The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	83510	157850	2078193	protease,tRNA,transposase	Bacillus_virus(20.0%)	53	NA	NA
WP_109227138.1|83510_84410_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_045918571.1|88390_89014_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_109227140.1|89140_89932_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_162562981.1|90048_90837_+	MlaE family lipid ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_109227142.1|90865_91621_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.0	1.6e-21
WP_045918573.1|91945_93706_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	4.6e-59
WP_109227143.1|93719_94193_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_045918574.1|94189_95104_-	DUF1189 family protein	NA	NA	NA	NA	NA
WP_045913706.1|95134_95530_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_045919573.1|95840_96986_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_045917953.1|98309_98492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227144.1|98521_98806_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_045917955.1|98799_99675_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_045917956.1|99834_100170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227145.1|101359_101542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227673.1|102647_103373_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_109227147.1|103392_104178_-	extragenic suppressor protein SuhB	NA	NA	NA	NA	NA
WP_045917958.1|104174_104744_-	elongation factor P	NA	NA	NA	NA	NA
WP_045917959.1|104949_106203_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.3	9.8e-120
WP_045917960.1|106328_107630_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045917961.1|107643_107937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227148.1|107950_109171_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_109227149.1|109251_110268_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109227150.1|110542_112996_+	virB4 protein precursor	NA	NA	NA	NA	NA
WP_109227151.1|112995_117519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045917964.1|119938_121675_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.8	3.3e-41
WP_045913377.1|121658_121991_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_109227152.1|122886_127008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045917974.1|129199_129550_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_045917967.1|129566_129956_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_162562982.1|130147_131938_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_045917975.1|131972_132758_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_109227153.1|135335_137051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227154.1|137059_138529_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.9	7.5e-71
WP_109227674.1|138625_140386_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_109227155.1|142454_143030_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	30.4	4.6e-08
WP_109227156.1|143064_143709_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.2	6.3e-14
WP_109227157.1|143806_144310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045913641.1|144313_145123_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.0	4.1e-18
WP_109227158.1|145496_145775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227159.1|145839_146541_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_109227675.1|146994_147471_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_109227676.1|147958_148423_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_045914126.1|148441_148936_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_109227160.1|148977_149565_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	2.6e-06
WP_109227161.1|149686_150661_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	3.9e-84
WP_109227162.1|151260_152334_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_162562948.1|152430_152574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227163.1|152657_153113_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045919586.1|154032_155595_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_109227164.1|155895_156999_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_174198122.1|157050_157470_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_174198144.1|157520_157850_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	171068	243490	2078193	integrase,transposase	Streptococcus_phage(23.53%)	59	226204:226225	251154:251175
WP_109227171.1|171068_172067_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	1.8e-84
WP_045919081.1|172134_172590_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227172.1|172882_175720_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.7	2.3e-07
WP_109227173.1|175748_177089_-	ankyrin repeat domain-containing protein	NA	A0A2H4X210	Flamingopox_virus	29.0	4.5e-06
WP_109227174.1|177266_178370_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109227175.1|178421_179381_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227176.1|179390_180638_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109227177.1|180643_181144_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045918824.1|181147_182293_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109227178.1|182315_184955_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109227179.1|186252_186951_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109227180.1|188143_189856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919179.1|189864_191301_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.9	2.3e-72
WP_045919178.1|191536_192112_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	29.6	5.7e-06
WP_109227181.1|192149_192794_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	30.6	3.7e-14
WP_045918715.1|192838_193342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227182.1|193345_194155_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	27.1	4.8e-19
WP_109227183.1|195717_199152_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.6	3.9e-09
WP_064613282.1|199876_201097_+|integrase	site-specific integrase	integrase	A0A0R6PGY7	Moraxella_phage	25.3	2.3e-25
WP_041621693.1|201228_201564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045912835.1|201563_202115_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_045917268.1|202111_202588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081420566.1|203005_203341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227184.1|203379_204708_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_045919286.1|204916_206632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919285.1|206640_208089_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.5	2.6e-71
WP_045914898.1|208321_208897_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	29.2	4.6e-08
