.1|2144885_2147273_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2147277_2147577_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|2147880_2148021_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488107.1|2148211_2148472_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_052931257.1|2148784_2149342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083446.1|2149344_2149932_-	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
WP_065304199.1|2151426_2152611_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	5.3e-224
WP_111724635.1|2152610_2153123_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	1.7e-91
WP_000665314.1|2153177_2153543_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2153551_2153707_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_111724636.1|2153693_2156501_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979945.1|2156513_2157002_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_097729471.1|2157098_2158277_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_111724637.1|2159285_2160086_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	4.8e-128
WP_111724638.1|2160131_2161184_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.3	9.5e-193
WP_111724639.1|2161846_2161996_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	86.4	4.2e-14
WP_000985163.1|2161992_2162196_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_061321272.1|2162219_2162636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021654.1|2162728_2162842_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|2162838_2163081_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_089590247.1|2163092_2163341_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.5e-29
WP_085947771.1|2163418_2164580_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_097729032.1|2164642_2164966_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	95.8	1.9e-35
WP_000956529.1|2166125_2167106_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154168.1|2167168_2167720_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2167719_2168469_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 5
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	2288557	2342908	4705297	protease,lysis,transposase	Escherichia_phage(30.0%)	57	NA	NA
WP_001260835.1|2288557_2289379_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2289478_2289562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743942.1|2289654_2289990_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091828.1|2290387_2291641_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2291747_2292641_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2292775_2293996_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2294120_2294816_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2294768_2296061_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2296219_2296834_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2296876_2297731_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_096846754.1|2297732_2298350_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2298360_2300784_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_111724647.1|2300844_2301954_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.1	1.1e-85
WP_164558598.1|2302755_2303968_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	3.2e-168
WP_063848527.1|2306115_2306631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164558598.1|2306689_2307903_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	3.2e-168
WP_063848529.1|2308708_2309200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164558601.1|2309281_2310271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111724651.1|2310965_2312444_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	1.5e-119
WP_001295396.1|2312642_2312948_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072104773.1|2313055_2313766_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2313768_2314329_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2314363_2314705_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2314839_2315166_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000836066.1|2316597_2317617_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2317674_2317785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111724652.1|2319117_2319369_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_020218920.1|2319441_2321913_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_109158035.1|2322006_2322198_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2322194_2322383_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001299931.1|2322782_2322947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171952.1|2322950_2323169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379588.1|2323328_2323484_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000362155.1|2323749_2324169_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2324269_2324551_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693835.1|2324534_2324960_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_164558598.1|2325957_2327171_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	3.2e-168
WP_046080786.1|2327455_2327881_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.3	3.5e-61
WP_111724653.1|2328108_2329134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2329512_2329620_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813254.1|2329721_2329877_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_111724654.1|2330043_2330322_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	8.2e-11
WP_097454173.1|2330323_2331373_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	1.8e-114
WP_001204787.1|2331390_2331768_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|2331923_2332448_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000066495.1|2333704_2333917_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_145959063.1|2333927_2334122_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2334263_2334419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2334591_2334765_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_032176291.1|2335060_2335267_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	7.6e-22
WP_000421825.1|2335817_2336357_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_085947771.1|2336515_2337678_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_111724656.1|2338150_2338741_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	6.2e-24
WP_000836768.1|2339057_2339291_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2339359_2339473_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2340075_2341359_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_111724657.1|2341447_2342908_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 6
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	3010563	3098478	4705297	lysis,tRNA,integrase,capsid,protease,tail,portal,head,terminase,plate	Salmonella_phage(58.62%)	92	3003527:3003542	3102357:3102372
3003527:3003542	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3010563_3011856_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3011946_3013290_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3013300_3013912_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3014066_3018056_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3018190_3018685_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3019229_3020195_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043577.1|3020317_3022084_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_072662931.1|3022084_3023806_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	9.9e-22
WP_001241678.1|3023847_3024552_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3024836_3025055_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934040.1|3025855_3028132_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
