The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	13358	88446	1932116	transposase	Bodo_saltans_virus(31.58%)	50	NA	NA
WP_109489709.1|13358_14226_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
WP_045918250.1|14922_15258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489710.1|16819_17107_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_045918254.1|17192_17450_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_045918257.1|17446_18112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918258.1|18131_18971_-	hypothetical protein	NA	A0A1V0SE83	Indivirus	30.2	1.1e-10
WP_109489712.1|21704_22572_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	9.4e-21
WP_045919643.1|22825_23776_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	5.9e-85
WP_109489713.1|24250_25135_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	4.0e-19
WP_045916314.1|25885_26878_-	ribonucleotide-diphosphate reductase subunit beta	NA	M1I8A4	Pelagibacter_phage	53.5	2.2e-98
WP_109489714.1|26900_28718_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	54.4	3.5e-187
WP_109489715.1|29766_30342_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	30.4	6.7e-07
WP_109489716.1|30931_31799_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	6.1e-20
WP_109489717.1|33754_35503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919503.1|36195_37293_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_162562846.1|40643_40793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162562847.1|41041_41305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489718.1|41823_42691_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	1.2e-20
WP_045918854.1|42997_43333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918855.1|43332_43884_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_045917268.1|43880_44357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081420566.1|44774_45110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489719.1|45148_46471_+	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_045915079.1|46470_46800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489720.1|46780_48577_+	TraC family protein	NA	NA	NA	NA	NA
WP_045912963.1|48484_49471_-	ankyrin repeat domain-containing protein	NA	Q70HB9	Fowlpox_virus	28.3	4.8e-13
WP_045918698.1|50007_50391_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_045918697.1|50387_52079_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_045918696.1|52238_53558_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918695.1|53752_54469_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109489724.1|55768_58405_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_109489725.1|58427_59573_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045919366.1|61204_61642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109489726.1|61852_62821_+|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_045918909.1|63127_64735_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109489727.1|64724_65264_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109490408.1|65315_66419_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109490409.1|68252_71063_-	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	25.1	4.1e-09
WP_109489728.1|71358_71814_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109489729.1|71883_72894_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	2.8e-85
WP_109489730.1|73012_73591_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	31.4	5.1e-07
WP_162562850.1|75422_75563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489732.1|76382_76931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918807.1|77556_78369_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	33.5	1.4e-29
WP_109489733.1|78372_78876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489734.1|78921_79566_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.8	7.5e-15
WP_109489735.1|79600_80176_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	30.4	5.7e-06
WP_109489736.1|80406_82113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918404.1|83234_84029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489737.1|87579_88446_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.4e-21
>prophage 2
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	96553	172958	1932116	transposase,tRNA,terminase,protease	Bodo_saltans_virus(29.41%)	54	NA	NA
WP_109489742.1|96553_97421_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	6.1e-20
WP_012461709.1|100165_100489_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_012461710.1|100526_101207_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_109489743.1|101454_101826_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_109489744.1|101849_102371_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_109489745.1|102374_104501_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	27.7	1.9e-59
WP_109489746.1|104761_106237_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109489747.1|107607_108474_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	4.2e-21
WP_011945048.1|111064_111286_-	cold-shock protein	NA	NA	NA	NA	NA
WP_109489748.1|113021_113888_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_109489749.1|114589_116446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045916981.1|116682_117054_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_109489750.1|117113_118151_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_109489751.1|118290_119229_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_109489752.1|119240_120827_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	41.2	2.1e-10
WP_109489753.1|121019_122441_-|terminase	phage terminase large subunit	terminase	A0A088FB00	Idiomarinaceae_phage	33.8	7.8e-57
WP_012461724.1|122770_123394_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_109489754.1|123393_123954_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_109489755.1|123963_125064_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_155379015.1|125111_125252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045917935.1|125955_126750_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_109227687.1|127917_128229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227266.1|128441_129312_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	33.8	6.1e-20
WP_162562848.1|129374_129548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489756.1|130480_131029_-	cytochrome c family protein	NA	NA	NA	NA	NA
WP_109489757.1|131277_132237_+	paraslipin	NA	S4VT23	Pandoravirus	26.4	2.8e-10
WP_109489758.1|132617_133504_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.8	2.4e-19
WP_045919379.1|137320_138346_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_045919380.1|138524_139580_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_045914761.1|139603_140470_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_109489759.1|140487_141888_+|protease	DegP-like serine protease TSA47	protease	W5SAB9	Pithovirus	31.1	1.2e-06
WP_109227262.1|142103_142718_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_109489760.1|142984_145768_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	28.9	1.4e-97
WP_109489761.1|145966_146983_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.7	2.5e-17
WP_045912337.1|146979_147885_+	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.7	8.8e-30
WP_109489763.1|149204_151571_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	33.7	6.2e-91
WP_109489764.1|151663_152620_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_109227256.1|152839_153334_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_109227255.1|153503_156035_+	AsmA-like C-terminal region-containing protein	NA	NA	NA	NA	NA
WP_109489765.1|156248_157172_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	27.8	6.7e-09
WP_109489766.1|157168_157714_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.2	9.1e-22
WP_109490411.1|159274_160369_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109489767.1|160420_161392_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_045918575.1|162665_162989_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109489768.1|163018_163885_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	2.5e-21
WP_109490412.1|164265_164958_-	TraU family protein	NA	NA	NA	NA	NA
WP_109489769.1|165002_165164_-	TraU family protein	NA	NA	NA	NA	NA
WP_012461928.1|165857_166481_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_109489770.1|166607_167399_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_162562893.1|167514_168303_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012461925.1|168331_169087_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.0	1.6e-21
WP_109489772.1|170049_171306_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918630.1|171324_172491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489773.1|172598_172958_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	250623	412370	1932116	transposase,tRNA,holin,integrase	Tupanvirus(16.13%)	108	386845:386869	418641:418665
WP_109489807.1|250623_253188_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9L2Y7	Tupanvirus	50.7	4.7e-246
WP_109489808.1|253177_256882_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	30.5	6.4e-127
WP_109489809.1|257200_259006_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.7	1.8e-42
WP_045912518.1|259181_259877_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	43.0	1.0e-17
WP_045912517.1|259879_260530_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011944369.1|260537_260837_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_109489810.1|260843_261476_+	ribonuclease D	NA	K7XYU9	uncultured_Mediterranean_phage	33.2	3.1e-13
WP_045919348.1|262083_262680_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_045919349.1|262808_263564_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_109489811.1|263882_264750_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
WP_174182868.1|265267_266053_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011944364.1|266835_266970_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_109489812.1|266970_267510_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_109489813.1|267748_270241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489814.1|270989_272270_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.3	5.1e-108
WP_109234605.1|272303_275021_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	32.3	7.3e-104
WP_109489815.1|275119_275869_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_174182854.1|275996_276602_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012461876.1|276635_276860_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_045914999.1|278932_279379_+	helix-turn-helix transcriptional regulator	NA	K4K6E9	Caulobacter_phage	42.4	2.2e-13
WP_045918434.1|280104_281013_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_012461867.1|281036_281306_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_045918433.1|281553_283770_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_045918432.1|283863_285093_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918431.1|285170_285866_-	DUF5394 family protein	NA	NA	NA	NA	NA
WP_045918430.1|286065_287322_-	MFS transporter	NA	NA	NA	NA	NA
WP_109489817.1|287416_287926_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_012461860.1|287943_288150_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_045918429.1|288320_288926_+	COQ9 family protein	NA	NA	NA	NA	NA
WP_109489818.1|288962_292166_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	34.5	1.4e-178
WP_045919130.1|292309_292894_+	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_045919131.1|293115_294378_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_045919132.1|294434_295595_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_045919133.1|295609_296488_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.5	3.3e-21
