The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962945	Brucella melitensis isolate 1 chromosome 1	2116992	1040496	1050517	2116992	integrase,transposase	Brucella_phage(37.5%)	15	1035494:1035534	1050595:1050635
1035494:1035534	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040496_1041948_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042359_1043052_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_080723468.1|1043052_1043810_-|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044650_1044896_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044895_1045210_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045557_1045728_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046075_1046786_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047131_1047608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047630_1047906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047902_1048133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048129_1048834_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048883_1049087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049083_1049299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049301_1049505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049491_1050517_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050595:1050635	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962945	Brucella melitensis isolate 1 chromosome 1	2116992	1119546	1131458	2116992	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119546_1121874_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121992_1122334_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122493_1123360_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123408_1124707_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124755_1124941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006267749.1|1125085_1125754_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125750_1126518_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126666_1127950_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128026_1128851_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128847_1129414_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129524_1129743_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129888_1130614_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130606_1131458_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962945	Brucella melitensis isolate 1 chromosome 1	2116992	1356152	1404554	2116992	portal,integrase,protease,tail	Paracoccus_phage(27.27%)	45	1346956:1346970	1360394:1360408
1346956:1346970	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356152_1357079_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357441_1358575_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358592_1358967_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359011_1359662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360316_1361087_+	YitT family protein	NA	NA	NA	NA	NA
1360394:1360408	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361146_1361404_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361673_1361913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361909_1362257_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362315_1363026_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363220_1363388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363384_1363552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363592_1365095_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365147_1366224_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366339_1368031_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368419_1369292_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369453_1370710_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370714_1371674_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006267928.1|1371899_1374551_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374941_1377293_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377563_1379675_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379719_1382671_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382793_1384200_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384196_1384904_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1384997_1386539_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386680_1387157_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387153_1389145_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389164_1389662_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389658_1390798_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390898_1391351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391444_1392755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392829_1393519_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393597_1393894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394055_1394262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394326_1396984_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397000_1398188_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398191_1398626_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398622_1399498_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399494_1400127_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400129_1400675_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400679_1400850_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400893_1401235_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401231_1401645_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401695_1402073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402069_1403263_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403294_1404554_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
