The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS399318	Klebsiella pneumoniae isolate CNR48 chromosome CNR48	5138672	627784	637258	5138672	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023302125.1|627784_629506_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_023302126.1|629550_630252_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|630605_630824_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|630954_633234_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|633264_633582_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|633907_634129_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|634205_636146_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|636142_637258_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 2
NZ_LS399318	Klebsiella pneumoniae isolate CNR48 chromosome CNR48	5138672	1118867	1170251	5138672	head,tRNA,lysis,terminase,holin	Cronobacter_phage(27.66%)	73	NA	NA
WP_040181289.1|1118867_1119107_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_071854268.1|1119212_1120013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186451.1|1122098_1124576_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_040181295.1|1124562_1124958_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|1124954_1125425_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_023283377.1|1125424_1125901_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071854269.1|1126014_1126428_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|1126447_1126627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842809.1|1126667_1130108_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
WP_029884072.1|1130202_1130706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074160392.1|1130808_1131036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129693860.1|1131130_1131448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328739.1|1131499_1131820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048294323.1|1132302_1132776_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
WP_072061015.1|1132812_1133244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|1133254_1133620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049182521.1|1133616_1133922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178855.1|1134226_1134910_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_048294321.1|1134962_1135715_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
WP_048294319.1|1135783_1136176_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
WP_004151265.1|1136172_1136598_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_058842810.1|1136600_1136963_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_038434988.1|1136962_1137136_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058842811.1|1137135_1137516_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
WP_058842812.1|1137518_1137794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191540.1|1137804_1138899_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	2.2e-123
WP_058842813.1|1138910_1139339_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
WP_040186437.1|1139342_1140728_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
WP_049185996.1|1140800_1141151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064148479.1|1141250_1142264_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
WP_058842815.1|1142196_1143660_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
WP_048294304.1|1143672_1144971_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
WP_111778328.1|1144954_1145422_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.2	1.7e-56
WP_058842816.1|1145452_1146079_-	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
WP_058842820.1|1146928_1147387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087760209.1|1147820_1147958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842818.1|1147960_1148428_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
WP_004146527.1|1148424_1148955_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_004151282.1|1148957_1149206_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_048322094.1|1149633_1150158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322093.1|1150502_1151192_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_048322092.1|1151188_1151329_-	YlcG family protein	NA	NA	NA	NA	NA
WP_058842819.1|1151325_1151961_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.0	2.2e-80
WP_032431555.1|1151953_1152124_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_016530701.1|1152104_1152572_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_048322089.1|1152762_1153020_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
WP_032432693.1|1153348_1153546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322087.1|1153538_1153805_-	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
WP_048322086.1|1154816_1155335_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
WP_048322084.1|1155837_1156035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322083.1|1156027_1156291_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
WP_040181698.1|1156287_1156710_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_004218528.1|1156706_1157009_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181695.1|1157005_1157743_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_170324251.1|1157739_1158768_-	replication protein	NA	A5VW95	Enterobacteria_phage	80.8	1.5e-62
WP_040181694.1|1158764_1159562_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_004139615.1|1159647_1159869_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004178811.1|1159908_1160142_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|1160246_1160936_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_032434121.1|1161276_1161993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|1161983_1162529_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024622729.1|1162577_1162781_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
WP_074183191.1|1163090_1163216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|1163208_1163403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|1163492_1163777_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|1163793_1164540_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|1164536_1165160_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|1165188_1165716_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|1165712_1165931_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|1165932_1166268_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|1167739_1168606_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|1168607_1168820_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|1168865_1170251_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 3
NZ_LS399318	Klebsiella pneumoniae isolate CNR48 chromosome CNR48	5138672	3802894	3862082	5138672	head,portal,tRNA,terminase,integrase,tail,protease,holin,capsid	Klebsiella_phage(55.32%)	74	3825894:3825917	3865348:3865371