WP_109489819.1|296556_298233_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_109489820.1|298409_301238_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_108839887.1|301273_301522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489821.1|301518_302004_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_109489822.1|302049_302823_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_045912254.1|302874_303567_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	33.7	5.6e-16
WP_045912255.1|303643_304189_-	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
WP_012461847.1|304151_304700_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_109489823.1|304838_306416_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045913414.1|307139_307433_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_109489824.1|307438_308188_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_109490418.1|308268_309822_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109489825.1|309848_310436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489826.1|310527_310749_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109489827.1|310941_311985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489828.1|313012_313880_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	3.6e-20
WP_045918082.1|314173_315145_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109489829.1|315195_316290_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_045919106.1|319695_320151_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109489830.1|320220_321255_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	8.4e-85
WP_109489831.1|321376_321964_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	29.4	5.8e-06
WP_109489832.1|322052_322920_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
WP_162562855.1|323852_324596_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109489835.1|324822_325452_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	33.3	3.6e-14
WP_109490420.1|327255_328875_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_109489836.1|329869_330916_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	8.5e-85
WP_109489837.1|330983_331439_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109490421.1|331734_334536_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.2	1.6e-05
WP_045919435.1|334672_335371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182869.1|336179_337220_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109489838.1|337235_338204_-|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	29.5	1.7e-23
WP_174182870.1|338879_339182_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_162562856.1|339631_339793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919417.1|339817_340066_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_109489840.1|344077_344341_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045918538.1|344669_344927_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109489841.1|347141_347753_-	major outer membrane protein TSA22	NA	NA	NA	NA	NA
WP_109489842.1|347928_348732_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_109489843.1|348823_350251_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	8.2e-38
WP_109489844.1|350583_351945_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_012462009.1|352121_353045_+	AEC family transporter	NA	NA	NA	NA	NA
WP_045918542.1|353174_354137_+	thioredoxin-disulfide reductase	NA	A0A2K9L162	Tupanvirus	41.1	1.5e-56
WP_174182855.1|354157_355675_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	29.6	1.5e-50
WP_045919370.1|357918_358422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489845.1|358524_358827_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109489846.1|359395_360628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489847.1|361522_361915_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_109489848.1|362498_362675_-	reverse transcriptase N-terminal domain-containing protein	NA	A0A0U4J920	Pseudomonas_phage	50.9	4.5e-07
WP_045918138.1|364489_365278_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_109489849.1|365258_365972_-	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.0	1.5e-16
WP_012462161.1|366242_366803_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_109489850.1|366814_368494_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	39.1	8.4e-42
WP_109489851.1|369550_372169_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_109489852.1|372260_373736_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109489853.1|373794_375165_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.2	2.0e-41
WP_045913578.1|375385_376135_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_109489854.1|376238_376907_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_109489855.1|377045_377375_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012462169.1|377412_377682_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_109489856.1|377999_378867_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	3.2e-21
WP_012462182.1|379707_380256_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_045919193.1|380695_381211_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_045919192.1|381542_381947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490423.1|382957_383713_-|integrase	site-specific integrase	integrase	B6SD77	Bacteriophage	32.9	4.2e-17
386845:386869	attL	TTTATAGTCATTTACAATGAAGTTT	NA	NA	NA	NA
WP_109489858.1|391200_393453_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_109489859.1|393960_397614_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_108839859.1|397997_398078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918333.1|398446_399688_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	35.3	1.2e-66
WP_045918334.1|400603_400837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489860.1|403504_404422_-	S49 family peptidase	NA	E5AFY0	Erwinia_phage	31.1	4.3e-16
WP_045919065.1|404713_406063_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_045919068.1|406236_407073_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_045913658.1|407213_407555_+	DUF2610 domain-containing protein	NA	NA	NA	NA	NA
WP_109489861.1|411446_412370_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
418641:418665	attR	AAACTTCATTGTAAATGACTATAAA	NA	NA	NA	NA
>prophage 4
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	419975	509672	1932116	transposase,tRNA,integrase	Bodo_saltans_virus(38.89%)	54	477254:477313	507156:507293
WP_045918276.1|419975_421769_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_109489864.1|422036_426227_-	DNA-directed RNA polymerase subunit beta'	NA	A0A0N9QZ01	Chrysochromulina_ericina_virus	25.5	2.0e-52
WP_109489865.1|426341_430466_-	DNA-directed RNA polymerase subunit beta	NA	F2Y248	Organic_Lake_phycodnavirus	20.2	2.3e-24
WP_080946207.1|430781_431171_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_012462212.1|431192_431702_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_064591919.1|431705_432455_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_012462214.1|432458_432905_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_041621696.1|432944_433499_-	transcription termination/antitermination factor NusG	NA	NA	NA	NA	NA
WP_012462216.1|433522_433723_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_047220489.1|433978_435163_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.2	7.7e-34
WP_012462218.1|435334_436099_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_109489866.1|436225_436837_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_012462220.1|436925_437462_-	septation protein A	NA	NA	NA	NA	NA
WP_012462221.1|437465_438305_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_012462222.1|438333_438699_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_045918282.1|439164_440397_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_045918283.1|440585_441317_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	6.7e-28
WP_109489867.1|441309_441936_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_109489868.1|442914_443781_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	1.6e-20
WP_109489869.1|447886_448754_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	2.5e-21
WP_109489870.1|449717_450284_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.9	6.1e-13
WP_045918833.1|450386_450890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045913603.1|450893_451703_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.0	5.3e-18
WP_045918836.1|453561_454140_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	31.0	6.1e-08
WP_045918837.1|454258_455269_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.9	2.8e-85
WP_109489872.1|455336_455600_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109489873.1|455849_456302_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109489874.1|456325_456697_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109490424.1|457467_457764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918987.1|457822_458278_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045918995.1|460451_461168_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_045918992.1|461179_461740_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	41.1	2.4e-25
WP_109489875.1|461850_463155_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045918644.1|468166_469423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918645.1|469949_470525_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_109489876.1|471805_472840_+	ankyrin repeat domain-containing protein	NA	A0A068EGQ7	Pigeonpox_virus	28.6	1.1e-07
WP_012460767.1|475663_476113_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_109489877.1|476449_477317_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	6.5e-22
477254:477313	attL	ATAGTCCATCATCTACCGCTTTGAATATCTTCATTCTTAAATCATAACTGTATCTTCTTG	NA	NA	NA	NA
WP_174182871.1|478780_479875_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109489878.1|479926_480910_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109489725.1|482541_483687_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109489879.1|484859_485727_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	3.2e-21
WP_045919300.1|487513_487915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162562857.1|488007_489171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489877.1|491338_492206_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	6.5e-22
WP_012461740.1|493436_493643_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_109489881.1|493731_494067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918812.1|495053_499580_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_158296923.1|500697_500835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489882.1|503682_504018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490426.1|504070_504739_-|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	27.1	4.7e-12
WP_109489883.1|505244_506112_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.1e-21
WP_162562858.1|506144_506291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489884.1|508805_509672_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
507156:507293	attR	CAAGAAGATACAGTTATGATTTAAGAATGAAGATATTCAAAGCGGTAGATGATGGACTATAGCAATAACGTAGGAAATAGGTACAATCAAATAAACTTCATTAAGTGTGCTACAGCAATGCTAATATCTTTGAATTGA	NA	NA	NA	NA
>prophage 5
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	540599	761852	1932116	transposase,tRNA,integrase,protease	Bodo_saltans_virus(37.21%)	155	539562:539621	760863:760890
539562:539621	attL	TATAGCACGAACGTAGGAAATAGGTACATAATATGCCAATATGAAAAGAGTATAAAAAAA	NA	NA	NA	NA
WP_109489893.1|540599_541466_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	3.2e-21
539562:539621	attL	TATAGCACGAACGTAGGAAATAGGTACATAATATGCCAATATGAAAAGAGTATAAAAAAA	NA	NA	NA	NA
WP_174182856.1|543158_544478_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	25.1	6.9e-15
539562:539621	attL	TATAGCACGAACGTAGGAAATAGGTACATAATATGCCAATATGAAAAGAGTATAAAAAAA	NA	NA	NA	NA
WP_045916792.1|544533_544869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918733.1|544868_545183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919476.1|545416_545893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182873.1|546137_546320_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_045919475.1|546319_546649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489894.1|547323_548190_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.4	7.2e-21
