The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	47206	86912	4406153	integrase,transposase	Pseudomonas_phage(28.57%)	43	53799:53858	86913:88058
WP_172953460.1|47206_48421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157775550.1|48383_48740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|48805_49078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|49183_49594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323530.1|49886_50783_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.6	1.3e-33
WP_099323529.1|51410_51821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|51926_52199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775550.1|52264_52621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157775553.1|52583_53048_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099323532.1|53213_53798_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
53799:53858	attL	CCATGTTTACTTCTCATTTTTCCATGACTACTCAGCCGTTCTCTGAAAGAATCAACACCA	NA	NA	NA	NA
WP_099323525.1|53800_54592_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099323533.1|55097_55325_-	PqqD family protein	NA	NA	NA	NA	NA
WP_099323534.1|55470_56502_-	radical SAM protein	NA	NA	NA	NA	NA
WP_099323530.1|58016_58913_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.6	1.3e-33
WP_099323535.1|58931_59207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323536.1|59654_60422_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_099323537.1|60730_61075_-	muconolactone delta-isomerase	NA	NA	NA	NA	NA
WP_099323538.1|61440_62184_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	5.4e-17
WP_099323539.1|62340_62931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323540.1|63273_64647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775556.1|64877_65039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323541.1|65120_65210_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_099323542.1|65432_65672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326927.1|65641_65791_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_099323543.1|66068_66539_-	bacterioferritin	NA	NA	NA	NA	NA
WP_099323544.1|67209_68547_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	7.7e-30
WP_099323545.1|69553_69997_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.2	1.9e-33
WP_099323546.1|70173_70596_+	response regulator	NA	NA	NA	NA	NA
WP_157775559.1|70664_72125_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_099323548.1|72134_72761_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099323549.1|72774_74073_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.9e-82
WP_099323550.1|74202_74931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157775562.1|75238_76981_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_099323551.1|77001_77700_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.5	6.4e-12
WP_169703078.1|78674_79193_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157775565.1|79302_79563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323553.1|79886_80945_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_099326928.1|81093_81261_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_099323554.1|81435_83310_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099323529.1|84524_84935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|85040_85313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775550.1|85378_85735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161081507.1|85697_86912_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
86913:88058	attR	CCATGTTTACTTCTCATTTTTCCATGACTACTCAGCCGTTCTCTGAAAGAATCAACACCAGCCTTATCATGAAAGACGAACGCTTTACCCAGGGGCTTGCACGACTCCAATACCTCTTACACTCAGGCTCTATCGCCGTCCTCTACGGACAGACGGGAGTCGGAAAATCCACACTCCTCAAACTCTTCCTCTCACAAATCCCCCAAAACCTGTTTCTCCCCATCTACCTCCATTTTACCCACCTAAAATCATCCAGCCTTCTCTCCTTAATCGTCTCCCAGCTCGGTGAAATACCAAAACACACCAAAGACCGGCTCTTCCTCCAAATTATGGATAAATCCTTGCGCTCAAATCTCACTCCCATTATCGTTATCGACGAGGCTCATCTCCTGAAAACCGACGCCATCACAGACCTCAGACTCCTTGTCAGCTCTCCGCTTGATTCTTCCACTCATCTCAAAATCATCCTCTCGGGACAGGAACACCTCAAATATATCCTCAAAAGAGACATCCATGCCGACTTCGCACAACGCATCTCGGTACATTACCACATTCATCCCCTTACTAAAACTCAAACCGCTGCATACATAGACTTCCATCTGAAATCTTCCGGCGCATCCGATAAAATCTTTGACTCAGACGTCAAAGACCTGATCCATGAGTTCTCCGCCGGCATCCCAAGGCAAATCAACGCCATTTCCACCGCCTGCCTGATTAACGCTTCCATCAGACAATCACAGAAAATTACCCAGGATATCTTCCATCAGGCTCTTGCTGAAATTCAATCTTTTTAAGGAGGTCTACCATGGCCCGTCTCTTTTCCCCTCAACTCTTGCGCTCATTACGAAACGATATCCCCATCGATCGACTCATCGCTGATGTCCTCTCCATACCTCATAAATACTCCGAAGGCTATTTCCGCTTCCTCTGCCCTCTCTGTTCTGAATTTAATTCCGCCACCAACCCAAATACGAACCTCGCCAGGTGTTTCCGTTGTAAAAAAAACTTTAATACCATCGACATCGTCATGGTAGATTCCAACTCCTCTTTCCCAGATGCTGTCTATCTGCTAAAATCCGTTTTACCTCAATATATTAATTCCACTTAATCTGAGAATTCCAGGTTCATTTATTGTGGGGCTTAGCA	NA	NA	NA	NA
>prophage 2
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	111830	173104	4406153	protease,tRNA,transposase	Staphylococcus_phage(20.0%)	60	NA	NA
WP_157775574.1|111830_112508_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_099323579.1|112565_113018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323580.1|113041_114064_-	dTDP-glucose 4,6-dehydratase	NA	M1HHF3	Acanthocystis_turfacea_Chlorella_virus	45.3	8.1e-72
WP_099323581.1|114195_114600_-	ATP synthase F1 subunit epsilon	NA	NA	NA	NA	NA
WP_099326931.1|114602_116009_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_099323582.1|116155_117028_-	ATP synthase F1 subunit gamma	NA	NA	NA	NA	NA
WP_099323583.1|117031_118546_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_099323584.1|118667_119216_-	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
WP_157775577.1|119205_119715_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_099323586.1|119739_120012_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_099323587.1|120185_120512_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_099323588.1|120620_121394_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_099323589.1|121628_122084_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_157775583.1|122046_122301_-	AtpZ/AtpI family protein	NA	NA	NA	NA	NA
