The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962943	Brucella melitensis isolate 1 chromosome 1	2117090	1040542	1050563	2117090	transposase,integrase	Brucella_phage(37.5%)	16	1035540:1035580	1050641:1050681
1035540:1035580	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040542_1041994_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042405_1043098_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_095844453.1|1043098_1043856_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.0e-15
WP_002966807.1|1044696_1044942_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044941_1045256_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002969999.1|1045371_1045605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964095.1|1045603_1045774_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046121_1046832_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047177_1047654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047676_1047952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047948_1048179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048175_1048880_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048929_1049133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049129_1049345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049347_1049551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049537_1050563_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050641:1050681	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962943	Brucella melitensis isolate 1 chromosome 1	2117090	1119587	1131499	2117090	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119587_1121915_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122033_1122375_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122534_1123401_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123449_1124748_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124796_1124982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125126_1125795_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125791_1126559_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126707_1127991_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128067_1128892_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128888_1129455_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129565_1129784_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129929_1130655_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130647_1131499_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962943	Brucella melitensis isolate 1 chromosome 1	2117090	1356216	1468278	2117090	transposase,portal,protease,tail,holin,integrase	Paracoccus_phage(12.5%)	104	1351727:1351743	1434664:1434680
1351727:1351743	attL	CGGCGCAGGATGCGCCC	NA	NA	NA	NA
WP_004683363.1|1356216_1357143_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357505_1358639_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358656_1359031_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359075_1359726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154018645.1|1360049_1360322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360381_1361152_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|1361211_1361469_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361738_1361978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361974_1362322_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362380_1363091_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363285_1363453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363449_1363617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363657_1365160_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365212_1366289_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366404_1368096_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368484_1369357_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369518_1370775_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370779_1371739_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371964_1374616_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1375006_1377358_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377628_1379740_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379784_1382736_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382858_1384265_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384261_1384969_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385062_1386604_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386745_1387222_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387218_1389210_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389229_1389727_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389723_1390863_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390963_1391416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391509_1392820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392894_1393584_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393662_1393959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394120_1394327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394391_1397049_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397065_1398253_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398256_1398691_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398687_1399563_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399559_1400192_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400194_1400740_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400744_1400915_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400958_1401300_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401296_1401710_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401760_1402138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402134_1403328_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403359_1404619_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963734.1|1404557_1405070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136183.1|1405409_1407584_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963732.1|1407590_1408202_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_004683287.1|1408194_1408737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006136186.1|1408934_1409993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963729.1|1410003_1410351_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_002971535.1|1410364_1411333_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_004686543.1|1411307_1413137_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_004683280.1|1413427_1413892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963725.1|1413971_1414397_+	SufE family protein	NA	NA	NA	NA	NA
WP_002967494.1|1414437_1415775_-	amidase	NA	NA	NA	NA	NA
WP_005969604.1|1415887_1416661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|1416657_1417113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136191.1|1417294_1417606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963720.1|1417813_1418242_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002967492.1|1418814_1420923_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963717.1|1421040_1421376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|1421547_1422147_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_006139491.1|1423023_1423266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963714.1|1423324_1424041_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002963713.1|1424238_1425750_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.4e-83
WP_002963712.1|1426085_1426448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686548.1|1426504_1427803_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004683264.1|1427799_1428477_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963709.1|1428632_1429625_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683261.1|1429685_1429916_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004686549.1|1429912_1430302_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_002967489.1|1430298_1430769_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_002963705.1|1430813_1431836_-	asparaginase	NA	NA	NA	NA	NA
WP_004683258.1|1432026_1432623_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004686551.1|1432625_1434308_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004686552.1|1434459_1435923_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
1434664:1434680	attR	GGGCGCATCCTGCGCCG	NA	NA	NA	NA
WP_004683253.1|1436461_1437031_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|1437012_1437456_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685498.1|1437718_1438750_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683247.1|1438782_1440234_+	xylulokinase	NA	NA	NA	NA	NA
WP_002966715.1|1440280_1441588_+	xylose isomerase	NA	NA	NA	NA	NA
WP_004683244.1|1441629_1442802_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004683241.1|1442809_1443862_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002969455.1|1443919_1444882_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683239.1|1444960_1445962_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969456.1|1448207_1449317_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002963690.1|1449399_1450572_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002963689.1|1450604_1452029_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_004685492.1|1452099_1453455_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_002975117.1|1454065_1454383_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087910421.1|1454279_1455043_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	6.3e-21
WP_005969645.1|1455206_1455761_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_077281774.1|1455803_1455956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006142162.1|1456713_1457832_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087910411.1|1458202_1458960_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	7.9e-16
WP_002963680.1|1461091_1462180_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963679.1|1462187_1463291_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_004683211.1|1463305_1464088_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004686562.1|1464084_1464843_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002963676.1|1464839_1465694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963675.1|1465720_1466500_+	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_077281772.1|1467927_1468278_-|transposase	transposase	transposase	NA	NA	NA	NA