WP_000520781.1|3028162_3028483_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3028805_3029030_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188140.1|3029102_3031049_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3031045_3032161_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|3032311_3033268_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|3033264_3034923_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3035347_3036043_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491127.1|3036537_3037437_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|3037580_3039233_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001412899.1|3039244_3040213_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3040345_3042064_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3042100_3043102_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136577.1|3043112_3044543_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3044641_3045655_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|3045651_3046482_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3046478_3046802_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|3046927_3047443_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027213.1|3047660_3048389_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	4.6e-29
WP_000756569.1|3048406_3049138_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001684.1|3049144_3049861_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3049860_3050529_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_111724702.1|3050819_3051551_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149766.1|3051749_3052877_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.9	1.2e-28
WP_000389260.1|3052917_3053406_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|3053465_3054311_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|3054307_3055261_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_073528531.1|3055270_3056404_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000203025.1|3057959_3058436_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3058523_3059426_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3059486_3060209_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3060192_3060480_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3060639_3060897_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3060926_3061304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3061574_3063260_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3063495_3063714_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011800.1|3063804_3064905_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	1.2e-177
WP_000980387.1|3064901_3065387_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_111724703.1|3065383_3068461_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.7	0.0e+00
WP_000763311.1|3068453_3068573_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3068587_3068890_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207667.1|3068944_3069460_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046151.1|3069469_3070642_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	1.7e-203
WP_024173770.1|3071380_3071872_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089534.1|3071874_3072318_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	49.7	3.6e-37
WP_001030518.1|3072289_3072892_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.0	5.6e-97
WP_111724704.1|3072891_3074436_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.6	4.5e-199
WP_111724705.1|3074432_3075038_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	3.4e-110
WP_000268309.1|3075030_3075939_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_000177580.1|3075925_3076285_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000993763.1|3076281_3076860_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000575294.1|3076950_3078096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829128.1|3078073_3078520_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.8	5.3e-60
WP_001039936.1|3078512_3078944_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_001080923.1|3079039_3079468_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	3.8e-47
WP_063112263.1|3079464_3079842_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_111724706.1|3079843_3080356_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	90.5	7.6e-87
WP_000171568.1|3080336_3080552_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3080555_3080759_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673526.1|3080758_3081223_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059191.1|3081318_3081969_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_096309988.1|3081972_3083031_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.2e-181
WP_111724707.1|3083047_3083881_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	1.2e-121
WP_111724708.1|3084023_3085790_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_053294929.1|3085789_3086815_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.9	4.0e-172
WP_126320719.1|3087677_3088166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086258518.1|3088171_3088486_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_052928646.1|3088488_3089556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137502154.1|3089895_3090573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3090686_3090920_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3090930_3091119_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_111724709.1|3091271_3093686_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.4	0.0e+00
WP_111724710.1|3093682_3094540_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	4.1e-154
WP_000752614.1|3094536_3094764_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_033813113.1|3094763_3094997_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_001504055.1|3095064_3095406_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_000956182.1|3095369_3095570_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|3095577_3096087_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|3096119_3096341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033813112.1|3096466_3097036_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_111724711.1|3097051_3097267_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	71.4	2.9e-08
WP_000290924.1|3097428_3098478_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	5.3e-103
3102357:3102372	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 7
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	3181933	3222386	4705297	lysis,integrase,capsid,transposase,tail,portal,head,terminase	Enterobacteria_phage(56.82%)	49	3204461:3204476	3224094:3224109
WP_000586336.1|3181933_3183265_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_001657981.1|3183338_3183923_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_111724714.1|3183922_3187150_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_105280121.1|3187214_3187814_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.2e-105
WP_111724715.1|3187881_3191361_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.8	0.0e+00
WP_000090891.1|3191421_3192054_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|3191990_3192734_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152627.1|3192739_3193438_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	8.6e-134
WP_000847379.1|3193437_3193767_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_111724716.1|3193763_3196325_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.7	0.0e+00
WP_000459457.1|3196317_3196752_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|3196733_3197156_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_024260476.1|3197171_3197912_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
