The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962926	Brucella melitensis isolate 1 chromosome 1	2117062	1040518	1050539	2117062	integrase,transposase	Brucella_phage(37.5%)	15	1035516:1035556	1050617:1050657
1035516:1035556	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040518_1041970_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042381_1043074_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_080723468.1|1043074_1043832_-|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044672_1044918_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044917_1045232_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045579_1045750_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046097_1046808_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047153_1047630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047652_1047928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047924_1048155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048151_1048856_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048905_1049109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049105_1049321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049323_1049527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049513_1050539_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050617:1050657	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962926	Brucella melitensis isolate 1 chromosome 1	2117062	1119568	1131480	2117062	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119568_1121896_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122014_1122356_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122515_1123382_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123430_1124729_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124777_1124963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125107_1125776_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125772_1126540_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126688_1127972_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128048_1128873_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128869_1129436_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129546_1129765_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129910_1130636_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130628_1131480_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962926	Brucella melitensis isolate 1 chromosome 1	2117062	1356213	1468281	2117062	transposase,integrase,tail,holin,portal,protease	Paracoccus_phage(12.5%)	103	1351724:1351740	1434668:1434684
1351724:1351740	attL	CGGCGCAGGATGCGCCC	NA	NA	NA	NA
WP_004683363.1|1356213_1357140_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357502_1358636_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358653_1359028_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359072_1359723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360377_1361148_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|1361207_1361465_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361734_1361974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361970_1362318_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362376_1363087_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363281_1363449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172439356.1|1363445_1363613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363653_1365156_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365208_1366285_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366400_1368092_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368480_1369353_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369514_1370771_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370775_1371735_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371960_1374612_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1375002_1377354_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377624_1379736_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379780_1382732_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382854_1384261_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384257_1384965_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385058_1386600_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386741_1387218_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387214_1389206_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389225_1389723_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389719_1390859_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390959_1391412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391505_1392816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392890_1393580_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393658_1393955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394116_1394323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394387_1397045_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397061_1398249_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398252_1398687_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398683_1399559_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399555_1400188_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400190_1400736_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400740_1400911_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400954_1401296_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401292_1401706_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401756_1402134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402130_1403324_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403355_1404615_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963734.1|1404553_1405066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136183.1|1405405_1407580_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963732.1|1407586_1408198_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_004683287.1|1408190_1408733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006136186.1|1408930_1409989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963729.1|1409999_1410347_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_002971535.1|1410360_1411329_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_004686543.1|1411303_1413133_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_004683280.1|1413423_1413888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963725.1|1413967_1414393_+	SufE family protein	NA	NA	NA	NA	NA
WP_002967494.1|1414433_1415771_-	amidase	NA	NA	NA	NA	NA
WP_005969604.1|1415883_1416657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|1416653_1417109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136191.1|1417290_1417602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963720.1|1417809_1418238_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002967492.1|1418810_1420919_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963717.1|1421036_1421372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|1421543_1422143_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_006139491.1|1423019_1423262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963714.1|1423320_1424037_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_065874133.1|1424242_1425754_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.8e-83
WP_002963712.1|1426089_1426452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686548.1|1426508_1427807_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004683264.1|1427803_1428481_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963709.1|1428636_1429629_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683261.1|1429689_1429920_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004686549.1|1429916_1430306_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_002967489.1|1430302_1430773_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_002963705.1|1430817_1431840_-	asparaginase	NA	NA	NA	NA	NA
WP_004683258.1|1432030_1432627_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004686551.1|1432629_1434312_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004686552.1|1434463_1435927_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
1434668:1434684	attR	GGGCGCATCCTGCGCCG	NA	NA	NA	NA
WP_004683253.1|1436465_1437035_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|1437016_1437460_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685498.1|1437722_1438754_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683247.1|1438786_1440238_+	xylulokinase	NA	NA	NA	NA	NA
WP_002966715.1|1440284_1441592_+	xylose isomerase	NA	NA	NA	NA	NA
WP_004683244.1|1441633_1442806_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004683241.1|1442813_1443866_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002969455.1|1443923_1444886_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683239.1|1444964_1445966_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969456.1|1448211_1449321_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002963690.1|1449403_1450576_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002963689.1|1450608_1452033_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_004685492.1|1452103_1453459_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_002975117.1|1454069_1454387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087907707.1|1454283_1455047_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	3.7e-21
WP_005969645.1|1455210_1455765_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_077281774.1|1455807_1455960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006142162.1|1456717_1457836_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087910411.1|1458206_1458964_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	7.9e-16
WP_002963680.1|1461094_1462183_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963679.1|1462190_1463294_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_004683211.1|1463308_1464091_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004686562.1|1464087_1464846_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002963676.1|1464842_1465697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963675.1|1465723_1466503_+	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_077281772.1|1467930_1468281_-|transposase	transposase	transposase	NA	NA	NA	NA
