The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962930	Brucella melitensis isolate 1 chromosome 1	2116999	1040513	1050534	2116999	integrase,transposase	Brucella_phage(37.5%)	15	1035499:1035539	1050612:1050652
1035499:1035539	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040513_1041965_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_029077469.1|1042376_1043069_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.0	1.3e-105
WP_101419120.1|1043069_1043827_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	6.1e-16
WP_002966807.1|1044667_1044913_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044912_1045227_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045574_1045745_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046092_1046803_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047148_1047625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047647_1047923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047919_1048150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048146_1048851_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048900_1049104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049100_1049316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049318_1049522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049508_1050534_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050612:1050652	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962930	Brucella melitensis isolate 1 chromosome 1	2116999	1119559	1131471	2116999	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119559_1121887_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122005_1122347_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122506_1123373_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123421_1124720_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124768_1124954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125098_1125767_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125763_1126531_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126679_1127963_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128039_1128864_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128860_1129427_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129537_1129756_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129901_1130627_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130619_1131471_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962930	Brucella melitensis isolate 1 chromosome 1	2116999	1356127	1404529	2116999	portal,integrase,tail,protease	Paracoccus_phage(27.27%)	45	1346932:1346946	1360369:1360383
1346932:1346946	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356127_1357054_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357416_1358550_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006136160.1|1358567_1358942_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1358986_1359637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360291_1361062_+	YitT family protein	NA	NA	NA	NA	NA
1360369:1360383	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361121_1361379_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361648_1361888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361884_1362232_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362290_1363001_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363195_1363363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363359_1363527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363567_1365070_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365122_1366199_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366314_1368006_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368394_1369267_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369428_1370685_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370689_1371649_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371874_1374526_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374916_1377268_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377538_1379650_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_087930911.1|1379694_1382646_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382768_1384175_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004683323.1|1384171_1384879_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1384972_1386514_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_004683319.1|1386655_1387132_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387128_1389120_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389139_1389637_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389633_1390773_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390873_1391326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391419_1392730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392804_1393494_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393572_1393869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394030_1394237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080699367.1|1394301_1396959_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.3	1.0e-142
WP_006136169.1|1396975_1398163_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398166_1398601_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398597_1399473_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399469_1400102_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400104_1400650_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400654_1400825_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400868_1401210_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401206_1401620_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401670_1402048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402044_1403238_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403269_1404529_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
