The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962912	Brucella melitensis isolate 1 chromosome 1	2117059	1040533	1050554	2117059	transposase,integrase	Brucella_phage(37.5%)	15	1035531:1035571	1050632:1050672
1035531:1035571	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040533_1041985_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042396_1043089_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_080723468.1|1043089_1043847_-|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044687_1044933_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044932_1045247_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045594_1045765_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046112_1046823_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047168_1047645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047667_1047943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047939_1048170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048166_1048871_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048920_1049124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049120_1049336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049338_1049542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049528_1050554_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050632:1050672	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962912	Brucella melitensis isolate 1 chromosome 1	2117059	1119582	1131494	2117059	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119582_1121910_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122028_1122370_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122529_1123396_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123444_1124743_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124791_1124977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125121_1125790_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125786_1126554_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126702_1127986_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128062_1128887_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128883_1129450_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129560_1129779_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129924_1130650_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130642_1131494_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962912	Brucella melitensis isolate 1 chromosome 1	2117059	1356202	1468271	2117059	protease,holin,transposase,tail,portal,integrase	Paracoccus_phage(12.5%)	103	1351713:1351729	1434657:1434673
1351713:1351729	attL	CGGCGCAGGATGCGCCC	NA	NA	NA	NA
WP_004683363.1|1356202_1357129_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357491_1358625_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358642_1359017_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359061_1359712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360366_1361137_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|1361196_1361454_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361723_1361963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361959_1362307_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362365_1363076_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363270_1363438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363434_1363602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363642_1365145_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365197_1366274_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366389_1368081_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368469_1369342_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369503_1370760_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370764_1371724_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371949_1374601_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374991_1377343_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377613_1379725_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379769_1382721_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382843_1384250_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384246_1384954_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385047_1386589_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386730_1387207_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387203_1389195_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389214_1389712_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389708_1390848_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390948_1391401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391494_1392805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392879_1393569_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393647_1393944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394105_1394312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394376_1397034_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397050_1398238_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398241_1398676_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398672_1399548_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399544_1400177_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400179_1400725_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400729_1400900_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400943_1401285_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401281_1401695_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401745_1402123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402119_1403313_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403344_1404604_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963734.1|1404542_1405055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136183.1|1405394_1407569_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963732.1|1407575_1408187_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_004683287.1|1408179_1408722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006136186.1|1408919_1409978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963729.1|1409988_1410336_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_002971535.1|1410349_1411318_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_004686543.1|1411292_1413122_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_004683280.1|1413412_1413877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963725.1|1413956_1414382_+	SufE family protein	NA	NA	NA	NA	NA
WP_002967494.1|1414422_1415760_-	amidase	NA	NA	NA	NA	NA
WP_101418059.1|1415872_1416646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|1416642_1417098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136191.1|1417279_1417591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963720.1|1417798_1418227_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002967492.1|1418799_1420908_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963717.1|1421025_1421361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|1421532_1422132_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_006139491.1|1423008_1423251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963714.1|1423309_1424026_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_065874133.1|1424231_1425743_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.8e-83
WP_002963712.1|1426078_1426441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686548.1|1426497_1427796_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004683264.1|1427792_1428470_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963709.1|1428625_1429618_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683261.1|1429678_1429909_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004686549.1|1429905_1430295_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_002967489.1|1430291_1430762_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_002963705.1|1430806_1431829_-	asparaginase	NA	NA	NA	NA	NA
WP_004683258.1|1432019_1432616_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004686551.1|1432618_1434301_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004686552.1|1434452_1435916_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
1434657:1434673	attR	GGGCGCATCCTGCGCCG	NA	NA	NA	NA
WP_004683253.1|1436454_1437024_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|1437005_1437449_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685498.1|1437711_1438743_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683247.1|1438775_1440227_+	xylulokinase	NA	NA	NA	NA	NA
WP_002966715.1|1440273_1441581_+	xylose isomerase	NA	NA	NA	NA	NA
WP_004683244.1|1441622_1442795_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004683241.1|1442802_1443855_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002969455.1|1443912_1444875_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683239.1|1444953_1445955_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969456.1|1448200_1449310_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002963690.1|1449392_1450565_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002963689.1|1450597_1452022_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_004685492.1|1452092_1453448_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_002975117.1|1454058_1454376_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087907707.1|1454272_1455036_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	3.7e-21
WP_005969645.1|1455199_1455754_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_077281774.1|1455796_1455949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006142162.1|1456706_1457825_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087910411.1|1458195_1458953_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	7.9e-16
WP_002963680.1|1461084_1462173_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963679.1|1462180_1463284_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_004683211.1|1463298_1464081_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004686562.1|1464077_1464836_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002963676.1|1464832_1465687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963675.1|1465713_1466493_+	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_077281772.1|1467920_1468271_-|transposase	transposase	transposase	NA	NA	NA	NA