WP_099323591.1|122309_122930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169702778.1|122987_124271_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_099323593.1|124395_125025_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_099323594.1|125040_125910_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_164994912.1|126045_127839_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_099323596.1|128031_128910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323597.1|128966_129953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169702776.1|129966_132864_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.8	1.8e-76
WP_099323599.1|133113_133359_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099323600.1|133361_133712_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_099323601.1|133743_134751_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_099323602.1|134757_137418_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	27.4	1.3e-41
WP_099323603.1|138934_140170_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	38.8	9.9e-16
WP_157775590.1|140598_141336_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_099323605.1|141797_142016_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_099323573.1|142209_143946_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157775592.1|143982_144267_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_099323607.1|144754_144871_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_099323609.1|145414_145612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323610.1|145805_146735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323611.1|146792_147953_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_099323612.1|147952_148702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323613.1|148909_149764_+	menaquinone biosynthesis protein	NA	NA	NA	NA	NA
WP_099323614.1|149753_150836_+	dehypoxanthine futalosine cyclase	NA	A9ZMK9	Mamastrovirus	49.6	6.4e-27
WP_099323615.1|151047_151998_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_169702775.1|151997_153524_-	UUP1 family membrane protein	NA	NA	NA	NA	NA
WP_157775596.1|153516_154116_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_164994902.1|154934_155267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775599.1|155992_156175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323621.1|156500_157004_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	32.9	2.1e-12
WP_157775602.1|157015_157666_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_099323623.1|157726_158143_-	EamA family transporter	NA	NA	NA	NA	NA
WP_157775605.1|158651_159611_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_099323626.1|159577_161380_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	40.6	2.8e-19
WP_099323628.1|162901_163720_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	5.0e-24
WP_099323629.1|163809_164556_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099323630.1|164572_164791_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_099323631.1|165172_165658_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_164994897.1|165650_166340_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_099323633.1|166391_167066_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_157775610.1|167265_167952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323635.1|168055_169489_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	38.1	5.1e-88
WP_099323636.1|169820_170255_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_157775612.1|170248_170452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323638.1|170709_171813_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099323639.1|172261_173104_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	35.8	1.3e-35
>prophage 3
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	183857	240748	4406153	integrase,tRNA,transposase	Staphylococcus_phage(16.67%)	53	170502:170524	236972:236994
170502:170524	attL	AGGATAAAATTGTCCATTTGACC	NA	NA	NA	NA
WP_099326933.1|183857_184328_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_099323646.1|185148_185334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323647.1|185397_186954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323573.1|187498_189235_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099323648.1|189574_190324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323649.1|190465_191140_-	polyphosphate polymerase domain-containing protein	NA	NA	NA	NA	NA
WP_157775618.1|191144_191591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323651.1|191876_192077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157775621.1|193070_193841_+	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_099323653.1|193824_194187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323654.1|194275_195064_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_099323655.1|195057_195933_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	1.3e-22
WP_099323656.1|196183_197278_+	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_099323657.1|197841_199377_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_099323658.1|199555_200023_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_099323659.1|200059_200260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323660.1|201083_201503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995060.1|201462_201981_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.0	9.3e-16
WP_099323535.1|201999_202275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323662.1|203830_204103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|204362_204773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|204878_205151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172953461.1|205216_205573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169703201.1|205535_206750_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099323525.1|206752_207544_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099323665.1|208464_209223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323666.1|209308_210067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323667.1|210155_210533_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_169703973.1|210612_210894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172953462.1|210905_211115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323669.1|212244_213123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323670.1|213293_213659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326935.1|213842_214580_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_099323671.1|215008_217039_+	glycogen debranching enzyme N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099323672.1|217151_217628_-	bacterioferritin	NA	NA	NA	NA	NA
