The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962940	Brucella melitensis isolate 1 chromosome 1	2117105	1040541	1050562	2117105	integrase,transposase	Brucella_phage(37.5%)	15	1035539:1035579	1050640:1050680
1035539:1035579	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040541_1041993_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042404_1043097_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_101433168.1|1043097_1043855_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044695_1044941_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044940_1045255_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045602_1045773_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046120_1046831_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047176_1047653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047675_1047951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047947_1048178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048174_1048879_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048928_1049132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049128_1049344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049346_1049550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049536_1050562_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050640:1050680	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962940	Brucella melitensis isolate 1 chromosome 1	2117105	1119586	1131498	2117105	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119586_1121914_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1122032_1122374_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122533_1123400_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123448_1124747_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124795_1124981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125125_1125794_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125790_1126558_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126706_1127990_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128066_1128891_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128887_1129454_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129564_1129783_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129928_1130654_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130646_1131498_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962940	Brucella melitensis isolate 1 chromosome 1	2117105	1356239	1468301	2117105	tail,integrase,portal,holin,protease,transposase	Paracoccus_phage(12.5%)	104	1351750:1351766	1434687:1434703
1351750:1351766	attL	CGGCGCAGGATGCGCCC	NA	NA	NA	NA
WP_004683363.1|1356239_1357166_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357528_1358662_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358679_1359054_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359098_1359749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154018645.1|1360072_1360345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360404_1361175_+	YitT family protein	NA	NA	NA	NA	NA
WP_004683353.1|1361234_1361492_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361761_1362001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361997_1362345_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362403_1363114_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363308_1363476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363472_1363640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363680_1365183_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365235_1366312_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366427_1368119_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368507_1369380_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369541_1370798_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370802_1371762_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371987_1374639_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1375029_1377381_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377651_1379763_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379807_1382759_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382881_1384288_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384284_1384992_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385085_1386627_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386768_1387245_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387241_1389233_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389252_1389750_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389746_1390886_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390986_1391439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391532_1392843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392917_1393607_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393685_1393982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394143_1394350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394414_1397072_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397088_1398276_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398279_1398714_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398710_1399586_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399582_1400215_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400217_1400763_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400767_1400938_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400981_1401323_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401319_1401733_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401783_1402161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402157_1403351_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403382_1404642_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
WP_002963734.1|1404580_1405093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136183.1|1405432_1407607_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_002963732.1|1407613_1408225_+	DUF1214 domain-containing protein	NA	NA	NA	NA	NA
WP_004683287.1|1408217_1408760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006136186.1|1408957_1410016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963729.1|1410026_1410374_-	DUF1491 family protein	NA	NA	NA	NA	NA
WP_002971535.1|1410387_1411356_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_004686543.1|1411330_1413160_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.2e-22
WP_004683280.1|1413450_1413915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963725.1|1413994_1414420_+	SufE family protein	NA	NA	NA	NA	NA
WP_002967494.1|1414460_1415798_-	amidase	NA	NA	NA	NA	NA
WP_005969604.1|1415910_1416684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004686544.1|1416680_1417136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136191.1|1417317_1417629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963720.1|1417836_1418265_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.6	1.0e-20
WP_002967492.1|1418837_1420946_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_002963717.1|1421063_1421399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683270.1|1421570_1422170_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-40
WP_006139491.1|1423046_1423289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963714.1|1423347_1424064_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002963713.1|1424261_1425773_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.4e-83
WP_002963712.1|1426108_1426471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686548.1|1426527_1427826_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004683264.1|1427822_1428500_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002963709.1|1428655_1429648_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004683261.1|1429708_1429939_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004686549.1|1429935_1430325_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.1	7.7e-07
WP_002967489.1|1430321_1430792_-	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_002963705.1|1430836_1431859_-	asparaginase	NA	NA	NA	NA	NA
WP_004683258.1|1432049_1432646_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_004686551.1|1432648_1434331_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	6.0e-40
WP_004686552.1|1434482_1435946_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
1434687:1434703	attR	GGGCGCATCCTGCGCCG	NA	NA	NA	NA
WP_004683253.1|1436484_1437054_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004686553.1|1437035_1437479_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685498.1|1437741_1438773_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004683247.1|1438805_1440257_+	xylulokinase	NA	NA	NA	NA	NA
WP_002966715.1|1440303_1441611_+	xylose isomerase	NA	NA	NA	NA	NA
WP_004683244.1|1441652_1442825_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004683241.1|1442832_1443885_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002969455.1|1443942_1444905_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004683239.1|1444983_1445985_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002969456.1|1448230_1449340_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002963690.1|1449422_1450595_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_002963689.1|1450627_1452052_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	9.0e-53
WP_004685492.1|1452122_1453478_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_002975117.1|1454088_1454406_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087910421.1|1454302_1455066_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.0	6.3e-21
WP_005969645.1|1455229_1455784_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.9	3.9e-12
WP_077281774.1|1455826_1455979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006142162.1|1456736_1457855_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_087910411.1|1458225_1458983_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	41.0	7.9e-16
WP_002963680.1|1461114_1462203_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	68.4	3.4e-137
WP_002963679.1|1462210_1463314_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	31.9	3.5e-44
WP_004683211.1|1463328_1464111_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004686562.1|1464107_1464866_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002963676.1|1464862_1465717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963675.1|1465743_1466523_+	LPS biosynthesis N-formyltransferase WbkC	NA	E3SNR5	Prochlorococcus_phage	31.4	3.3e-09
WP_077281772.1|1467950_1468301_-|transposase	transposase	transposase	NA	NA	NA	NA