WP_109489895.1|549172_549649_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_174182874.1|549823_550408_+|integrase	tyrosine-type recombinase/integrase	integrase	B6SD77	Bacteriophage	35.9	9.8e-14
WP_045918504.1|550869_551187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919156.1|551398_551728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919157.1|552980_553970_-	ankyrin repeat domain-containing protein	NA	A0A1V0QGP6	Shearwaterpox_virus	28.0	1.1e-09
WP_011944475.1|557930_558056_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_109489896.1|558414_559281_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
558343:558896	attR	TATAGCACGAACGTAGGAAATAGGTACATAATATGCCAATATGAAAAGAGTATAAAAAAAAATAGATAAATAATGGCAAGAAGATACAGTTATGATTTAAGAATGAAGATATTCAAAGCGGTAGATGATGGACTATCAATTGTTAAAGCATGTAAAATATTCAATATAAGTCGTAATACGATATATAGATGGAAACATCTTAAAAGGGAAACAGGAGATATTAAAGCAAAACCTTATGGCCCAGCCAAAGGTTATAATGCAAAAATAGATCTCAAAGAATTTGAGGAGTTAATTATCAATCATCATGATAAAACATCTAAAGAATTAAGTATTATACTAGGTAATAGATTACAAAGAACTAGAATAAATTATTATAGAAAACTACTAGGATACACTTATAAAAAAAACTCATTTTCATCCCAAAAGGGATACTGTGTTAAGGGATGAATTTATAGAGAAGATAAAGCAAATTTCTAAAGAAAATCTAGTATTTATTGATGAGTCAGGAATAGAGGATAATGCTTGTAGAGAATATGGATGGAGTATAAAAGGTA	NA	NA	NA	NA
WP_109489898.1|560077_560404_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.7	1.5e-16
558343:558896	attR	TATAGCACGAACGTAGGAAATAGGTACATAATATGCCAATATGAAAAGAGTATAAAAAAAAATAGATAAATAATGGCAAGAAGATACAGTTATGATTTAAGAATGAAGATATTCAAAGCGGTAGATGATGGACTATCAATTGTTAAAGCATGTAAAATATTCAATATAAGTCGTAATACGATATATAGATGGAAACATCTTAAAAGGGAAACAGGAGATATTAAAGCAAAACCTTATGGCCCAGCCAAAGGTTATAATGCAAAAATAGATCTCAAAGAATTTGAGGAGTTAATTATCAATCATCATGATAAAACATCTAAAGAATTAAGTATTATACTAGGTAATAGATTACAAAGAACTAGAATAAATTATTATAGAAAACTACTAGGATACACTTATAAAAAAAACTCATTTTCATCCCAAAAGGGATACTGTGTTAAGGGATGAATTTATAGAGAAGATAAAGCAAATTTCTAAAGAAAATCTAGTATTTATTGATGAGTCAGGAATAGAGGATAATGCTTGTAGAGAATATGGATGGAGTATAAAAGGTA	NA	NA	NA	NA
WP_109489899.1|560426_562745_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
558343:558896	attR	TATAGCACGAACGTAGGAAATAGGTACATAATATGCCAATATGAAAAGAGTATAAAAAAAAATAGATAAATAATGGCAAGAAGATACAGTTATGATTTAAGAATGAAGATATTCAAAGCGGTAGATGATGGACTATCAATTGTTAAAGCATGTAAAATATTCAATATAAGTCGTAATACGATATATAGATGGAAACATCTTAAAAGGGAAACAGGAGATATTAAAGCAAAACCTTATGGCCCAGCCAAAGGTTATAATGCAAAAATAGATCTCAAAGAATTTGAGGAGTTAATTATCAATCATCATGATAAAACATCTAAAGAATTAAGTATTATACTAGGTAATAGATTACAAAGAACTAGAATAAATTATTATAGAAAACTACTAGGATACACTTATAAAAAAAACTCATTTTCATCCCAAAAGGGATACTGTGTTAAGGGATGAATTTATAGAGAAGATAAAGCAAATTTCTAAAGAAAATCTAGTATTTATTGATGAGTCAGGAATAGAGGATAATGCTTGTAGAGAATATGGATGGAGTATAAAAGGTA	NA	NA	NA	NA
WP_064591171.1|562757_563819_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_109489900.1|563928_565278_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_109489901.1|565337_566159_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_109489902.1|566277_567153_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045913142.1|567335_567644_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_109489903.1|568179_569076_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109489904.1|569072_570281_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	K4JS34	Caulobacter_phage	31.2	6.1e-34
WP_109490428.1|570333_571533_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_109489905.1|571708_575176_-	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	28.1	5.3e-06
WP_109489906.1|575188_575680_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_109489907.1|575743_576595_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_109489908.1|576599_577403_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109489909.1|577828_578356_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_045919263.1|579361_579568_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_045919264.1|579664_580030_+	membrane protein	NA	NA	NA	NA	NA
WP_045919265.1|580409_581330_-	GTPase Era	NA	NA	NA	NA	NA
WP_045919266.1|581326_582349_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_045918130.1|582553_583633_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_109489910.1|584397_585264_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.3	2.7e-20
WP_109489911.1|586263_591183_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_109489912.1|591264_592608_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_109489913.1|592633_593572_+	tyrosine recombinase XerC	NA	A0A0K0N6I5	Gordonia_phage	34.9	2.5e-11
WP_045912215.1|593606_594038_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_012462271.1|594127_594655_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	49.7	1.6e-39
WP_109489914.1|594678_595551_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_109489915.1|595534_596473_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_162562860.1|596893_597187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045919011.1|597466_600055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919012.1|600660_600942_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109489917.1|600938_601298_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_162562861.1|602482_602641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489919.1|602874_603741_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	2.1e-20
WP_109489920.1|605207_606075_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	1.0e-19
WP_109489921.1|607265_607967_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_109489922.1|607985_608771_-	extragenic suppressor protein SuhB	NA	NA	NA	NA	NA
WP_109489923.1|608767_609337_-	elongation factor P	NA	NA	NA	NA	NA
WP_012460731.1|609542_610796_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.6	2.0e-120
WP_012460730.1|611023_612325_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012460729.1|612338_612632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045913361.1|612645_613866_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_109489924.1|613946_614963_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109489925.1|615237_617691_+	virB4 protein precursor	NA	NA	NA	NA	NA
WP_109489926.1|617690_622208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489927.1|623087_623954_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	1.2e-20
WP_109489928.1|627542_629279_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.8	1.3e-40
WP_109489929.1|629262_629595_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_109489930.1|630510_634635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489931.1|637252_637636_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_045918884.1|637666_638056_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_045918885.1|638247_640038_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_045918888.1|640072_640858_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_109489933.1|641590_642457_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.0	1.9e-21
WP_174182849.1|643508_644219_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_174182850.1|644275_645058_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_109489934.1|645086_646742_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109489935.1|646928_648023_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109489936.1|648074_649082_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109489937.1|650919_651786_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.7	4.2e-21
WP_162562862.1|652049_652208_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_012460929.1|653257_653593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489938.1|653840_654708_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
WP_109489939.1|656694_656844_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109489940.1|656844_657712_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	6.5e-22
WP_045919388.1|657711_658377_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_045918992.1|658388_658949_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	41.1	2.4e-25
WP_045919493.1|659059_659956_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045919203.1|663013_663343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174182875.1|663342_663525_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_109490174.1|663621_663744_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_045919526.1|663793_664246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919061.1|664242_664794_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109489882.1|664793_665129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490426.1|665181_665850_-|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	27.1	4.7e-12
WP_045919057.1|667777_669061_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109489941.1|669713_670580_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	2.5e-21
WP_109489942.1|674387_676316_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_109489943.1|676361_678260_-	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_045917989.1|678409_679330_+	DMT family transporter	NA	NA	NA	NA	NA
WP_045916875.1|679367_680723_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_045917990.1|680722_681295_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_109489944.1|681308_681800_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_109489945.1|682044_682767_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_109489946.1|682761_683247_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109489947.1|683580_684510_-	site-specific tyrosine recombinase XerD	NA	S5W9T9	Leptospira_phage	29.3	6.5e-20
WP_109489948.1|684853_686227_+	TolC family protein	NA	NA	NA	NA	NA
WP_109489949.1|686271_686844_+	DUF2497 domain-containing protein	NA	NA	NA	NA	NA
WP_109489950.1|686845_688675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918006.1|688717_689482_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_012460802.1|689478_689853_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_045918000.1|689879_692072_+	ATP-dependent RecD-like DNA helicase	NA	A0A0H3UZA5	Geobacillus_virus	27.1	3.1e-52
WP_109489951.1|692096_692964_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.4e-21
WP_109489952.1|693597_694053_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_047220525.1|694141_694717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489953.1|695390_696257_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	1.6e-20
WP_045919614.1|696796_697735_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	60.9	1.3e-84
WP_045919449.1|697856_698432_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	2.3e-07
WP_045919615.1|698532_699390_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045918311.1|700924_702145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489954.1|702502_703369_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.4e-21
WP_109489955.1|704370_706143_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	35.8	4.3e-97
WP_109489956.1|706139_708239_-	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	36.3	3.4e-101
WP_174182876.1|708307_708763_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_045912615.1|708809_709727_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_045919126.1|710006_710819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011945017.1|711921_712470_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	37.8	2.7e-05
WP_045914701.1|712528_712882_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_045919125.1|712957_713596_+	endonuclease III	NA	NA	NA	NA	NA
WP_109489957.1|713592_714225_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_109489958.1|714543_718017_+	acyl-[ACP]--phospholipid O-acyltransferase	NA	NA	NA	NA	NA
WP_174182856.1|721101_722421_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	25.1	6.9e-15
WP_045916792.1|722476_722812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919142.1|724356_724803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489959.1|725304_725631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489960.1|725670_727005_+	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_045918856.1|727004_727334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919231.1|729210_729417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182857.1|729417_730395_+	TraU family protein	NA	NA	NA	NA	NA