WP_045915372.1|208931_209576_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	27.1	3.4e-07
WP_109227185.1|209623_210127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045917470.1|210130_210940_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.7	2.4e-18
WP_045915136.1|211306_211585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918981.1|211649_212351_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080946297.1|212804_213281_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_109227679.1|213768_214233_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_109227186.1|214251_214746_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_109227187.1|214787_215375_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	2.6e-06
WP_109227188.1|215499_216582_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	4.4e-84
WP_109227189.1|216649_217105_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227190.1|217400_220202_+	AAA family ATPase	NA	A0A0H3UZA5	Geobacillus_virus	21.7	9.2e-09
WP_109227680.1|222042_223137_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_174198126.1|223737_224148_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045919394.1|224157_225912_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045919393.1|225917_227063_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
226204:226225	attL	CCTTTGTTATAATAAGCATCTG	NA	NA	NA	NA
WP_109227191.1|227085_229737_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_109227192.1|229736_231038_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_109227193.1|231034_231733_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109227194.1|231729_233421_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_109227195.1|233417_233801_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_174191434.1|233823_234801_-	TraU family protein	NA	NA	NA	NA	NA
WP_109227196.1|234801_235005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227197.1|235091_235751_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_109227198.1|235747_238240_-	TraC family protein	NA	NA	NA	NA	NA
WP_045915079.1|238220_238550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227199.1|238549_239875_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109227200.1|239913_240249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108839729.1|240737_241226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045912835.1|241222_241774_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_041621693.1|241773_242109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227201.1|242206_243490_-|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	25.4	1.9e-14
251154:251175	attR	CAGATGCTTATTATAACAAAGG	NA	NA	NA	NA
>prophage 3
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	261005	311584	2078193	integrase,transposase	Pseudomonas_phage(20.0%)	38	291705:291764	312179:312832
WP_109227210.1|261005_262025_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227682.1|262076_263171_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109227211.1|265009_267811_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.6	2.3e-07
WP_045917117.1|268107_268563_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045915951.1|268884_269958_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109227212.1|270594_271701_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	4.5e-84
WP_108884021.1|271825_272413_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	3.4e-06
WP_045914126.1|272454_272949_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_108884033.1|272967_273432_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_109227683.1|273910_274396_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045918981.1|274849_275551_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_045918661.1|275615_275894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045913641.1|276260_277070_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.0	4.1e-18
WP_109227213.1|277073_277622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227214.1|277669_278314_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	27.7	2.6e-07
WP_045914898.1|278348_278924_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	29.2	4.6e-08
WP_045919163.1|279157_280600_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	37.5	2.1e-73
WP_045919162.1|280608_282174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227215.1|282693_283561_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	33.8	3.2e-21
WP_109227216.1|284194_285304_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045919346.1|285404_285980_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	1.8e-07
WP_109227217.1|286100_287063_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	1.3e-84
WP_045919345.1|287130_287586_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_174198123.1|287862_288807_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_045919117.1|288951_290739_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	25.1	7.1e-07
291705:291764	attL	ATGGTAATTTTTTGATGAAACCATCATTTTACGATCAGGCTCCATTGCTGGAATTAATAA	NA	NA	NA	NA
WP_045918955.1|291899_292235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227218.1|292358_293573_-|integrase	site-specific integrase	integrase	A0A2D1GNR7	Pseudomonas_phage	24.1	1.5e-16
WP_109227219.1|294867_295845_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	25.7	6.9e-12
WP_045918420.1|295897_296203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918419.1|296231_296633_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109227220.1|296629_296956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227221.1|298154_298340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158296923.1|298497_298635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918418.1|299612_304193_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_109227222.1|305610_305817_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_155367757.1|305813_305957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227223.1|308684_309593_+	AAA family ATPase	NA	A0A218KST2	Xenohaliotis_phage	42.4	1.6e-55
WP_109227218.1|310369_311584_+|integrase	site-specific integrase	integrase	A0A2D1GNR7	Pseudomonas_phage	24.1	1.5e-16
312179:312832	attR	TTATTAATTCCAGCAATGGAGCCTGATCGTAAAATGATGGTTTCATCAAAAAATTACCATGAAACCTATTTAAAGGAATGGGCAATTTTTATGATGAAAGGCTTGTTGACTACTTCTCCAAATGAGGTAGAAAGGCAAATAGCTGACATGAAAGTGGCATCTAGTAATACTGAATCTTTAAATAAATTTTTTCATGATCACTTGCAATTTGTTAAAGGCTCAAATGTATCTTCAGTCTTTTTTCCAAAAAAGATTGAAGTGGTAAATGAATGGAGTATTAATTAGTGGCACGCTTCGTTATTGGTTTAGCGATAGTAAACATATAGCTGTCGATAAGACTTACCTTTTGACTTACAAGCGAACTCCTAATTACCTTTTGTTATTGACTGGTGTTAAAGAGAATGGAATAAAAAAATGAATATTAGAGTTTTGAGATTTATGATAGGGCTTATTGCTTTGGTAAACGTTAATAATATATATGCAGTAGAATATGAGTTAGAAGCTGATAATTTACTAAAGCTTGAGATTTCTGATAGTGGGCCAACAAGAATTAATCTTAAAGATGAAAAAATTAATGATATTTTTATGTATCCTCAAAATGCAGCTGAAGTTGTAGTTCATGAGTCTGGATTTTTGTTTATTGCTCTACGAGAA	NA	NA	NA	NA
