The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962951	Brucella melitensis isolate 1 chromosome 1	2117043	1040506	1050527	2117043	integrase,transposase	Brucella_phage(37.5%)	15	1035492:1035532	1050605:1050645
1035492:1035532	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040506_1041958_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042369_1043062_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_087932749.1|1043062_1043820_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044660_1044906_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044905_1045220_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045567_1045738_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046085_1046796_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047141_1047618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047640_1047916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047912_1048143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048139_1048844_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048893_1049097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049093_1049309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049311_1049515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049501_1050527_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050605:1050645	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962951	Brucella melitensis isolate 1 chromosome 1	2117043	1119552	1131464	2117043	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_080630759.1|1119552_1121880_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121998_1122340_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122499_1123366_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123414_1124713_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124761_1124947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125091_1125760_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125756_1126524_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126672_1127956_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128032_1128857_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128853_1129420_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129530_1129749_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129894_1130620_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130612_1131464_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962951	Brucella melitensis isolate 1 chromosome 1	2117043	1356152	1404553	2117043	portal,integrase,tail,protease	Paracoccus_phage(30.0%)	44	1346952:1346966	1360393:1360407
1346952:1346966	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356152_1357079_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_006136160.1|1358591_1358966_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359010_1359661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360315_1361086_+	YitT family protein	NA	NA	NA	NA	NA
1360393:1360407	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361145_1361403_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361672_1361912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361908_1362256_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362314_1363025_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363219_1363387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363383_1363551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363591_1365094_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365146_1366223_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366338_1368030_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368418_1369291_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369452_1370709_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370713_1371673_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371898_1374550_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374940_1377292_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_004683330.1|1377562_1379674_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379718_1382670_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382792_1384199_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004683323.1|1384195_1384903_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1384996_1386538_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_004683319.1|1386679_1387156_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387152_1389144_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389163_1389661_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389657_1390797_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390897_1391350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391443_1392754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392828_1393518_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393596_1393893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394054_1394261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101419832.1|1394325_1396983_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	4.6e-143
WP_006136169.1|1396999_1398187_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398190_1398625_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398621_1399497_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399493_1400126_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400128_1400674_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400678_1400849_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400892_1401234_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401230_1401644_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401694_1402072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402068_1403262_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403293_1404553_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