WP_109489961.1|730417_730807_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109489962.1|730803_731904_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_041621750.1|731861_732497_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_109489963.1|735730_736762_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109489965.1|738536_738974_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109489726.1|739184_740153_+|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_109489966.1|740168_740729_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109489967.1|740780_741875_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109489968.1|745315_745771_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109489969.1|745838_746825_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	1.0e-84
WP_109489970.1|746943_747534_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	38.8	2.6e-06
WP_109489971.1|747575_748070_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045919443.1|749912_750176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919371.1|750543_751353_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.0	5.3e-18
WP_045919370.1|751356_751860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489972.1|751962_752529_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.3	6.1e-13
WP_045919512.1|752826_754275_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.5	5.7e-71
WP_045918669.1|754283_755999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918667.1|757974_758355_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	8.9e-08
WP_109489973.1|758351_759914_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_109489974.1|760985_761852_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	4.2e-21
>prophage 6
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	799489	867354	1932116	transposase,tRNA,integrase	Bodo_saltans_virus(23.08%)	49	845788:845809	865086:865107
WP_109489988.1|799489_800357_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	3.2e-21
WP_045918108.1|800670_801423_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_109489989.1|801434_803207_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012461557.1|803371_803716_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	34.3	3.4e-14
WP_109489990.1|803724_805149_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_109489991.1|805347_808014_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	37.9	1.4e-70
WP_045918111.1|808146_809760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489992.1|809761_810415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489993.1|810404_811295_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_045912384.1|811309_812848_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_109489994.1|812891_813437_-	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
WP_045912386.1|813531_813978_-	dUTP diphosphatase	NA	A0A2R8FFV2	Cedratvirus	55.5	2.6e-35
WP_109489995.1|814144_814648_-	translation initiation factor IF-3	NA	A0A2C9CXP5	Yersinia_phage	26.7	4.2e-05
WP_109489996.1|814690_816643_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.0	1.2e-119
WP_109489997.1|816894_818235_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_109489998.1|818337_819369_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_109489999.1|819617_822257_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_109490000.1|822749_824981_-	AAA family ATPase	NA	A0A2R8FE73	Brazilian_cedratvirus	25.7	4.6e-11
WP_011944565.1|826385_826871_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_045918118.1|827990_828203_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109490001.1|831123_831990_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	2.9e-22
WP_109490432.1|832794_833931_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_109490433.1|833951_834764_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_109490002.1|834774_835749_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_109490003.1|835726_836638_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_162562866.1|836606_838079_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_045918268.1|838282_839020_-	type-specific antigen TSA56	NA	NA	NA	NA	NA
WP_045918267.1|839247_840849_-	type-specific antigen TSA56	NA	NA	NA	NA	NA
WP_109490005.1|841394_842273_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_109490006.1|842265_844317_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_109490007.1|844294_845263_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	33.8	2.1e-37
845788:845809	attL	TAGATAAGTAACTAGCTTTTTT	NA	NA	NA	NA
WP_109490008.1|847615_847789_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109490009.1|848976_849654_+	DUF2659 family protein	NA	NA	NA	NA	NA
WP_109490010.1|849713_851066_+	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_109490011.1|851984_852851_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	5.5e-21
WP_045919236.1|853696_854836_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	27.0	3.4e-18
WP_045919235.1|854838_855309_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_045913241.1|855376_855712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919234.1|855711_856290_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109489959.1|856395_856722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109489960.1|856761_858096_+	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_045918856.1|858095_858425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490012.1|858405_860898_+	TraC family protein	NA	NA	NA	NA	NA
WP_109490013.1|860894_861554_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_045919231.1|861637_861844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182853.1|861844_862822_+	TraU family protein	NA	NA	NA	NA	NA
WP_109489789.1|862908_863229_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_109489726.1|864037_865006_-|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_109489726.1|866385_867354_+|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
865086:865107	attR	AAAAAAGCTAGTTACTTATCTA	NA	NA	NA	NA
>prophage 7
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	877058	945054	1932116	transposase	Streptococcus_phage(15.0%)	53	NA	NA
WP_109490018.1|877058_877496_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109489726.1|877706_878675_+|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_109490019.1|878690_879251_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109490434.1|879302_880397_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109490020.1|881085_881955_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109490021.1|884198_884612_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109490022.1|884679_885642_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.5	1.0e-84
WP_109490023.1|885760_886339_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.2	2.3e-07
WP_109490024.1|886439_887297_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_109490025.1|887318_888047_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_109490026.1|888401_889118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490027.1|889644_890457_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	33.5	3.0e-29
WP_109490435.1|890460_891009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490028.1|891055_891700_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.8	1.3e-14
WP_045913638.1|891737_892313_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	29.2	4.6e-08
WP_109490029.1|892542_894249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918803.1|896744_897074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174182859.1|897073_897625_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_174182860.1|899245_899419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182861.1|899419_900397_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_045919229.1|900419_900803_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109490031.1|900799_902491_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_109490032.1|902487_903186_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109490033.1|903182_904484_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_109490034.1|907763_908711_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109489967.1|908762_909857_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109490035.1|913297_913753_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109490036.1|913820_914819_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	65.7	4.3e-86
WP_045918906.1|914937_915516_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	29.6	1.3e-05
WP_045919371.1|917375_918185_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.0	5.3e-18
WP_109490038.1|918188_918692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489972.1|918794_919361_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.3	6.1e-13
WP_045919512.1|919658_921107_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.5	5.7e-71
WP_045912460.1|924038_924563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011944708.1|924992_925151_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_109490437.1|925669_926659_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_109490039.1|926678_927056_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_109490040.1|927079_927409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045914482.1|927580_928321_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_109490041.1|928653_929052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490042.1|929069_931208_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	35.6	1.4e-09
WP_109490043.1|931218_931614_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_109490044.1|931750_932618_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	5.0e-22
WP_012460965.1|933711_935379_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	53.1	1.4e-142
WP_045914486.1|935451_935736_-	co-chaperone GroES	NA	A0A221S4E4	uncultured_virus	29.2	8.1e-06
WP_162562867.1|935976_936201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918817.1|936354_936585_-	reverse transcriptase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045918816.1|936670_937843_+	ankyrin repeat domain-containing protein	NA	Q6VZB8	Canarypox_virus	27.7	1.5e-05
WP_045918815.1|938046_938913_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	8.5e-22
WP_045918814.1|939281_940736_-	replicative DNA helicase	NA	A0A218KST2	Xenohaliotis_phage	34.4	1.5e-63
WP_045918829.1|941480_942992_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.6	9.0e-27
WP_011944696.1|943326_943677_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_109489988.1|944186_945054_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	3.2e-21
>prophage 8
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	949230	1024141	1932116	transposase,tRNA,integrase	Bodo_saltans_virus(21.43%)	57	975443:975502	980759:981738
WP_109489726.1|949230_950199_-|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_045919500.1|955110_955611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490047.1|956644_957512_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.8	6.5e-22
WP_109490048.1|957579_958578_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_109490049.1|958549_959857_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_045919401.1|960152_960608_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045914886.1|960649_961435_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.5	2.0e-17
WP_109489982.1|961686_962554_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	5.5e-21
WP_045919404.1|964256_964442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045912900.1|965929_966319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490050.1|967707_968310_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_109490051.1|968350_969505_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	33.8	1.2e-23