WP_157775627.1|217776_218073_-	hypothetical protein	NA	W8CYF6	Bacillus_phage	37.1	8.2e-09
WP_157775630.1|218091_218469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323675.1|219527_219746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157775633.1|219858_220986_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099323677.1|221615_223094_-|transposase	ISNCY-like element ISCku10 family transposase	transposase	NA	NA	NA	NA
WP_099323678.1|223297_223705_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099323679.1|223849_224404_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099323680.1|224928_228336_-	IscS subfamily cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	28.8	5.7e-37
WP_099323681.1|228356_229358_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_157775636.1|229636_229936_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_164995102.1|229959_230127_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323684.1|230400_230691_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099323685.1|230836_231670_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	45.8	1.2e-54
WP_099323686.1|231716_232187_-	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_099323687.1|232237_235816_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_099323688.1|236109_236829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323689.1|236943_237705_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	34.6	4.8e-13
236972:236994	attR	AGGATAAAATTGTCCATTTGACC	NA	NA	NA	NA
WP_099323690.1|239065_240748_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	443226	514322	4406153	integrase,transposase	Mycobacterium_phage(20.0%)	57	489805:489831	516015:516041
WP_099323573.1|443226_444963_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157820319.1|444999_446541_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_099323854.1|446576_446981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323855.1|447368_448358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323856.1|448748_453491_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_099323857.1|453666_454392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323858.1|454449_454722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323859.1|455107_455293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323860.1|455279_455543_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1C9M026	Mycobacterium_phage	34.5	2.1e-08
WP_099323861.1|455665_456262_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	31.5	2.1e-16
WP_099323862.1|456376_456913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323863.1|457293_457860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995171.1|458521_459553_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_099323866.1|460269_460668_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_099323867.1|460829_461228_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099326945.1|461254_462322_-	NirF protein	NA	NA	NA	NA	NA
WP_099323868.1|462405_463494_-	radical SAM protein	NA	NA	NA	NA	NA
WP_099323869.1|463477_465187_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_157820320.1|465186_465612_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_099326946.1|465682_467500_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_099323872.1|468648_468978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323873.1|469442_469682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323874.1|469959_470229_+	response regulator	NA	NA	NA	NA	NA
WP_099323875.1|470293_470686_+	response regulator	NA	NA	NA	NA	NA
WP_099323876.1|470982_473247_+	PAS domain S-box protein	NA	A0A1V0SL97	Klosneuvirus	26.3	3.9e-10
WP_099323877.1|473375_473945_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_157820321.1|474627_476586_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.7e-22
WP_099323879.1|476612_477485_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099326947.1|477481_478318_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099323880.1|479111_480425_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_099323881.1|481315_484162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323883.1|484479_486474_+	TIGR03663 family protein	NA	NA	NA	NA	NA
WP_157820322.1|486615_487350_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_099323885.1|487516_488719_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_099323886.1|488884_489514_-	hypothetical protein	NA	NA	NA	NA	NA
489805:489831	attL	CGTTGCCATTATTACGTTTATAGACAT	NA	NA	NA	NA
WP_099323887.1|490642_491746_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099323573.1|493140_494877_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099323888.1|496298_497627_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099323889.1|497589_498057_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099323890.1|499080_499347_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_157820323.1|499349_499532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323891.1|499525_500518_-	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_169702847.1|500625_501138_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_099326949.1|501151_501538_-	type II toxin-antitoxin system death-on-curing family toxin	NA	D0R0D2	Streptococcus_phage	29.7	5.5e-13
WP_099323892.1|501537_501765_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_157820324.1|502156_502918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323894.1|502919_503903_-	DevR family CRISPR-associated autoregulator	NA	NA	NA	NA	NA