WP_000683105.1|3197919_3198315_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975051.1|3198311_3198890_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000753019.1|3198901_3199255_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158868.1|3199266_3199662_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063218.1|3199703_3200729_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_001369910.1|3200784_3201117_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_053276103.1|3201126_3202446_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_053276104.1|3202426_3204028_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	4.2e-309
WP_000198149.1|3204024_3204231_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027267.1|3204227_3206153_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
3204461:3204476	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453576.1|3206127_3206673_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_111724717.1|3207061_3207301_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.6e-21
WP_085947771.1|3207347_3208509_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001537735.1|3208614_3209025_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_001059339.1|3209327_3209852_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139682.1|3210054_3210207_-	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_111724718.1|3210194_3210662_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	91.0	3.4e-70
WP_089075737.1|3210658_3211156_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	1.3e-88
WP_000839596.1|3211155_3211371_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|3211944_3213027_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|3213215_3213599_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|3213684_3213825_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|3213821_3214184_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_111724719.1|3214180_3214471_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	6.3e-46
WP_000224912.1|3214463_3214634_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_111724720.1|3214633_3215089_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	2.8e-61
WP_072130332.1|3215085_3215187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379700.1|3215276_3215633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351655.1|3216094_3216418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032139864.1|3218111_3218219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|3218310_3218643_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145902.1|3218710_3219013_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
WP_000788890.1|3219009_3219711_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_111724802.1|3220924_3221080_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	97.7	3.5e-19
WP_001303849.1|3221119_3221338_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3221315_3222386_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3224094:3224109	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
NZ_LS483296	Escherichia coli strain NCTC9966 chromosome 1	4705297	3664036	3719984	4705297	protease,transposase,integrase	Enterobacteria_phage(20.0%)	58	3653988:3654008	3720147:3720167
3653988:3654008	attL	TTTTGTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_001254917.1|3664036_3665188_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_020239822.1|3667620_3667884_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|3667898_3668162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643630.1|3668391_3668673_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350437.1|3668707_3669277_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000101613.1|3669382_3672232_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_001295707.1|3672231_3672423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111724747.1|3672483_3674211_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	9.7e-86
WP_001275372.1|3674298_3674757_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_001022485.1|3674779_3675694_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001005473.1|3675796_3676684_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090787.1|3676773_3677385_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001166995.1|3677464_3678610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786817.1|3678599_3679040_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	3.4e-11
WP_001295706.1|3679043_3680759_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843382.1|3680755_3681253_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_000196689.1|3681230_3682196_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323727.1|3682220_3683372_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_001568592.1|3685287_3686151_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000197387.1|3686242_3687064_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	2.1e-46
WP_111724748.1|3687280_3687982_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001144031.1|3688022_3688259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649865.1|3688258_3688702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001385283.1|3688724_3689192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|3689268_3689508_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000211838.1|3689605_3690064_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000811693.1|3690079_3690556_+	RadC family protein	NA	NA	NA	NA	NA
WP_001568590.1|3690564_3690786_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070396.1|3690804_3691122_+	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000854680.1|3691142_3691484_+	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_085947771.1|3693154_3694317_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001567470.1|3694562_3695543_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_001185343.1|3695958_3696231_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	41.1	8.3e-08
WP_111724749.1|3696236_3696788_-	phage polarity suppression protein	NA	NA	NA	NA	NA
WP_001567467.1|3696784_3697528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111724750.1|3697929_3700602_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	9.2e-59
WP_001567464.1|3700598_3700982_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001567463.1|3700978_3701263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|3701647_3701824_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_021537047.1|3701955_3702129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567459.1|3702161_3702452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075842496.1|3704174_3705365_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	5.8e-122
WP_000893278.1|3705719_3706973_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3706984_3708088_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3708375_3709431_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_097729452.1|3709469_3709871_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3709928_3711173_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3711264_3711723_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3711983_3713441_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001353768.1|3713497_3714055_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|3713966_3714233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|3714467_3714920_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|3714929_3715328_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|3715330_3715624_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_111724751.1|3715675_3716731_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207587.1|3716801_3717587_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_096165450.1|3717531_3719271_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006256.1|3719486_3719984_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
3720147:3720167	attR	CGCCTTATCCGGCCTACAAAA	NA	NA	NA	NA
