The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962910	Brucella melitensis isolate 1 chromosome 1	2117029	1040527	1050548	2117029	transposase,integrase	Brucella_phage(37.5%)	15	1035525:1035565	1050626:1050666
1035525:1035565	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040527_1041979_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042390_1043083_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_101433168.1|1043083_1043841_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044681_1044927_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044926_1045241_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045588_1045759_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046106_1046817_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047162_1047639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047661_1047937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047933_1048164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048160_1048865_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048914_1049118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049114_1049330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049332_1049536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049522_1050548_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050626:1050666	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962910	Brucella melitensis isolate 1 chromosome 1	2117029	1119576	1131488	2117029	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119576_1121904_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122022_1122364_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122523_1123390_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123438_1124737_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124785_1124971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125115_1125784_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125780_1126548_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126696_1127980_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128056_1128881_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128877_1129444_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129554_1129773_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129918_1130644_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130636_1131488_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962910	Brucella melitensis isolate 1 chromosome 1	2117029	1356196	1468265	2117029	holin,transposase,protease,integrase,portal,tail	Paracoccus_phage(12.5%)	103	1351707:1351723	1434651:1434667
1351707:1351723	attL	CGGCGCAGGATGCGCCC	NA	NA	NA	NA
WP_004683363.1|1356196_1357123_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357485_1358619_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358636_1359011_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359055_1359706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360360_1361131_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|1361190_1361448_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361717_1361957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361953_1362301_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362359_1363070_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363264_1363432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363428_1363596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363636_1365139_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365191_1366268_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366383_1368075_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368463_1369336_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369497_1370754_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370758_1371718_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371943_1374595_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374985_1377337_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377607_1379719_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379763_1382715_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382837_1384244_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384240_1384948_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385041_1386583_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386724_1387201_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387197_1389189_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389208_1389706_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389702_1390842_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390942_1391395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391488_1392799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392873_1393563_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393641_1393938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394099_1394306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394370_1397028_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397044_1398232_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398235_1398670_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398666_1399542_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399538_1400171_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400173_1400719_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400723_1400894_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400937_1401279_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401275_1401689_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401739_1402117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402113_1403307_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403338_1404598_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963734.1|1404536_1405049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136183.1|1405388_1407563_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963732.1|1407569_1408181_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_004683287.1|1408173_1408716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006136186.1|1408913_1409972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963729.1|1409982_1410330_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_002971535.1|1410343_1411312_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_004686543.1|1411286_1413116_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_004683280.1|1413406_1413871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963725.1|1413950_1414376_+	SufE family protein	NA	NA	NA	NA	NA
WP_002967494.1|1414416_1415754_-	amidase	NA	NA	NA	NA	NA
WP_005969604.1|1415866_1416640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|1416636_1417092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136191.1|1417273_1417585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963720.1|1417792_1418221_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002967492.1|1418793_1420902_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963717.1|1421019_1421355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|1421526_1422126_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_006139491.1|1423002_1423245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963714.1|1423303_1424020_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_065874133.1|1424225_1425737_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.8e-83
WP_002963712.1|1426072_1426435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686548.1|1426491_1427790_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004683264.1|1427786_1428464_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963709.1|1428619_1429612_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683261.1|1429672_1429903_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004686549.1|1429899_1430289_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_002967489.1|1430285_1430756_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_002963705.1|1430800_1431823_-	asparaginase	NA	NA	NA	NA	NA
WP_004683258.1|1432013_1432610_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004686551.1|1432612_1434295_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004686552.1|1434446_1435910_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
1434651:1434667	attR	GGGCGCATCCTGCGCCG	NA	NA	NA	NA
WP_004683253.1|1436448_1437018_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|1436999_1437443_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685498.1|1437705_1438737_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683247.1|1438769_1440221_+	xylulokinase	NA	NA	NA	NA	NA
WP_002966715.1|1440267_1441575_+	xylose isomerase	NA	NA	NA	NA	NA
WP_004683244.1|1441616_1442789_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004683241.1|1442796_1443849_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002969455.1|1443906_1444869_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683239.1|1444947_1445949_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969456.1|1448194_1449304_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002963690.1|1449386_1450559_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002963689.1|1450591_1452016_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_004685492.1|1452086_1453442_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_002975117.1|1454052_1454370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087907707.1|1454266_1455030_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	3.7e-21
WP_005969645.1|1455193_1455748_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_077281774.1|1455790_1455943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006142162.1|1456700_1457819_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087910411.1|1458189_1458947_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	7.9e-16
WP_002963680.1|1461078_1462167_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963679.1|1462174_1463278_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_004683211.1|1463292_1464075_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004686562.1|1464071_1464830_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002963676.1|1464826_1465681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963675.1|1465707_1466487_+	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_077281772.1|1467914_1468265_-|transposase	transposase	transposase	NA	NA	NA	NA