>prophage 4
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	374379	450943	2078193	tRNA,holin,integrase,transposase	Tupanvirus(27.27%)	60	372774:372794	412517:412537
372774:372794	attL	TTTTTATAAAATTATTATTTC	NA	NA	NA	NA
WP_109227238.1|374379_375201_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109227239.1|375222_375549_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012461895.1|376919_377918_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_109227240.1|378270_379056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918319.1|379322_380198_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_109227241.1|380229_382794_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9L2Y7	Tupanvirus	50.7	2.5e-247
WP_109227242.1|382783_386488_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	30.7	2.9e-127
WP_109227243.1|386806_388612_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.8	1.5e-41
WP_045918320.1|388787_389483_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	41.3	1.6e-18
WP_045918321.1|389485_390136_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_045918322.1|390143_390443_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_109227244.1|390449_391082_+	ribonuclease D	NA	U3REX6	uncultured_virus	31.7	1.3e-11
WP_012461885.1|391681_392278_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_109227245.1|392407_393163_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_174190493.1|393906_394692_-	cytochrome c1	NA	NA	NA	NA	NA
WP_080503988.1|394884_395043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011944364.1|395482_395617_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_052694750.1|395617_396157_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_109227246.1|396386_398879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045917262.1|399031_399907_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_109227247.1|400522_401803_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.8	1.2e-109
WP_109227248.1|401836_404554_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	32.7	4.3e-104
WP_045918752.1|404652_405402_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_174198128.1|405528_406134_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012461876.1|406167_406392_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_045912239.1|411057_411345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155729561.1|411458_411599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045914999.1|411900_412347_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	42.4	2.2e-13
WP_045918381.1|413376_414285_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
412517:412537	attR	GAAATAATAATTTTATAAAAA	NA	NA	NA	NA
WP_045918382.1|414308_414578_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_045918383.1|414825_417036_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_045918384.1|417177_418455_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918386.1|418939_420169_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918387.1|420260_420980_-	DUF5394 family protein	NA	NA	NA	NA	NA
WP_045918389.1|421230_422460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918388.1|422639_423905_-	MFS transporter	NA	NA	NA	NA	NA
WP_045918068.1|423999_424509_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_012461860.1|424537_424744_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_045918069.1|424914_425520_+	COQ9 family protein	NA	NA	NA	NA	NA
WP_045918070.1|425556_428760_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	34.5	9.0e-178
WP_045918071.1|428896_429481_+	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_045918072.1|429835_431098_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_045918073.1|431154_432315_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_045919133.1|432329_433208_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.5	3.3e-21
WP_109227249.1|433276_434953_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_045918074.1|435129_437964_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_045917098.1|437992_438247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918075.1|438243_438729_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_109227250.1|438778_439552_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_109227251.1|439603_440296_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	33.7	7.3e-16
WP_045918076.1|440372_440918_-	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
WP_045918077.1|440871_441429_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_109227252.1|441567_443148_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045913414.1|443887_444181_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_045916254.1|444186_444936_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_045918087.1|445016_446570_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045919617.1|446605_447199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227253.1|447290_447512_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045919618.1|447723_448746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919245.1|449971_450943_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	565948	639808	2078193	transposase	Wolbachia_phage(20.0%)	45	NA	NA
WP_109227294.1|565948_566956_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227686.1|567007_568102_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109227295.1|569949_572751_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.2	7.8e-08
WP_109227296.1|573045_573501_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227297.1|573568_574603_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	1.9e-84
WP_045918871.1|574724_575300_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	2.3e-07
WP_109227298.1|577359_578076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227299.1|578625_579438_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	33.0	1.1e-28
WP_109227300.1|579441_579990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918868.1|580091_580736_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.2	8.2e-14
WP_045918867.1|580770_581346_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	28.6	6.7e-07
WP_109227301.1|581724_583431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919146.1|584751_586062_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109227302.1|586979_588281_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_109227303.1|588280_590920_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109227304.1|590928_592068_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109227305.1|592073_593828_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109227306.1|593837_594749_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227690.1|594800_595895_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109227307.1|597727_600526_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.2	7.8e-08
