The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962920	Brucella melitensis isolate 1 chromosome 1	2116960	1040448	1050469	2116960	integrase,transposase	Brucella_phage(37.5%)	15	1035434:1035474	1050547:1050587
1035434:1035474	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040448_1041900_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042311_1043004_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_101457036.1|1043004_1043762_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.0e-15
WP_002966807.1|1044602_1044848_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044847_1045162_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045509_1045680_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046027_1046738_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047083_1047560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047582_1047858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047854_1048085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048081_1048786_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048835_1049039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049035_1049251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049253_1049457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049443_1050469_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050547:1050587	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962920	Brucella melitensis isolate 1 chromosome 1	2116960	1119494	1131406	2116960	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119494_1121822_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121940_1122282_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122441_1123308_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123356_1124655_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124703_1124889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125033_1125702_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125698_1126466_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126614_1127898_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1127974_1128799_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128795_1129362_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129472_1129691_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129836_1130562_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130554_1131406_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962920	Brucella melitensis isolate 1 chromosome 1	2116960	1356102	1404504	2116960	integrase,protease,tail,portal	Paracoccus_phage(27.27%)	45	1346907:1346921	1360344:1360358
1346907:1346921	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356102_1357029_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357391_1358525_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006136160.1|1358542_1358917_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1358961_1359612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360266_1361037_+	YitT family protein	NA	NA	NA	NA	NA
1360344:1360358	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361096_1361354_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361623_1361863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361859_1362207_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362265_1362976_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363170_1363338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363334_1363502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363542_1365045_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365097_1366174_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366289_1367981_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368369_1369242_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369403_1370660_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370664_1371624_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371849_1374501_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374891_1377243_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377513_1379625_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_006143569.1|1379669_1382621_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382743_1384150_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004683323.1|1384146_1384854_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1384947_1386489_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_004683319.1|1386630_1387107_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387103_1389095_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389114_1389612_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389608_1390748_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390848_1391301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391394_1392705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392779_1393469_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393547_1393844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394005_1394212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394276_1396934_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_101457041.1|1396950_1398138_-	host specificity protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.7e-36
WP_004683307.1|1398141_1398576_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398572_1399448_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399444_1400077_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400079_1400625_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400629_1400800_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400843_1401185_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401181_1401595_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401645_1402023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402019_1403213_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403244_1404504_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
