The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962953	Brucella melitensis isolate 1 chromosome 1	2117003	1040526	1050547	2117003	integrase,transposase	Brucella_phage(37.5%)	15	1035524:1035564	1050625:1050665
1035524:1035564	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040526_1041978_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042389_1043082_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_080723468.1|1043082_1043840_-|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044680_1044926_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044925_1045240_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045587_1045758_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046105_1046816_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047161_1047638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047660_1047936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047932_1048163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048159_1048864_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048913_1049117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049113_1049329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049331_1049535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049521_1050547_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050625:1050665	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962953	Brucella melitensis isolate 1 chromosome 1	2117003	1119573	1131485	2117003	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119573_1121901_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122019_1122361_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122520_1123387_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123435_1124734_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124782_1124968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125112_1125781_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125777_1126545_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126693_1127977_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128053_1128878_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128874_1129441_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129551_1129770_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129915_1130641_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130633_1131485_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962953	Brucella melitensis isolate 1 chromosome 1	2117003	1356204	1468250	2117003	portal,integrase,transposase,protease,holin,tail	Paracoccus_phage(12.5%)	103	1351714:1351730	1434636:1434652
1351714:1351730	attL	CGGCGCAGGATGCGCCC	NA	NA	NA	NA
WP_004683363.1|1356204_1357131_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357493_1358627_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358644_1359019_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359063_1359714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360368_1361139_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|1361198_1361456_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361725_1361965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361961_1362309_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362367_1363078_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363272_1363440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363436_1363604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363644_1365147_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365199_1366276_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366391_1368083_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368471_1369344_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369505_1370762_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370766_1371726_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371951_1374603_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374993_1377345_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377615_1379727_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379771_1382723_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382845_1384252_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384248_1384956_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385049_1386591_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386732_1387209_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387205_1389197_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389216_1389714_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389710_1390850_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390950_1391403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391496_1392807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392881_1393571_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393649_1393946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394107_1394314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394378_1397036_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397052_1398240_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398243_1398678_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398674_1399550_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399546_1400179_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400181_1400727_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400731_1400902_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400945_1401287_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401283_1401697_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401747_1402125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402121_1403315_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403346_1404606_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963734.1|1404544_1405057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136183.1|1405396_1407571_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963732.1|1407577_1408189_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_004683287.1|1408181_1408724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006136186.1|1408921_1409980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963729.1|1409990_1410338_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_002971535.1|1410351_1411320_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_004686543.1|1411294_1413124_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_002963726.1|1413414_1413864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963725.1|1413943_1414369_+	SufE family protein	NA	NA	NA	NA	NA
WP_002967494.1|1414409_1415747_-	amidase	NA	NA	NA	NA	NA
WP_005969604.1|1415859_1416633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|1416629_1417085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136191.1|1417266_1417578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963720.1|1417785_1418214_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002967492.1|1418786_1420895_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963717.1|1421012_1421348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|1421519_1422119_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_006139491.1|1422995_1423238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963714.1|1423296_1424013_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002963713.1|1424210_1425722_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.4e-83
WP_002963712.1|1426057_1426420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686548.1|1426476_1427775_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004683264.1|1427771_1428449_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963709.1|1428604_1429597_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683261.1|1429657_1429888_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004686549.1|1429884_1430274_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_002967489.1|1430270_1430741_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_002963705.1|1430785_1431808_-	asparaginase	NA	NA	NA	NA	NA
WP_004683258.1|1431998_1432595_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004686551.1|1432597_1434280_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004686552.1|1434431_1435895_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
1434636:1434652	attR	GGGCGCATCCTGCGCCG	NA	NA	NA	NA
WP_004683253.1|1436433_1437003_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|1436984_1437428_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685498.1|1437690_1438722_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683247.1|1438754_1440206_+	xylulokinase	NA	NA	NA	NA	NA
WP_002966715.1|1440252_1441560_+	xylose isomerase	NA	NA	NA	NA	NA
WP_004683244.1|1441601_1442774_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004683241.1|1442781_1443834_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002969455.1|1443891_1444854_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683239.1|1444932_1445934_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969456.1|1448179_1449289_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002963690.1|1449371_1450544_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002963689.1|1450576_1452001_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_004685492.1|1452071_1453427_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_002975117.1|1454037_1454355_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087910421.1|1454251_1455015_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	6.3e-21
WP_005969645.1|1455178_1455733_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_077281774.1|1455775_1455928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006142162.1|1456685_1457804_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087910411.1|1458174_1458932_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	7.9e-16
WP_002963680.1|1461063_1462152_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963679.1|1462159_1463263_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_004683211.1|1463277_1464060_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004686562.1|1464056_1464815_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002963676.1|1464811_1465666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963675.1|1465692_1466472_+	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_077281772.1|1467899_1468250_-|transposase	transposase	transposase	NA	NA	NA	NA