WP_047220226.1|600821_601277_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_047220525.1|601365_601941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227308.1|602622_603123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227309.1|603407_604418_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	6.3e-85
WP_109227310.1|604539_605115_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	1.0e-07
WP_109227311.1|605215_606073_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045918899.1|606094_606823_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045918900.1|607172_607889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080946874.1|608744_609272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918901.1|609750_610563_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	30.6	4.1e-26
WP_045918902.1|610566_611118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918480.1|611844_612420_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	30.4	1.1e-06
WP_109227312.1|612655_614104_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.6	1.1e-71
WP_045918394.1|616035_616218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918393.1|616247_616565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918392.1|618647_618929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227313.1|621498_623037_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012461666.1|623074_624829_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	38.4	1.5e-25
WP_045918391.1|626142_627657_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_045918390.1|627693_628074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227314.1|629248_630442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227315.1|632123_632699_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	30.4	1.5e-06
WP_109227316.1|633077_634784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045917262.1|637759_638635_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_045918918.1|638869_639808_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	61.2	5.8e-85
>prophage 6
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	764507	817897	2078193	tRNA,integrase,transposase	Bacillus_phage(28.57%)	34	793286:793345	809277:810269
WP_109227342.1|764507_764681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045912119.1|767027_767393_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_012461401.1|767412_767619_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_109227343.1|768053_769946_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	31.1	5.5e-90
WP_109227344.1|770110_771277_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_109227345.1|771428_772919_+	trigger factor	NA	NA	NA	NA	NA
WP_045917912.1|773422_775093_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	8.1e-45
WP_045917911.1|775198_775948_-	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	28.4	3.4e-11
WP_011944537.1|776226_776583_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_045914249.1|776655_776937_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_045917910.1|776979_777507_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_045917909.1|777660_779136_+	NTP/NDP exchange transporter	NA	NA	NA	NA	NA
WP_045917923.1|780505_780976_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_012461412.1|780984_781410_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	27.1	1.2e-05
WP_045917908.1|781465_781690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227346.1|784999_786343_+	DUF2748 family protein	NA	NA	NA	NA	NA
WP_011945154.1|786578_787688_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
793286:793345	attL	AAACGCCAGATTAGGATAAGGAGTTAGAAGAAAAAGAAGAGGAGATAAGATAAGGATTAA	NA	NA	NA	NA
WP_045917262.1|793295_794171_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_109227347.1|794278_794476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045914051.1|796006_796684_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_174198147.1|796753_798148_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_109227349.1|798313_799792_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.5	8.5e-38
WP_109227692.1|800961_801075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227693.1|804876_805374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227350.1|807096_807483_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_045915426.1|807535_807871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227351.1|808418_808655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045917262.1|809286_810162_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162562955.1|811672_812548_-	PRANC domain-containing protein	NA	A0A1V0QGP6	Shearwaterpox_virus	30.4	1.5e-10
809277:810269	attR	AAACGCCAGATTAGGATAAGGAGTTAGAAGAAAAAGAAGAGGAGATAAGATAAGGATTAAGTTTGGAGATAGAATAACTAGTAAGAGAAGCAATTATATGAACAAAGAAATTAAGAGGAGAACGGTGTCTAGTATGCTCTAAATGCATGTGTTTTTTTAGTACATTAAAGACAGACTCAATTAAAGAACGTTTATTTAATAAGCACTTATCATCTATGTCTAATAAATATGTTTTCATATCTTTACGAAGATTAGTAAATAAACGTAGACCATTGGAGAACAGTTGATGAAATAACTCTTTAGATATGTAAGCTTTATCACCAAACAATTTACCAGATAGGCCTTCAGAAATAACTGAAGCTATAGATAGGTCGCTTTTATTGCCTTTAGTAATTTTAACTGACATTATTTCGCCTTTGTTATTGATTATAAGATGAAGCTTAAAGCCTAAGAACCAGCCATAACTACTCTTGCCAATTTTAGAAAATCTGTTAAAAACTCTATTGCTGGAAGTACGTTTATTATGACAAATTGCTAACTTTGTAGAATCGATGTAATATATACCAGTCTCATCTCCTTTCAGATAATGCATTAATACGGCTAATGGTAGCAACATTCTAGGTAATAGTTGTATTATCCTACTATAGCTTGGTAAACAAAAGTATTCTTTATACTTATAACGCAAGTAATATAGATAATAATTTTTAAAATCCTTGCATGGAGATAAATAAAAATATATCGTTATTGTTAATAACTCAGCTAAGGATAACTTTCCATCTCTGTTCCTTTGATTACTACTTGGTATTAATTTCTTTCTTTCCCACTCTTGATATATCTTGCAAAAATTATCTATTAAATAGTATACTGTTACAATACATTTTTTCATGTTGGGTTATTTCATTTTTATTTAAATTTTCTTTATAACTCAACATTCTCTCTTTGTATACCTTTTATTCACTACCTTTCATATTTCCCTTATCCTATTCTGGCGTT	NA	NA	NA	NA
WP_162562956.1|812633_812777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227694.1|813989_815741_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_045918454.1|815992_816481_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045918453.1|816591_817152_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	39.4	4.6e-21
WP_109227354.1|817363_817897_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	1065131	1163893	2078193	integrase,transposase	Bacillus_phage(22.22%)	60	1128972:1128988	1153265:1153281
WP_045919592.1|1065131_1066124_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227707.1|1066133_1067381_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109227409.1|1067395_1067887_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_108839655.1|1067892_1069038_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045917530.1|1077976_1078297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918394.1|1078296_1078479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918393.1|1078508_1078826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227410.1|1081162_1084600_-	response regulator	NA	A0A1V0SGX0	Hokovirus	22.2	6.2e-15