WP_099323895.1|503905_505612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820325.1|505608_508035_-	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_099323897.1|508031_508871_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_157820326.1|508870_509530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323899.1|510011_510467_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_099323900.1|510570_511548_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_099323529.1|511934_512345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|512450_512723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775550.1|512788_513145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994869.1|513107_514322_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
516015:516041	attR	CGTTGCCATTATTACGTTTATAGACAT	NA	NA	NA	NA
>prophage 5
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	1169152	1220127	4406153	integrase,tRNA,transposase	Acinetobacter_phage(28.57%)	48	1197694:1197715	1214660:1214681
WP_099324396.1|1169152_1171345_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099323925.1|1171730_1172747_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099324397.1|1173337_1174090_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	1.2e-16
WP_099324398.1|1174086_1174893_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_099324399.1|1175034_1175358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324400.1|1175383_1177666_-	molybdopterin-dependent oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	37.4	3.5e-139
WP_099324401.1|1177652_1179071_-	FAD binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	33.4	1.9e-55
WP_099324402.1|1179398_1182677_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_099326984.1|1182930_1183113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324403.1|1183236_1184139_-	flagellin	NA	NA	NA	NA	NA
WP_157820401.1|1184809_1185730_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_099326985.1|1185847_1186354_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_099324405.1|1186486_1186723_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099324406.1|1187171_1187372_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	7.2e-17
WP_157820402.1|1187814_1188267_+	response regulator	NA	NA	NA	NA	NA
WP_099326986.1|1188331_1190146_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.4e-42
WP_099324409.1|1190523_1191642_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_099324410.1|1191677_1192409_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_099324411.1|1192439_1193654_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099324412.1|1193895_1194105_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_099324413.1|1194111_1194324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324414.1|1194624_1194816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820820.1|1194812_1194911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324415.1|1195584_1196013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324416.1|1196012_1196480_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	35.2	2.7e-14
WP_099323535.1|1196498_1196774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820403.1|1196959_1197556_+	hypothetical protein	NA	NA	NA	NA	NA
1197694:1197715	attL	GCAAATGCTTCGCCCCTACTTT	NA	NA	NA	NA
WP_099324418.1|1197716_1199234_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_099323556.1|1199861_1200398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323525.1|1200744_1201536_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_161081507.1|1201538_1202753_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157775550.1|1202715_1203072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|1203137_1203410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|1203515_1203926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324419.1|1205861_1206071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323638.1|1206481_1207585_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_164994612.1|1208191_1208368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323647.1|1208745_1210302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324421.1|1210360_1210567_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_099324422.1|1210579_1210894_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.3	2.0e-13
WP_099324423.1|1211260_1212037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324424.1|1212168_1212354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324425.1|1212429_1213284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324426.1|1213645_1214242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324427.1|1214466_1214625_-	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_099323638.1|1215117_1216221_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
1214660:1214681	attR	AAAGTAGGGGCGAAGCATTTGC	NA	NA	NA	NA
WP_099326987.1|1216660_1218151_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_099324133.1|1218243_1220127_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	1410293	1465357	4406153	protease,transposase	Bacillus_thuringiensis_phage(16.67%)	41	NA	NA
WP_099324570.1|1410293_1410827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099324571.1|1411198_1411732_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099324572.1|1412497_1412980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994542.1|1413217_1413721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324574.1|1413968_1414550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820422.1|1414726_1415188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324577.1|1415982_1416261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172953476.1|1416270_1416537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324579.1|1417040_1418525_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_099324580.1|1418558_1419914_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_099324581.1|1420079_1422155_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_099324582.1|1422186_1422573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324583.1|1422887_1423838_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_099324584.1|1424355_1425306_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.7	6.0e-37