WP_004145598.1|3802894_3804313_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|3804364_3804757_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|3804760_3805114_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023301631.1|3805735_3807907_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|3807955_3809158_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|3809504_3810746_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004899719.1|3810803_3811157_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_023301632.1|3811287_3812280_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_023301633.1|3812460_3814122_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|3814118_3815354_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|3815617_3816583_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|3816636_3817374_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|3817385_3819083_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_004153200.1|3819081_3819195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409803.1|3819191_3819377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913372.1|3819465_3820680_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|3820750_3820822_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004185022.1|3821160_3822357_-	cyanate transporter	NA	NA	NA	NA	NA
WP_023301635.1|3822353_3822812_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	7.2e-12
WP_004149227.1|3822944_3823853_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023301636.1|3823862_3824744_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|3825110_3825593_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
3825894:3825917	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_064184927.1|3826111_3827281_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.5	1.1e-200
WP_064184926.1|3827313_3828252_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	31.7	5.8e-08
WP_077255880.1|3828267_3828453_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	2.4e-14
WP_064184925.1|3828460_3829069_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	82.4	4.8e-48
WP_004141386.1|3829065_3829278_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_064184924.1|3829277_3830018_-	hypothetical protein	NA	R9TPK2	Aeromonas_phage	97.3	2.5e-30
WP_048270910.1|3830295_3830706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064184923.1|3830833_3831619_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	8.1e-64
WP_040149782.1|3831618_3831918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705289.1|3832306_3832951_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_024176406.1|3833045_3833255_+	cell division protein	NA	NA	NA	NA	NA
WP_004213338.1|3833280_3833742_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|3833979_3834159_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_064184921.1|3834148_3835117_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	5.5e-86
WP_049006283.1|3835113_3835923_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	3.5e-110
WP_000779146.1|3835932_3836310_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_071854253.1|3836322_3837303_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_064184919.1|3837316_3837895_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	1.9e-49
WP_064184918.1|3838046_3838286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|3838455_3838755_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_064184917.1|3838751_3839291_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	3.1e-99
WP_064184916.1|3839287_3839635_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	5.7e-38
WP_064184915.1|3839631_3839907_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.2	2.1e-22
WP_052454910.1|3839857_3840055_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	84.5	7.3e-22
WP_106493672.1|3840210_3840633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184914.1|3840629_3841922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|3841998_3842244_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_042950192.1|3842310_3842532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042950190.1|3842588_3842879_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	1.7e-51
WP_004216880.1|3842891_3843101_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	87.0	2.6e-25
WP_064184913.1|3843222_3843657_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	99.3	2.4e-73
WP_004143904.1|3843666_3845199_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_017880221.1|3845201_3846479_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_077269009.1|3846484_3847165_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_064184946.1|3847176_3848340_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	7.7e-212
WP_133060710.1|3848376_3848619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|3848566_3848893_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|3848953_3849151_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_064184945.1|3849152_3849485_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	1.5e-56
WP_064184944.1|3849477_3850017_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	2.3e-94
WP_000561415.1|3850013_3850379_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|3850435_3850927_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004899623.1|3850970_3851354_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_004104224.1|3851356_3851620_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	91.9	3.0e-39
WP_133060711.1|3851678_3852056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184943.1|3852104_3854639_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.4	0.0e+00
WP_004899614.1|3854638_3855118_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_064184942.1|3855104_3855587_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	3.9e-85
WP_064184941.1|3855596_3855977_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.0	1.8e-69
WP_065802474.1|3855973_3859042_+	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
WP_040181868.1|3861087_3861888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074177881.1|3861899_3862082_+	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	88.9	1.5e-18
3865348:3865371	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 4
NZ_LS399318	Klebsiella pneumoniae isolate CNR48 chromosome CNR48	5138672	4087003	4093908	5138672	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|4087003_4087867_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|4087877_4088651_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|4088891_4089788_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|4090030_4091392_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|4091710_4092433_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|4092429_4093908_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_LS399318	Klebsiella pneumoniae isolate CNR48 chromosome CNR48	5138672	4363402	4432113	5138672	transposase,plate,lysis,terminase	Salmonella_phage(26.98%)	86	NA	NA
WP_004175494.1|4363402_4364698_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_074183181.1|4364709_4365519_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021312745.1|4365759_4367022_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_040181674.1|4367064_4367310_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_016529283.1|4367313_4367532_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_040181675.1|4367528_4367738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181676.1|4367734_4368040_-	hypothetical protein	NA	A0A1B3AZN4	Gordonia_phage	35.6	7.4e-05
WP_040181677.1|4368036_4368228_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	1.6e-13