WP_109227411.1|1084918_1085125_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109227412.1|1085197_1085458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227413.1|1086081_1087281_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_109227414.1|1087666_1089808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227415.1|1090052_1090670_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_064591360.1|1090669_1091647_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.3	6.2e-05
WP_045915899.1|1091828_1092653_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_109227416.1|1093043_1093382_-	YraN family protein	NA	NA	NA	NA	NA
WP_109227417.1|1093448_1094750_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.7	6.5e-34
WP_109227418.1|1095042_1096521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227419.1|1096526_1097804_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_109227420.1|1097803_1100695_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_109227421.1|1100735_1101377_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	30.7	7.2e-26
WP_157866413.1|1101476_1101647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012461270.1|1102590_1103859_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_109227422.1|1103848_1105735_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_045919406.1|1111939_1113646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918867.1|1114024_1114600_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	28.6	6.7e-07
WP_045919407.1|1114634_1115279_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.2	6.3e-14
WP_109227708.1|1115325_1115832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918900.1|1117197_1117914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918899.1|1118263_1118992_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045918859.1|1119013_1119871_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_109227423.1|1119971_1120547_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	31.0	6.0e-08
WP_109227424.1|1120552_1121080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052696007.1|1121232_1121859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064591486.1|1121873_1122140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227425.1|1122416_1123772_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918681.1|1124298_1126515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918768.1|1126934_1127378_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
1128972:1128988	attL	GAAAAAAATTTTTATGC	NA	NA	NA	NA
WP_174198151.1|1130864_1131959_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_045918840.1|1131943_1132996_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_045919174.1|1133005_1134751_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109227428.1|1139287_1139848_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	40.4	3.4e-24
WP_045919186.1|1139958_1140855_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045919185.1|1142791_1143175_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_174198134.1|1143197_1144175_-	TraU family protein	NA	NA	NA	NA	NA
WP_045918858.1|1144175_1144382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919419.1|1146473_1146803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227429.1|1148085_1148412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919420.1|1148547_1149036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919421.1|1149032_1149584_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_045919422.1|1149583_1149919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080943617.1|1149971_1150358_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_109227430.1|1150336_1150954_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_109227709.1|1152086_1152584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227431.1|1153494_1154265_+	hypothetical protein	NA	NA	NA	NA	NA
1153265:1153281	attR	GAAAAAAATTTTTATGC	NA	NA	NA	NA
WP_045913401.1|1154429_1156478_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_109227432.1|1157137_1158715_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	24.4	9.1e-06
WP_109227433.1|1158855_1160325_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_109227434.1|1160433_1162194_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_162562963.1|1163701_1163893_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	1212006	1281777	2078193	tRNA,transposase	Tetraselmis_virus(20.0%)	40	NA	NA
WP_045917262.1|1212006_1212882_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012460860.1|1213105_1213435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918363.1|1214690_1215905_-	aspartate kinase	NA	NA	NA	NA	NA
WP_109227452.1|1216186_1216684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919092.1|1216664_1218407_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_045919091.1|1218579_1219152_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_045919090.1|1219148_1219763_+	CvpA family protein	NA	NA	NA	NA	NA
WP_109227453.1|1221901_1222724_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109227454.1|1222831_1225435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227455.1|1225475_1227962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919317.1|1230209_1230479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227712.1|1233502_1234750_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109227458.1|1234759_1235719_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227459.1|1237174_1239976_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	25.3	1.3e-07
WP_109227460.1|1240799_1241774_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	1.4e-84
WP_109227713.1|1242158_1242611_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_109227461.1|1244641_1245286_-	ankyrin repeat domain-containing protein	NA	K7Y837	Megavirus	34.4	6.7e-16
WP_109227462.1|1247271_1247898_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_109227463.1|1247980_1249399_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_045919111.1|1249405_1250533_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_045919112.1|1250536_1251616_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_162562885.1|1253260_1253449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227465.1|1255364_1255661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162562967.1|1255657_1255810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227466.1|1256573_1256804_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045914565.1|1257897_1258332_-	CopD family protein	NA	NA	NA	NA	NA
WP_109227467.1|1258340_1259375_-	ferrochelatase	NA	NA	NA	NA	NA
