The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962916	Brucella melitensis isolate 1 chromosome 1	2117031	1040521	1050542	2117031	integrase,transposase	Brucella_phage(37.5%)	15	1035519:1035559	1050620:1050660
1035519:1035559	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040521_1041973_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042384_1043077_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_080723468.1|1043077_1043835_-|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044675_1044921_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044920_1045235_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045582_1045753_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046100_1046811_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047156_1047633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047655_1047931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047927_1048158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048154_1048859_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048908_1049112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049108_1049324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049326_1049530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049516_1050542_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050620:1050660	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962916	Brucella melitensis isolate 1 chromosome 1	2117031	1119569	1131481	2117031	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119569_1121897_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122015_1122357_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122516_1123383_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123431_1124730_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124778_1124964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125108_1125777_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125773_1126541_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126689_1127973_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128049_1128874_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128870_1129437_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129547_1129766_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129911_1130637_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130629_1131481_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962916	Brucella melitensis isolate 1 chromosome 1	2117031	1356173	1468234	2117031	tail,integrase,transposase,protease,holin,portal	Paracoccus_phage(12.5%)	103	1351684:1351700	1434620:1434636
1351684:1351700	attL	CGGCGCAGGATGCGCCC	NA	NA	NA	NA
WP_004683363.1|1356173_1357100_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357462_1358596_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358613_1358988_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359032_1359683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360337_1361108_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|1361167_1361425_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361694_1361934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361930_1362278_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362336_1363047_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363241_1363409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363405_1363573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363613_1365116_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365168_1366245_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366360_1368052_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368440_1369313_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369474_1370731_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370735_1371695_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371920_1374572_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374962_1377314_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377584_1379696_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379740_1382692_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382814_1384221_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384217_1384925_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385018_1386560_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386701_1387178_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387174_1389166_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389185_1389683_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389679_1390819_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390919_1391372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391465_1392776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392850_1393540_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393618_1393915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394076_1394283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394347_1397005_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397021_1398209_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398212_1398647_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398643_1399519_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399515_1400148_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400150_1400696_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400700_1400871_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400914_1401256_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401252_1401666_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401716_1402094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402090_1403284_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403315_1404575_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963734.1|1404513_1405026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136183.1|1405365_1407540_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963732.1|1407546_1408158_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_004683287.1|1408150_1408693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006136186.1|1408890_1409949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963729.1|1409959_1410307_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_002971535.1|1410320_1411289_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_004686543.1|1411263_1413093_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_004683280.1|1413383_1413848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963725.1|1413927_1414353_+	SufE family protein	NA	NA	NA	NA	NA
WP_002967494.1|1414393_1415731_-	amidase	NA	NA	NA	NA	NA
WP_005969604.1|1415843_1416617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|1416613_1417069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136191.1|1417250_1417562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963720.1|1417769_1418198_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002967492.1|1418770_1420879_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963717.1|1420996_1421332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|1421503_1422103_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_006139491.1|1422979_1423222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963714.1|1423280_1423997_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002963713.1|1424194_1425706_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.4e-83
WP_002963712.1|1426041_1426404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686548.1|1426460_1427759_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004683264.1|1427755_1428433_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963709.1|1428588_1429581_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683261.1|1429641_1429872_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004686549.1|1429868_1430258_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_002967489.1|1430254_1430725_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_002963705.1|1430769_1431792_-	asparaginase	NA	NA	NA	NA	NA
WP_004683258.1|1431982_1432579_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004686551.1|1432581_1434264_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004686552.1|1434415_1435879_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
1434620:1434636	attR	GGGCGCATCCTGCGCCG	NA	NA	NA	NA
WP_004683253.1|1436417_1436987_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|1436968_1437412_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685498.1|1437674_1438706_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683247.1|1438738_1440190_+	xylulokinase	NA	NA	NA	NA	NA
WP_002966715.1|1440236_1441544_+	xylose isomerase	NA	NA	NA	NA	NA
WP_004683244.1|1441585_1442758_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004683241.1|1442765_1443818_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002969455.1|1443875_1444838_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683239.1|1444916_1445918_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969456.1|1448163_1449273_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002963690.1|1449355_1450528_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002963689.1|1450560_1451985_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_004685492.1|1452055_1453411_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_002975117.1|1454021_1454339_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087907707.1|1454235_1454999_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	3.7e-21
WP_005969645.1|1455162_1455717_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_077281774.1|1455759_1455912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006142162.1|1456669_1457788_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087910411.1|1458158_1458916_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	7.9e-16
WP_002963680.1|1461047_1462136_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963679.1|1462143_1463247_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_004683211.1|1463261_1464044_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004686562.1|1464040_1464799_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002963676.1|1464795_1465650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963675.1|1465676_1466456_+	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_077281772.1|1467883_1468234_-|transposase	transposase	transposase	NA	NA	NA	NA