WP_040181678.1|4368224_4368989_-	hypothetical protein	NA	Q71T76	Escherichia_phage	58.7	2.7e-72
WP_040181679.1|4369205_4369976_-	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_040181681.1|4369972_4370500_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_016529279.1|4370496_4370655_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181683.1|4370651_4371338_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_129693859.1|4371330_4371951_-	hypothetical protein	NA	A0A076GAP8	Staphylococcus_phage	43.8	5.5e-23
WP_040181685.1|4371947_4372793_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_040181687.1|4372808_4373093_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_004151303.1|4373182_4373377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165758635.1|4373369_4373528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181691.1|4373821_4374454_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.0	9.2e-34
WP_023284762.1|4374553_4374769_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_040181693.1|4374818_4375139_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	69.8	7.7e-37
WP_040181694.1|4375225_4376023_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_170324251.1|4376019_4377048_+	replication protein	NA	A5VW95	Enterobacteria_phage	80.8	1.5e-62
WP_040181695.1|4377044_4377782_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_004218528.1|4377778_4378081_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181698.1|4378077_4378500_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_040181701.1|4378496_4378757_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_004141386.1|4379288_4379501_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_087750241.1|4380129_4380543_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_040181178.1|4381043_4381499_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	4.0e-55
WP_040181180.1|4381498_4381669_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.7e-14
WP_040181182.1|4381661_4382300_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	68.4	1.2e-73
WP_040181184.1|4382296_4382437_+	YlcG family protein	NA	NA	NA	NA	NA
WP_040181186.1|4382433_4383243_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
WP_004146347.1|4384428_4384743_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_040181191.1|4384745_4385249_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_111778345.1|4385245_4385713_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	2.2e-56
WP_087749278.1|4385715_4385853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021441335.1|4386209_4386698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181195.1|4386648_4388049_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_039108763.1|4388286_4389738_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_025714257.1|4389793_4390342_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_025714258.1|4390387_4390582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181203.1|4390591_4391794_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_040181205.1|4391797_4392292_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_040181207.1|4392303_4393245_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	7.8e-138
WP_040181209.1|4393284_4393566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181211.1|4393534_4393954_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	1.1e-40
WP_040181213.1|4393950_4394457_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.2	2.4e-16
WP_023312779.1|4394456_4394843_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_004152176.1|4394937_4395378_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_040181215.1|4395381_4396527_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.2	6.3e-166
WP_023312781.1|4396536_4396980_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_040181217.1|4396983_4397403_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	8.8e-41
WP_016244729.1|4397444_4397597_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_040181220.1|4397586_4399506_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	72.3	3.0e-192
WP_016244727.1|4399505_4400105_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_074183180.1|4400180_4400408_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	54.7	1.7e-19
WP_040181225.1|4400410_4401442_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.0	3.5e-99
WP_087760196.1|4401542_4401776_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.6	8.9e-19
WP_040181227.1|4401814_4402321_+	hypothetical protein	NA	A0A0M3ULK2	Salmonella_phage	47.6	3.1e-32
WP_040181228.1|4402359_4403115_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	66.0	4.0e-84
WP_023312790.1|4403114_4403468_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.8e-50
WP_040181231.1|4403467_4404667_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.3	1.3e-161
WP_040181232.1|4404663_4405437_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
WP_023284799.1|4405436_4406210_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.0e-26
WP_013815099.1|4406278_4407247_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_111778346.1|4407294_4409274_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	28.4	8.1e-28
WP_072040613.1|4409283_4410084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181236.1|4410189_4410429_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	54.4	1.1e-16
WP_040181238.1|4410428_4410746_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.8e-22
WP_040181240.1|4411720_4412203_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|4412394_4413093_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|4413118_4413658_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|4413772_4414102_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_009307582.1|4414667_4416008_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004175498.1|4416004_4416658_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307583.1|4416661_4418359_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009307584.1|4418817_4421445_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_023342696.1|4421447_4423475_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_004148791.1|4423489_4424386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413757.1|4424878_4425286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029499423.1|4425311_4425569_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040181245.1|4425573_4426785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023301801.1|4426799_4430216_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_040181246.1|4430349_4432113_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 6
NZ_LS399318	Klebsiella pneumoniae isolate CNR48 chromosome CNR48	5138672	5103253	5114128	5138672		Escherichia_phage(85.71%)	8	NA	NA
WP_040182019.1|5103253_5106361_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|5106415_5107681_+	MFS transporter	NA	NA	NA	NA	NA
WP_040182017.1|5107711_5108800_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|5108886_5109147_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_002904004.1|5109444_5110305_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|5110325_5111087_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|5111348_5112251_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210516.1|5113507_5114128_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