WP_109227468.1|1259367_1260396_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_045914581.1|1262060_1263392_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_045914562.1|1264135_1264324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918168.1|1265364_1266648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918167.1|1267287_1269156_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_045918172.1|1269295_1269949_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	32.7	2.4e-21
WP_045918166.1|1269941_1271015_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_045918165.1|1271061_1271769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227469.1|1271777_1273142_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_109227714.1|1273207_1275877_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	30.7	6.0e-42
WP_109227470.1|1276313_1277765_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_045918164.1|1278585_1279416_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_045918163.1|1280901_1281777_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	1295505	1390046	2078193	tRNA,transposase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(10.0%)	57	NA	NA
WP_045918714.1|1295505_1296384_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	58.1	2.5e-85
WP_109227475.1|1299233_1302035_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	25.5	7.8e-08
WP_045918849.1|1302113_1303769_-	ankyrin repeat domain-containing protein	NA	A0A2H4X210	Flamingopox_virus	31.6	1.2e-05
WP_109227476.1|1304191_1305439_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109227177.1|1305444_1305945_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045918824.1|1305948_1307094_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045917262.1|1309187_1310063_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_045919042.1|1310157_1310751_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045918063.1|1312840_1313188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162562968.1|1313280_1314444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918061.1|1314956_1315277_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_045918060.1|1316579_1317395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918056.1|1318515_1318845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227477.1|1318844_1319306_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_162562969.1|1319302_1319479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918054.1|1322400_1322592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041621159.1|1322765_1323278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227478.1|1324191_1324362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918052.1|1324970_1327805_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_052692533.1|1328537_1328777_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045918050.1|1330718_1332107_-	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PKQ6	Moraxella_phage	25.9	2.2e-32
WP_045918049.1|1332103_1332877_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_045912755.1|1333405_1333888_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_109227479.1|1333903_1335406_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_045918048.1|1335655_1338196_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	27.3	6.1e-28
WP_011944947.1|1338226_1338589_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_109227480.1|1340069_1340309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918047.1|1342846_1343182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227482.1|1343528_1343711_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_045917530.1|1343710_1344031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227483.1|1344011_1346504_+	TraC family protein	NA	NA	NA	NA	NA
WP_109227484.1|1346500_1347160_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_174190469.1|1347243_1347417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174198137.1|1347417_1348395_+	TraU family protein	NA	NA	NA	NA	NA
WP_045913917.1|1348417_1348801_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_109227485.1|1350485_1351190_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109227486.1|1352489_1355141_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_109227487.1|1355156_1356302_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109227488.1|1356307_1358062_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045919280.1|1358071_1359055_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_045918640.1|1363783_1364239_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045915056.1|1364322_1364520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918639.1|1364558_1364840_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045915347.1|1365356_1366508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045915350.1|1366812_1367187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227489.1|1368019_1371457_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.3	7.8e-10
WP_162562970.1|1371762_1371900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080503971.1|1371915_1371990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919584.1|1372581_1373556_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	3.9e-84
WP_045919583.1|1373676_1374252_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	28.9	5.7e-06
WP_045918715.1|1376827_1377331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227490.1|1377375_1377933_-	ankyrin repeat domain-containing protein	NA	K7Y837	Megavirus	32.9	1.2e-13
WP_012460882.1|1378011_1379019_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_109227491.1|1379586_1379826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227492.1|1381533_1384761_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	2.4e-21
WP_045918189.1|1385808_1387203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918175.1|1389173_1390046_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	1395300	1467523	2078193	capsid,integrase,tail,head,transposase,tRNA,protease	Marinomonas_phage(10.0%)	56	1380655:1380674	1470030:1470049
1380655:1380674	attL	TTTATAGTCATTTACAATGA	NA	NA	NA	NA
WP_045918178.1|1395300_1395855_+|head,protease	HK97 family phage prohead protease	head,protease	I6S2W2	Marinomonas_phage	43.8	3.8e-23
WP_109227493.1|1395866_1396982_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	39.6	1.2e-52
WP_045918179.1|1397015_1397561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918180.1|1397562_1397904_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_045918181.1|1397903_1398329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918182.1|1398321_1398924_+	DUF2460 domain-containing protein	NA	A0A1W6DWM9	Sphingobium_phage	33.5	1.8e-18
WP_045918183.1|1398936_1399740_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_045914457.1|1399837_1400266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012461483.1|1400473_1400857_+	glutaredoxin family protein	NA	A0A223FNA2	NY_014_poxvirus	41.2	1.2e-09