WP_108883745.1|969944_970061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490052.1|971191_972967_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	1.3e-69
WP_109490053.1|972950_974795_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	29.7	1.9e-34
975443:975502	attL	TAAAGCTACAAAGACATATCAAATATAAGGGAGAAGAAAAGTTAATTTTTATTAACTTTT	NA	NA	NA	NA
WP_109489895.1|975861_976338_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_174182874.1|976512_977097_+|integrase	tyrosine-type recombinase/integrase	integrase	B6SD77	Bacteriophage	35.9	9.8e-14
WP_045918504.1|977558_977876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919215.1|978087_978294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490054.1|978361_979228_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.3	3.6e-20
WP_174182877.1|979253_979838_-|integrase	tyrosine-type recombinase/integrase	integrase	B6SD77	Bacteriophage	34.0	3.6e-16
WP_109489895.1|979922_980399_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_109490055.1|981027_984465_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.6	1.7e-09
980759:981738	attR	AAAAGTTAATAAAAATTAACTTTTCTTCTCCCTTATATTTGATATGTCTTTGTAGCTTTACCTATAGCACATCTTATTGATTATAAGATGAAGCTTAAAGCATAAGAACGAGCCATAACTTACTTTTACCAATTTTAGAAATTTTGTTAAAAACTCTATTGCTTGAGGTACATTTATTATGACAAATTGCTAACTTTGTAGAATTGATGTAATATATACTTTTCAAAAAGCCTATCTGAACTCTAATAGCTAACATAAAAGATGGATATCTAAGGGAGATAAGAATAAGGAAGGGGAATAATTGTTTGCTTAAGGTAGTAGTTGATGACATTACGAAGCTCATTATAGGTATAAGGTTTTTCAATGAAGGCTACTACTCCCATAGAATAAAGCAGGTTTTTAGTTTCATAGGTTTGGCTATAACCTGAAATAATAATAATAGGAATGCCATACATTTTTGTTACTGTATAAATTTCCTGCACAACTTGCTCTCCGCTTTTTTCAGGCATCACCATATCAAGTAATACCAAAGAGTACTGTAATGGATTTTCCTTAATCAACCTAACAGCTTCAAAAGCATTATTAACTGGCTCTGGAGTATATTGTTCAGCATAGATATCTAAAGATATCGCATCTAAAAAATTTTGATCATCATCAACTATTAAAATGCTTTTATTAACTCTAATATGATTTTCAAGCTCATTGAGAGAATTAATAGAGTTGCATTCATAACCAAATCCTTTTAATAATTTTGCTATTCTGTCTTTATATATTTTACCAAAAACCTCACTTTTACTATAAACAGCTTTATTGAAGCCGCCTTCTGGCTGTCGTAATGGTAATCTAAAAGTAAATTTGCTTCCTCTGTTATTAGGTCGATTCTCTGCCCAGATTTCACCATGATGTGCTAATATAATTTCTTTAGCGAGTGTTAGCCCTAACCCACGGCCACAAGCCTTAGATTTAGTTCTGCTACTTTC	NA	NA	NA	NA
WP_109490056.1|984756_984963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109490057.1|985014_985296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109234702.1|985921_987121_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_109490058.1|987514_989650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109227415.1|989894_990512_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011944917.1|990511_991489_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.3	6.2e-05
WP_045914419.1|991670_992495_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_109490059.1|992887_993226_-	YraN family protein	NA	NA	NA	NA	NA
WP_109490060.1|993292_994594_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.7	1.0e-31
WP_109490061.1|994885_996364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045912227.1|996369_997647_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_109490062.1|997646_1000538_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_109227421.1|1000578_1001220_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	30.7	7.2e-26
WP_064591350.1|1002432_1003701_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_109490063.1|1003690_1005553_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_109490064.1|1005721_1005850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012461497.1|1009854_1010085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490065.1|1010289_1010661_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_011944977.1|1010672_1011188_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_045918691.1|1011198_1011789_+	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_045918690.1|1011800_1012991_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_109490066.1|1012987_1013542_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_109490067.1|1013559_1014828_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_109490068.1|1015124_1015838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490438.1|1016135_1016417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109490069.1|1016968_1018468_+	NTP/NDP exchange transporter	NA	NA	NA	NA	NA
WP_109490070.1|1018711_1019068_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_109490439.1|1019130_1019499_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_045912552.1|1019672_1020152_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_109490071.1|1020207_1021176_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_109490072.1|1021203_1021542_-	DUF167 domain-containing protein	NA	NA	NA	NA	NA
WP_109490073.1|1021694_1022435_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_109490074.1|1022421_1023288_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_109490075.1|1023289_1024141_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1030557	1120788	1932116	transposase,tRNA,integrase	Bodo_saltans_virus(52.63%)	58	1027167:1027226	1113777:1113885
1027167:1027226	attL	TCAAAATTATTGCTGACAAATATCGAAATAGACGTAAAAGATTCTCTCTTAGATTTAATT	NA	NA	NA	NA
WP_045918580.1|1030557_1030812_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045918579.1|1030924_1031125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490078.1|1032167_1033034_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	4.2e-21
WP_045918578.1|1033031_1033466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918577.1|1034558_1034738_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_109235163.1|1035184_1035829_-	SCO family protein	NA	NA	NA	NA	NA
WP_109490080.1|1038016_1038883_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	8.5e-22
WP_012461396.1|1040204_1040375_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_012461397.1|1040383_1040707_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_109490081.1|1041842_1042709_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	5.0e-22
WP_109490082.1|1042947_1043121_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012461400.1|1045465_1045831_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_011944543.1|1045850_1046057_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_045913593.1|1046496_1048389_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	30.9	2.1e-89
WP_012461403.1|1048551_1049718_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_109490083.1|1049869_1051360_+	trigger factor	NA	NA	NA	NA	NA
WP_109490084.1|1051856_1053527_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	8.1e-45
WP_045918515.1|1053635_1054385_-	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	27.5	1.2e-11
WP_011944537.1|1054678_1055035_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_045918523.1|1055109_1055391_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_045918516.1|1055434_1055962_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_045918517.1|1056115_1057591_+	NTP/NDP exchange transporter	NA	NA	NA	NA	NA
WP_045918524.1|1058997_1059468_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_045918518.1|1059476_1059902_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_109489856.1|1061093_1061960_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	3.2e-21
WP_109490087.1|1064558_1065426_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.8	4.2e-21
WP_045914191.1|1066361_1067705_+	DUF2748 family protein	NA	NA	NA	NA	NA
WP_109490088.1|1067939_1069049_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_109490089.1|1069407_1069647_+	propionyl-CoA carboxylase beta chain precursor	NA	NA	NA	NA	NA
WP_109489737.1|1069750_1070618_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.4e-21
WP_045918630.1|1071706_1072873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489772.1|1072891_1074148_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109490440.1|1075418_1076105_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_109490090.1|1076101_1076800_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109490091.1|1078099_1078591_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109489838.1|1080066_1081035_+|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	29.5	1.7e-23
WP_174182862.1|1081688_1082102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919656.1|1084402_1084864_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045919657.1|1084906_1085635_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109490441.1|1086745_1087036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490092.1|1087244_1088183_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	61.2	1.7e-84
WP_045918906.1|1088301_1088880_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	29.6	1.3e-05
WP_109490093.1|1091286_1092154_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	2.1e-20
WP_045919222.1|1092914_1093733_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	33.5	1.4e-29
WP_109490094.1|1093736_1094240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490095.1|1095903_1096771_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	9.4e-21
WP_109490096.1|1097994_1099140_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109490097.1|1099145_1100900_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109490098.1|1100909_1101905_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109490442.1|1101956_1103051_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109490099.1|1104883_1105681_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_045915368.1|1107981_1108437_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045918904.1|1108447_1109296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918905.1|1110027_1111014_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	65.7	5.6e-86
WP_109490100.1|1112848_1113715_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	3.8e-22
WP_109490101.1|1114101_1117536_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.6	1.3e-09
1113777:1113885	attR	TCAAAATTATTGCTGACAAATATCGAAATAGACGTAAAAGATTCTCTCTTAGATTTAATTTGATCTCTGGCATTTATAATTTTGAACTACCTTAACCAGTTTCGAAAGA	NA	NA	NA	NA
WP_109490102.1|1119288_1119837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490103.1|1119921_1120788_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
>prophage 10
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1130369	1200510	1932116	protease,integrase,head,transposase,tRNA,capsid,tail,portal	Bodo_saltans_virus(35.29%)	53	1184472:1184490	1203824:1203842
WP_109490107.1|1130369_1131560_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	37.1	3.1e-59
WP_045918368.1|1131578_1131845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011945001.1|1132243_1132483_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045918369.1|1132661_1134224_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_162562869.1|1134252_1134390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490108.1|1134423_1135290_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.4e-21
WP_045918370.1|1136845_1137532_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918371.1|1138009_1139071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162562870.1|1139260_1139494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490110.1|1141424_1142292_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	6.5e-22
WP_045918373.1|1143870_1145052_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	3.1e-14
WP_109490111.1|1147757_1148624_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	2.2e-22
WP_109490112.1|1148771_1150322_-	RAP domain-containing protein	NA	NA	NA	NA	NA
WP_162562871.1|1150617_1150827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490113.1|1151159_1152671_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_109490114.1|1153824_1155309_+	ankyrin repeat domain-containing protein	NA	A0A1V0S7Q4	Shearwaterpox_virus	26.0	7.0e-08
WP_109490443.1|1155406_1155550_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_109490115.1|1155775_1155967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490116.1|1156114_1157767_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.8	1.9e-46