WP_109227494.1|1401295_1402906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919454.1|1405433_1406987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227495.1|1410040_1410250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227496.1|1410582_1412094_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_109227497.1|1413257_1414742_+	ankyrin repeat domain-containing protein	NA	A0A1V0S7Q4	Shearwaterpox_virus	30.4	8.3e-09
WP_109227717.1|1414839_1414983_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_109227498.1|1415547_1417200_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.1	1.7e-47
WP_109227499.1|1417183_1418035_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_162562984.1|1418378_1419239_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_045913718.1|1419235_1420162_+	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_045918230.1|1420248_1422690_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_045918231.1|1422686_1423721_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.7	2.4e-31
WP_174198138.1|1424626_1424752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918233.1|1428631_1429570_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_045918234.1|1429611_1431609_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	33.9	2.6e-05
WP_045918235.1|1432118_1432886_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052692508.1|1432921_1434061_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_064591327.1|1434406_1435843_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_045918236.1|1435839_1436244_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_045918238.1|1436484_1437369_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_045918239.1|1437618_1438308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012461495.1|1440026_1440872_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_045918692.1|1443477_1443708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011944976.1|1443912_1444284_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_011944977.1|1444296_1444812_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_045918691.1|1444822_1445413_+	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_045918690.1|1445424_1446615_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_045918689.1|1446611_1447166_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_045918688.1|1447183_1448452_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_045918687.1|1448748_1449462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080943558.1|1449760_1450042_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109227501.1|1450594_1452094_+	NTP/NDP exchange transporter	NA	NA	NA	NA	NA
WP_109227502.1|1452342_1452699_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_109227503.1|1452769_1453123_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_109227504.1|1453298_1453778_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_109227505.1|1453833_1454802_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_045919267.1|1454830_1455169_-	DUF167 domain-containing protein	NA	NA	NA	NA	NA
WP_109227506.1|1455307_1456048_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_109227507.1|1456034_1456901_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_045918584.1|1456902_1457754_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_045914431.1|1457895_1458378_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_045918583.1|1458381_1458873_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_045918582.1|1459222_1459969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919589.1|1463760_1464015_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174198124.1|1464725_1465112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174198152.1|1465133_1465670_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	29.0	2.9e-12
WP_174198125.1|1467097_1467523_-|integrase	site-specific integrase	integrase	A0A0R6PGY7	Moraxella_phage	34.6	6.6e-12
1470030:1470049	attR	TTTATAGTCATTTACAATGA	NA	NA	NA	NA
>prophage 12
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	1793451	1873123	2078193	integrase,tRNA,transposase	Wolbachia_phage(15.38%)	56	1831774:1831809	1872288:1872323
WP_109227595.1|1793451_1794660_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2L0UZ92	Agrobacterium_phage	41.6	3.5e-34
WP_045918133.1|1794712_1795912_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_109227596.1|1796089_1799557_-	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	27.7	2.4e-06
WP_109227597.1|1799569_1800061_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_109227598.1|1800124_1800976_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_109227599.1|1800982_1801786_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109227600.1|1802210_1802738_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_045912408.1|1803013_1803220_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011944492.1|1803316_1803682_+	membrane protein	NA	NA	NA	NA	NA
WP_045918128.1|1804041_1804962_-	GTPase Era	NA	NA	NA	NA	NA
WP_045918129.1|1804958_1805981_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_045912405.1|1806185_1807265_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_045919341.1|1807659_1808532_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162562944.1|1809233_1809392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227602.1|1810025_1811798_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	36.3	1.3e-96
WP_109227603.1|1811794_1813894_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	36.1	6.5e-100
WP_174198140.1|1813957_1814419_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_109227604.1|1814480_1815398_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_045918315.1|1815676_1816489_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011945017.1|1817634_1818183_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	37.8	2.7e-05
WP_045914701.1|1818241_1818595_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_011945015.1|1818670_1819309_+	endonuclease III	NA	NA	NA	NA	NA
WP_109227605.1|1819305_1819938_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_109227606.1|1820257_1823731_+	acyl-[ACP]--phospholipid O-acyltransferase	NA	Q75ZG1	Hepacivirus	23.2	4.6e-18
WP_109227607.1|1825095_1825836_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	34.1	1.7e-23
WP_045918558.1|1825890_1826631_-	signal peptidase I	NA	NA	NA	NA	NA
WP_045917955.1|1827176_1828052_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_109227608.1|1828035_1828344_-	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	37.2	2.5e-08
WP_045918559.1|1830336_1830912_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	B3FJI5	Pseudomonas_phage	26.3	8.2e-05
WP_045919009.1|1831033_1831948_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	60.9	8.8e-86
1831774:1831809	attL	TAAAGCTGAAGGTAAAGCTGAAGGTAAAGCTGAAGG	NA	NA	NA	NA
WP_109227724.1|1832015_1832279_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227725.1|1833264_1833600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919006.1|1833618_1834074_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227609.1|1836767_1838276_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045919306.1|1842814_1843114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919307.1|1843550_1844834_+|integrase	site-specific integrase	integrase	Q9T1R0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	26.3	1.5e-14
WP_012460929.1|1844931_1845267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227610.1|1845266_1845818_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109227611.1|1845814_1846303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064592066.1|1846791_1847124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162562969.1|1847852_1848029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227477.1|1848025_1848487_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_045918471.1|1848486_1848816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227612.1|1848796_1851286_+	TraC family protein	NA	NA	NA	NA	NA
WP_109227484.1|1851282_1851942_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_174190469.1|1852025_1852199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174198141.1|1852199_1853177_+	TraU family protein	NA	NA	NA	NA	NA
WP_045913917.1|1853199_1853583_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_109227613.1|1855267_1855972_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109227614.1|1857270_1859928_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109227615.1|1859940_1861080_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109227617.1|1862849_1863869_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227690.1|1863920_1865015_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109227618.1|1866850_1869652_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.6	4.5e-08
WP_155379036.1|1870489_1870633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918678.1|1872124_1873123_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	1.4e-84
1872288:1872323	attR	CCTTCAGCTTTACCTTCAGCTTTACCTTCAGCTTTA	NA	NA	NA	NA
>prophage 13
NZ_LS398552	Orientia tsutsugamushi isolate UT76 chromosome I	2078193	1928750	2010346	2078193	integrase,tRNA,transposase	Salmonella_phage(18.18%)	52	1937240:1937271	1954258:1954289
WP_045918337.1|1928750_1930100_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_109227631.1|1930408_1931326_+	S49 family peptidase	NA	E5AFY0	Erwinia_phage	30.5	2.1e-15
WP_012462191.1|1933248_1933464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918846.1|1935276_1936518_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	35.5	2.5e-67
WP_108839859.1|1936872_1936953_+	hypothetical protein	NA	NA	NA	NA	NA
1937240:1937271	attL	ATAATTTTGAACTACGTTAACCAGTTTCGAAA	NA	NA	NA	NA
WP_109227632.1|1937465_1941113_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_109227633.1|1941608_1943873_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_045918328.1|1944163_1944349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012462182.1|1946038_1946587_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_109227635.1|1948053_1948218_-	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_109227636.1|1948181_1948586_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	38.8	3.0e-06
WP_045918154.1|1949372_1949843_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_109227728.1|1950499_1950727_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_045918151.1|1951237_1951705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227637.1|1952253_1952517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174198156.1|1952714_1953392_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	27.8	3.9e-14
WP_109227638.1|1957022_1957370_-	MobA/MobL family protein	NA	NA	NA	NA	NA
1954258:1954289	attR	ATAATTTTGAACTACGTTAACCAGTTTCGAAA	NA	NA	NA	NA
WP_108883845.1|1958294_1958369_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045918146.1|1958368_1958572_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109227639.1|1958648_1958963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012462169.1|1960421_1960691_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_045918144.1|1960731_1961058_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_045918143.1|1961196_1961865_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_045914296.1|1961970_1962720_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_109227640.1|1962938_1964309_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	34.3	1.4e-42
WP_045918142.1|1964367_1965843_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109227641.1|1965932_1969040_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_045918140.1|1970096_1971776_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	38.4	9.3e-41
WP_045918139.1|1971787_1972348_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_045918785.1|1972616_1973330_+	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	4.0e-17
WP_045918780.1|1973310_1974099_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_109227642.1|1974859_1975156_+	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	52.8	2.6e-07
WP_012462157.1|1975738_1976131_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_045918784.1|1981750_1982029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227169.1|1982093_1982795_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_109227678.1|1983022_1983490_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045915481.1|1984462_1984957_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_109227170.1|1984998_1985586_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	36.4	7.3e-09
WP_109227171.1|1985707_1986706_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	1.8e-84
WP_045919081.1|1986773_1987229_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109227643.1|1987521_1989489_+	AAA family ATPase	NA	A0A0H3UZA5	Geobacillus_virus	24.4	3.5e-07
WP_012461970.1|1989710_1991495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109227644.1|1993253_1994201_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109227730.1|1994210_1995458_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_045919031.1|1997165_1997627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919032.1|1998146_1999484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919030.1|1999483_1999813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174198157.1|2002094_2002415_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_109227646.1|2002411_2004106_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_109227647.1|2004102_2004801_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_045919321.1|2008081_2009836_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109227648.1|2009845_2010346_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