WP_109227499.1|1157750_1158602_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041621781.1|1158942_1159803_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_109490117.1|1159799_1160729_+	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_109490118.1|1160815_1163257_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_109490119.1|1163253_1164288_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.7	2.4e-31
WP_011944826.1|1166745_1168551_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	32.6	3.3e-20
WP_109490121.1|1168702_1169806_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_109490122.1|1170126_1172616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162562873.1|1172945_1173122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490123.1|1173328_1174342_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_109490124.1|1174512_1175202_+	protein TolQ	NA	NA	NA	NA	NA
WP_011944822.1|1175207_1175666_+	protein TolR	NA	NA	NA	NA	NA
WP_109490125.1|1175652_1176882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490444.1|1176973_1177765_-	NAD kinase	NA	NA	NA	NA	NA
WP_109490126.1|1177781_1178816_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.6	6.5e-69
WP_045913688.1|1178839_1179349_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_064591391.1|1179570_1180239_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	47.5	3.2e-37
WP_109490127.1|1180992_1184430_+	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	35.8	6.6e-09
1184472:1184490	attL	GCTTTTTGAAAAGTATATA	NA	NA	NA	NA
WP_109490001.1|1185183_1186050_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	2.9e-22
WP_045919431.1|1186047_1186965_+|integrase	site-specific integrase	integrase	B6SD77	Bacteriophage	27.3	4.8e-15
WP_045916792.1|1187020_1187356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918733.1|1187355_1187670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919476.1|1187903_1188380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182873.1|1188624_1188807_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_045919475.1|1188806_1189136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490128.1|1189810_1190677_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	9.4e-21
WP_045919137.1|1191817_1192513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919138.1|1193345_1194611_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_109490129.1|1194812_1196174_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_109490130.1|1196257_1197229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918178.1|1197906_1198461_+|head,protease	HK97 family phage prohead protease	head,protease	I6S2W2	Marinomonas_phage	43.8	3.8e-23
WP_109490131.1|1198472_1199588_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	39.9	8.3e-54
WP_109490132.1|1199621_1200167_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_109490133.1|1200168_1200510_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
1203824:1203842	attR	TATATACTTTTCAAAAAGC	NA	NA	NA	NA
>prophage 11
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1213147	1279072	1932116	transposase,tRNA	Bodo_saltans_virus(44.44%)	46	NA	NA
WP_109490139.1|1213147_1214437_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.5	3.4e-99
WP_109490140.1|1214438_1215296_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_109490141.1|1215662_1217195_+	ADP/ATP carrier protein	NA	NA	NA	NA	NA
WP_109490142.1|1217247_1219917_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	4.6e-26
WP_109490143.1|1220000_1220927_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	7.6e-37
WP_162562874.1|1221060_1221267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490145.1|1221263_1222131_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	2.9e-22
WP_162562875.1|1222164_1222311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490146.1|1223114_1223291_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045919447.1|1223430_1223997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919446.1|1224249_1225242_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_045918632.1|1225304_1226576_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_109490147.1|1226866_1227734_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	8.5e-22
WP_012461495.1|1228403_1229249_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_109489772.1|1231427_1232684_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045918630.1|1232702_1233869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919440.1|1237279_1237714_-	CopD family protein	NA	NA	NA	NA	NA
WP_109490148.1|1237722_1238757_-	ferrochelatase	NA	NA	NA	NA	NA
WP_109490149.1|1238749_1239778_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_109490150.1|1241239_1242745_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_064643676.1|1243485_1243674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490151.1|1244101_1244969_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	5.0e-22
WP_011944758.1|1245831_1246071_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_045917880.1|1246124_1246406_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_109490152.1|1247485_1248838_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_045917881.1|1248895_1249252_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_109490153.1|1250009_1250882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045913507.1|1251095_1251761_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	31.2	1.1e-13
WP_109490154.1|1251894_1254744_+	cell surface protein	NA	NA	NA	NA	NA
WP_109490001.1|1256015_1256883_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	2.9e-22
WP_045913535.1|1257226_1258168_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_045917888.1|1258115_1258736_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_045919257.1|1258732_1260436_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_109490156.1|1263354_1264770_-	amino acid permease	NA	NA	NA	NA	NA
WP_162562876.1|1265207_1265456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174182863.1|1265639_1268045_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	2.7e-110
WP_109490158.1|1268177_1269038_+	TIGR01459 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_012461430.1|1269590_1269920_+	monovalent cation/H(+) antiporter subunit G	NA	NA	NA	NA	NA
WP_109490159.1|1269916_1270507_+	DUF4040 domain-containing protein	NA	NA	NA	NA	NA
WP_109490160.1|1270527_1270962_+	Na(+)/H(+) antiporter subunit B	NA	NA	NA	NA	NA
WP_080943541.1|1270939_1271341_+	cation:proton antiporter subunit C	NA	NA	NA	NA	NA
WP_109490161.1|1271333_1272824_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_045918998.1|1272833_1274306_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_045919000.1|1277179_1277539_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_045919001.1|1277519_1277846_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_045919002.1|1278088_1279072_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1297211	1482424	1932116	integrase,tRNA,transposase	Bodo_saltans_virus(24.32%)	116	1311945:1311975	1463723:1463754
WP_174182856.1|1297211_1298531_-|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	25.1	6.9e-15
WP_109490166.1|1300668_1301970_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_045918793.1|1301989_1302916_-	AEC family transporter	NA	NA	NA	NA	NA
WP_045918792.1|1303225_1303825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918791.1|1303888_1304272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490167.1|1305424_1305610_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_109490168.1|1305764_1306631_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	9.4e-21
WP_109490169.1|1309864_1311340_-	ankyrin repeat domain-containing protein	NA	Q70GU1	Fowlpox_virus	28.3	1.3e-06
1311945:1311975	attL	TATAGTCATTTACAATGAAGTTTGAGCATAG	NA	NA	NA	NA
WP_109490170.1|1312837_1313986_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
1311945:1311975	attL	TATAGTCATTTACAATGAAGTTTGAGCATAG	NA	NA	NA	NA
WP_109489789.1|1315926_1316247_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_109490172.1|1317547_1318363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490173.1|1319382_1319712_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_174182864.1|1319711_1319894_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_109490174.1|1319988_1320111_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_045913241.1|1320413_1320749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490445.1|1320801_1321230_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041621607.1|1322694_1323285_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	48.9	1.3e-26
WP_109490175.1|1324093_1324958_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	33.8	9.3e-21
WP_109490176.1|1326157_1328308_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	9.5e-107
WP_109490177.1|1329292_1330729_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.3	4.2e-50
WP_045918013.1|1330793_1332140_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	34.8	3.4e-09
WP_109490178.1|1332319_1334362_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.8	1.2e-98
WP_109490179.1|1334389_1335643_-	MFS transporter	NA	NA	NA	NA	NA
WP_109490180.1|1335679_1338244_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_109490181.1|1338236_1341509_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_109490182.1|1341562_1345450_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_109490183.1|1345471_1347919_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_109490184.1|1347918_1350336_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_012461380.1|1350346_1350634_-	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
WP_109490185.1|1350949_1352890_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_109490186.1|1353076_1354612_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	38.8	5.1e-94
WP_109490187.1|1354624_1355413_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012461376.1|1355971_1356838_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_045918026.1|1358612_1359278_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	40.2	4.2e-13
WP_109490189.1|1361218_1362086_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.1e-21
WP_155377128.1|1363920_1364088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162551756.1|1364235_1364370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490190.1|1365519_1366998_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.1	1.1e-37
WP_174182878.1|1367255_1368650_-	class II fumarate hydratase	NA	NA	NA	NA	NA
1367192:1367222	attR	CTATGCTCAAACTTCATTGTAAATGACTATA	NA	NA	NA	NA
WP_045914051.1|1368719_1369397_-	histidine phosphotransferase	NA	NA	NA	NA	NA
1367192:1367222	attR	CTATGCTCAAACTTCATTGTAAATGACTATA	NA	NA	NA	NA
WP_109490192.1|1370936_1371134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490193.1|1371386_1371749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182879.1|1373173_1373515_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_109490195.1|1373534_1375388_-	Fe-S protein assembly chaperone HscA	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.9	4.6e-73
WP_109490196.1|1375374_1375878_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_109490197.1|1375890_1376265_-	iron-sulfur cluster assembly accessory protein	NA	A0A1B1IT29	uncultured_Mediterranean_phage	33.3	4.9e-11
WP_012461222.1|1376277_1376703_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	73.8	2.4e-46
WP_045919507.1|1376742_1378014_-	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	39.3	1.0e-36
WP_109490198.1|1378028_1379312_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.2	3.9e-31
WP_012461225.1|1379323_1379770_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_109490199.1|1379973_1380675_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045912440.1|1380968_1382216_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_109490200.1|1382194_1383505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490201.1|1383489_1385241_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_162562877.1|1386490_1386652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918774.1|1387852_1388647_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_109490202.1|1388941_1389448_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_109490203.1|1389666_1390533_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	1.6e-20
WP_109490204.1|1392783_1393651_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	5.0e-22
WP_162562878.1|1393684_1393915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490205.1|1394031_1394970_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_109490206.1|1395011_1397009_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	33.9	2.6e-05
WP_045918235.1|1397529_1398297_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052692508.1|1398332_1399472_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_064591327.1|1399817_1401254_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_109490207.1|1401250_1401655_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_109490208.1|1402440_1403307_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	4.2e-21
WP_045919545.1|1405161_1406556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490209.1|1407604_1410832_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-21
WP_109490210.1|1411280_1412147_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.8	6.5e-22
WP_109490211.1|1412163_1412268_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_050897521.1|1412720_1412960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045919275.1|1413524_1414532_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_109490001.1|1415861_1416729_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	2.9e-22
WP_109490212.1|1417417_1418866_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	37.5	7.2e-74
WP_045918635.1|1418874_1419408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918636.1|1421124_1421316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918502.1|1421478_1421991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489895.1|1422938_1423415_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_174182874.1|1423589_1424174_+|integrase	tyrosine-type recombinase/integrase	integrase	B6SD77	Bacteriophage	35.9	9.8e-14
WP_045918504.1|1424635_1424953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490213.1|1424982_1425165_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_045918856.1|1425164_1425494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490164.1|1425474_1427958_+	TraC family protein	NA	NA	NA	NA	NA
WP_045919252.1|1427942_1428845_+	TraU family protein	NA	NA	NA	NA	NA
WP_045919253.1|1428931_1429252_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109490214.1|1431065_1432376_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109490215.1|1434591_1437255_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045919452.1|1437262_1438405_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045919050.1|1438572_1438920_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045919047.1|1438921_1439227_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109490216.1|1440178_1441102_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109490446.1|1441153_1442248_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_045917117.1|1447181_1447637_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_162562879.1|1447720_1447864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490217.1|1447960_1449163_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045919181.1|1449355_1450354_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	65.3	5.6e-86
WP_045919182.1|1450472_1451051_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.9	6.7e-07
WP_045917205.1|1453126_1453936_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	27.1	7.4e-20
WP_162562880.1|1453939_1454107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490219.1|1454109_1454487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490220.1|1454534_1455179_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.8	3.7e-14
WP_064613103.1|1455213_1455789_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9LAT2	Tupanvirus	31.9	1.0e-07
WP_109490221.1|1456021_1457458_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	36.9	1.0e-72
WP_109490222.1|1463242_1464109_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.8	1.0e-22
WP_080503910.1|1465532_1465619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174182865.1|1466293_1468918_+	pyruvate, phosphate dikinase	NA	A0A2I7QIA2	Vibrio_phage	32.8	1.2e-63
WP_109490224.1|1470129_1470804_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_109490225.1|1472154_1472883_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_011944645.1|1472938_1473163_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_045914383.1|1473170_1473668_+	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_162562881.1|1473680_1474145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490227.1|1476372_1478661_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	43.0	3.9e-74
WP_109490228.1|1479157_1480825_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.9	8.1e-45
WP_109490229.1|1480965_1481799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490230.1|1482190_1482424_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1502276	1576929	1932116	transposase,tRNA	Bodo_saltans_virus(54.55%)	46	NA	NA
WP_109489838.1|1502276_1503245_-|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	29.5	1.7e-23
WP_109490244.1|1503616_1504177_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_012460827.1|1504192_1505161_-|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	30.2	5.9e-24
WP_109490245.1|1505371_1505869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109490246.1|1507323_1508190_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	8.5e-22
WP_109490247.1|1508930_1511402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918894.1|1512640_1513930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490248.1|1514569_1516438_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_045915711.1|1516583_1517237_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	34.1	6.4e-22
WP_109490249.1|1517229_1518303_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_109490250.1|1518373_1519057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490251.1|1519065_1520430_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_109490252.1|1520495_1523165_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	30.7	2.7e-42
WP_109490448.1|1523595_1525047_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_045918931.1|1525867_1526698_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_045918932.1|1526853_1527207_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109490253.1|1528302_1529169_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	3.8e-22
WP_174182851.1|1529415_1529820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109490254.1|1530010_1530181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490255.1|1530789_1533585_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_045912757.1|1536426_1537815_-	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PKQ6	Moraxella_phage	25.9	6.5e-32
WP_109490256.1|1537811_1538585_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_045912755.1|1539121_1539604_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_045912754.1|1539619_1541122_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_109490257.1|1541371_1543912_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	27.6	6.1e-28
WP_045919027.1|1543942_1544305_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_109490258.1|1544593_1545461_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.4	4.7e-20
WP_011945086.1|1545542_1546412_-	RMD1 family protein	NA	NA	NA	NA	NA
WP_045918765.1|1548705_1549785_-	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_109490259.1|1550991_1551195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490260.1|1551208_1552076_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.1e-21
WP_045918762.1|1552667_1555151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490449.1|1555189_1557793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918360.1|1559882_1560506_-	CvpA family protein	NA	NA	NA	NA	NA
WP_045918361.1|1560502_1561075_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_109490261.1|1561247_1562990_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_109490262.1|1562970_1563468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490263.1|1563743_1564958_+	aspartate kinase	NA	NA	NA	NA	NA
WP_162562885.1|1566105_1566294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490264.1|1566748_1567828_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_109490265.1|1567831_1568959_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_109490266.1|1568965_1570384_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_109490267.1|1570466_1571093_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_109490268.1|1573536_1574404_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	2.5e-21
WP_045918438.1|1575556_1576252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490269.1|1576446_1576929_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1581111	1669812	1932116	transposase,tRNA,integrase,protease	Bodo_saltans_virus(31.25%)	58	1611903:1611961	1682411:1682469
WP_109490272.1|1581111_1582572_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_109490273.1|1582574_1584053_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_045913370.1|1584052_1584352_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_045918511.1|1584434_1586171_-	ribonuclease J	NA	NA	NA	NA	NA
WP_011944869.1|1586307_1587045_-	response regulator transcription factor	NA	A0A0K0PVG9	Roseobacter_phage	57.7	1.5e-14
WP_162562886.1|1590438_1590573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490275.1|1592806_1593673_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.1e-21
WP_108883788.1|1594128_1594308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011944868.1|1595140_1595935_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011944867.1|1597893_1598514_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	59.3	1.3e-59
WP_162562887.1|1599466_1599784_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_162562888.1|1599732_1600059_-|transposase	transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	40.6	1.9e-11
WP_109490275.1|1600055_1600923_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.1e-21
WP_162562849.1|1600955_1601114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490277.1|1601816_1603523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045913638.1|1603752_1604328_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	29.2	4.6e-08
WP_064612913.1|1604362_1605007_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	33.0	1.7e-14
WP_109490278.1|1605054_1605558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490279.1|1606924_1607641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490280.1|1607992_1608721_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_109490281.1|1608742_1609600_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_109490282.1|1609700_1610279_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	30.9	1.1e-06
WP_109490283.1|1610397_1611372_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.1	1.4e-84
1611903:1611961	attL	TTCAAAATTATTGCTGACAAATATCGAAATAGACGTAAAAGATTCGGTCTTAGATTTAA	NA	NA	NA	NA
WP_109490284.1|1612538_1615976_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.6	4.6e-10
WP_109490450.1|1617019_1618192_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045919563.1|1618605_1619061_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_109490421.1|1619356_1622158_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	24.2	1.6e-05
WP_045919435.1|1622294_1622993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490451.1|1623807_1624902_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109490285.1|1624953_1625937_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109490286.1|1625946_1627701_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109490287.1|1627706_1628846_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109490288.1|1628858_1631492_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_109490289.1|1632791_1633490_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_109490290.1|1633486_1635178_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_109490291.1|1635174_1635558_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_174182866.1|1635580_1636558_-	TraU family protein	NA	NA	NA	NA	NA
WP_012460825.1|1636558_1636762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490292.1|1636852_1637512_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109490293.1|1637508_1640001_-	TraC family protein	NA	NA	NA	NA	NA
WP_045915079.1|1639981_1640311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489719.1|1640310_1641633_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_109490294.1|1641671_1642004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918201.1|1642363_1642840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918202.1|1642836_1643388_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_109490295.1|1643810_1644566_-|integrase	site-specific integrase	integrase	B6SD77	Bacteriophage	26.9	2.8e-13
WP_045918206.1|1646143_1646611_+	single-stranded DNA-binding protein	NA	A0A1B1IVU7	uncultured_Mediterranean_phage	51.3	1.0e-37
WP_045918207.1|1646689_1647550_+	peptidase	NA	NA	NA	NA	NA
WP_109490296.1|1647753_1648617_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	34.4	4.6e-20
WP_109490297.1|1649161_1650652_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_109490298.1|1650751_1652119_-	magnesium transporter	NA	NA	NA	NA	NA
WP_109490452.1|1652304_1653324_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_109490299.1|1653343_1655863_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	38.5	3.7e-158
WP_109490300.1|1656479_1657211_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_109490301.1|1658700_1660164_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_174182880.1|1665309_1665807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490302.1|1665964_1666390_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109490303.1|1668945_1669812_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	2.9e-22
1682411:1682469	attR	TTAAATCTAAGACCGAATCTTTTACGTCTATTTCGATATTTGTCAGCAATAATTTTGAA	NA	NA	NA	NA
>prophage 15
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1685118	1713199	1932116	transposase	Bodo_saltans_virus(44.44%)	20	NA	NA
WP_109490311.1|1685118_1685985_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	9.4e-21
WP_109490312.1|1686770_1688039_+	ankyrin repeat domain-containing protein	NA	A0A068EG22	Pigeonpox_virus	33.7	3.5e-16
WP_109490313.1|1688729_1689596_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.4	6.5e-22
WP_109490314.1|1689785_1691546_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_109490315.1|1691650_1693123_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_109490316.1|1693263_1694841_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	24.4	1.2e-05
WP_109490317.1|1695510_1697559_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_109490318.1|1697728_1698514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490319.1|1698815_1699684_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.2e-20
WP_045918575.1|1699714_1700038_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_045919470.1|1701311_1701773_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_109489726.1|1701983_1702952_+|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_109490321.1|1702967_1703528_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109489967.1|1703579_1704674_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_109490322.1|1708673_1709600_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	62.0	2.0e-85
WP_045918922.1|1709720_1710326_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.1	3.7e-08
WP_045918923.1|1710367_1710862_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045919296.1|1710880_1711348_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_162562895.1|1711835_1712300_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_109490324.1|1712331_1713199_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	8.5e-22
>prophage 16
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1747416	1809059	1932116	transposase,tRNA	Bodo_saltans_virus(35.0%)	49	NA	NA
WP_109490341.1|1747416_1748283_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	33.8	4.2e-21
WP_045918951.1|1749332_1750526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045918946.1|1752730_1753354_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.4	2.7e-14
WP_109490342.1|1756082_1756325_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_045919371.1|1756450_1757260_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.0	5.3e-18
WP_045919370.1|1757263_1757767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489972.1|1757869_1758436_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	31.3	6.1e-13
WP_109490343.1|1760191_1761907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109489726.1|1762466_1763435_-|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_045919596.1|1763645_1763936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011945084.1|1764402_1764828_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	37.4	1.8e-17
WP_109490344.1|1766872_1767740_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	2.5e-21
WP_012461764.1|1767825_1768494_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_045919521.1|1769136_1769328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490455.1|1769586_1769874_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_045918094.1|1770753_1771230_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_045919522.1|1771252_1772524_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	22.4	1.3e-23
WP_012461767.1|1772526_1773012_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_109490345.1|1773016_1773379_-	NADH:ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_012461769.1|1773350_1773857_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	48.5	2.4e-32
WP_109490346.1|1773856_1774396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490347.1|1774524_1775346_-	DsbA family protein	NA	NA	NA	NA	NA
WP_109490348.1|1775474_1775795_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_109490349.1|1775799_1776510_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_109490350.1|1776502_1777234_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_109490351.1|1777232_1778063_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_109490352.1|1778459_1779327_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	9.4e-21
WP_162562897.1|1779366_1780062_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109489726.1|1780743_1781712_+|transposase	IS110-like element ISOt5 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	8.6e-23
WP_109490353.1|1782018_1783626_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109490354.1|1783615_1784155_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_109490355.1|1784380_1785247_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	7.2e-21
WP_109490356.1|1788660_1789554_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_045918797.1|1789550_1790219_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_045918796.1|1790230_1790791_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	41.1	5.3e-25
WP_109490357.1|1790900_1792307_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_174182867.1|1793750_1793930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174182882.1|1794110_1795457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045918831.1|1795697_1796273_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	29.2	1.0e-07
WP_045918832.1|1796307_1796952_+	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	32.2	1.8e-13
WP_045918833.1|1797054_1797558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045913641.1|1797561_1798371_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	26.0	4.1e-18
WP_109490359.1|1801263_1802130_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	7.2e-21
WP_109490360.1|1802995_1803934_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	34.6	2.4e-14
WP_109490361.1|1804045_1804435_+	DUF2660 domain-containing protein	NA	NA	NA	NA	NA
WP_109490362.1|1804541_1805408_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	1.7e-22
WP_109490363.1|1805786_1806167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490364.1|1806203_1807718_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_109490365.1|1808191_1809059_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	6.5e-22
>prophage 17
NZ_LS398547	Orientia tsutsugamushi isolate UT176 chromosome I	1932116	1835122	1895604	1932116	transposase,tRNA	Bodo_saltans_virus(45.0%)	39	NA	NA
WP_109490370.1|1835122_1835989_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.8	1.9e-21
WP_162562895.1|1836021_1836486_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045919296.1|1836973_1837441_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_045918923.1|1837459_1837954_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_045918922.1|1837995_1838601_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.1	3.7e-08
WP_045919297.1|1838721_1839648_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	59.4	2.6e-85
WP_109490371.1|1839988_1840855_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	5.5e-21
WP_162562891.1|1840956_1841307_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109490457.1|1841634_1844436_+	AAA family ATPase	NA	A0A2P0VMS9	Tetraselmis_virus	25.4	7.8e-08
WP_109490373.1|1846091_1846958_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	8.5e-22
WP_109490374.1|1847998_1848643_-	ankyrin repeat domain-containing protein	NA	A0A2K9L931	Tupanvirus	30.5	6.8e-08
WP_045918624.1|1848677_1849253_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A292GI44	Xanthomonas_phage	29.8	1.3e-07
WP_045918623.1|1852282_1852762_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_045918622.1|1852808_1853708_+	RNA polymerase sigma factor RpoH	NA	G8CLC7	Synechococcus_phage	26.7	2.7e-10
WP_045918621.1|1854391_1854931_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_109490376.1|1856040_1856907_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.4	1.4e-21
WP_109490377.1|1859082_1860570_-	ankyrin repeat domain-containing protein	NA	A0A0M3ZHP2	Turkeypox_virus	33.3	3.7e-09
WP_109490378.1|1862986_1863854_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
WP_109490379.1|1863894_1864701_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_109490380.1|1864855_1866019_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_109490381.1|1867235_1868102_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.4	7.9e-20
WP_109489938.1|1869976_1870843_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	1.9e-21
WP_109490382.1|1871690_1875128_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.6	7.8e-10
WP_109490383.1|1875868_1877425_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_045919651.1|1877598_1878495_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_045919652.1|1878727_1879948_+	MFS transporter	NA	NA	NA	NA	NA
WP_109490384.1|1881020_1882799_+	DUF1601 domain-containing protein	NA	NA	NA	NA	NA
WP_108883849.1|1882887_1883010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490385.1|1883325_1885194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109490386.1|1885762_1886776_-	serine/threonine dehydratase	NA	NA	NA	NA	NA
WP_162562899.1|1886913_1889265_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.0	3.5e-171
WP_064644301.1|1889328_1889979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109490388.1|1890108_1890855_-	ComF family protein	NA	NA	NA	NA	NA
WP_109490389.1|1890838_1891876_-|tRNA	tRNA dimethylallyltransferase	tRNA	NA	NA	NA	NA
WP_109490390.1|1891945_1892563_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	7.1e-23
WP_109490391.1|1892897_1893765_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.1	3.2e-21
WP_162562892.1|1893797_1893944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045919669.1|1894087_1894339_+	DUF2312 domain-containing protein	NA	A0A076YL00	Rhizobium_phage	52.0	6.7e-12
WP_109490359.1|1894736_1895604_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	28.8	7.2e-21