WP_099324585.1|1425804_1426218_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_099324586.1|1426780_1427566_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_099324587.1|1427597_1428554_-	acetyl-CoA decarbonylase/synthase complex subunit delta	NA	NA	NA	NA	NA
WP_099324588.1|1428739_1429510_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099324589.1|1429524_1431459_-	DUF4445 domain-containing protein	NA	NA	NA	NA	NA
WP_099324590.1|1431689_1433030_-	acetyl-CoA decarbonylase/synthase complex subunit gamma	NA	NA	NA	NA	NA
WP_099324591.1|1433874_1434501_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.9	1.0e-24
WP_099324592.1|1434866_1437050_-	CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta	NA	NA	NA	NA	NA
WP_099324593.1|1437079_1439041_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_099324594.1|1439240_1440014_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099326997.1|1440253_1440754_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_099324595.1|1440926_1443617_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_099324596.1|1443924_1445577_-	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_099324597.1|1445756_1446245_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_157820423.1|1446313_1446463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324599.1|1447430_1447799_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_099324600.1|1447966_1450288_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.9	5.3e-95
WP_099324601.1|1450637_1450922_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_099324602.1|1451190_1453317_-	BatA domain-containing protein	NA	NA	NA	NA	NA
WP_099324603.1|1453417_1453831_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_157820424.1|1453808_1454024_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_099324605.1|1454353_1459189_-	glycosyltransferase	NA	A0A218MKE2	uncultured_virus	34.2	8.6e-39
WP_099324606.1|1459465_1460410_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VY82	Leptospira_phage	27.1	2.8e-18
WP_099324607.1|1460765_1461131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994257.1|1461444_1461681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070065843.1|1461945_1463424_-|transposase	ISNCY-like element ISCku10 family transposase	transposase	NA	NA	NA	NA
WP_099324609.1|1464019_1465357_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	4.5e-30
>prophage 7
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	1676436	1740066	4406153	integrase,protease,tRNA,transposase	Staphylococcus_phage(28.57%)	59	1672796:1672817	1723016:1723037
1672796:1672817	attL	AGTGCGACGAGGTTCGTCGCAC	NA	NA	NA	NA
WP_157820454.1|1676436_1677069_-|integrase	site-specific integrase	integrase	T2KT84	uncultured_phage	38.0	1.1e-15
WP_157820455.1|1677364_1677757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324798.1|1677750_1678002_+	chorismate-binding protein	NA	NA	NA	NA	NA
WP_099324799.1|1678015_1678249_+	chorismate-binding protein	NA	NA	NA	NA	NA
WP_099324800.1|1678349_1678541_+	chorismate-binding protein	NA	NA	NA	NA	NA
WP_099324801.1|1678570_1678711_+	chorismate-binding protein	NA	NA	NA	NA	NA
WP_099327008.1|1678793_1678961_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_157820456.1|1679358_1679520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324803.1|1680034_1680427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324804.1|1680614_1681070_-	universal stress protein	NA	NA	NA	NA	NA
WP_099324805.1|1681197_1682208_-	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_099323525.1|1683692_1684484_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_169703201.1|1684486_1685701_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157775550.1|1685663_1686020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|1686085_1686358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|1686463_1686874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324808.1|1688148_1688787_+	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_099324809.1|1688905_1689376_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_157820457.1|1689409_1689535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820458.1|1689741_1690143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323573.1|1690478_1692215_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099324811.1|1692662_1693340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323690.1|1693465_1695148_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157820459.1|1695364_1695529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820460.1|1695653_1695974_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_099324813.1|1696176_1696722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324814.1|1696722_1697340_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_099324815.1|1697474_1698677_+	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_157820461.1|1698681_1699863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820462.1|1699837_1700605_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099324817.1|1700634_1700859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324818.1|1701037_1702291_+	MFS transporter	NA	NA	NA	NA	NA
WP_099327009.1|1702268_1702424_-	TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_157820463.1|1703574_1704621_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099327010.1|1706417_1708028_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_169703199.1|1708302_1710180_-	DUF5069 domain-containing protein	NA	NA	NA	NA	NA
WP_099324821.1|1710393_1711608_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164994474.1|1711824_1714518_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_099324823.1|1716089_1716860_-	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_099324824.1|1717234_1718083_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.3	6.3e-30
WP_099324825.1|1718104_1719385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820464.1|1719494_1720229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327011.1|1720509_1722720_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_099324827.1|1723166_1723409_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
1723016:1723037	attR	GTGCGACGAACCTCGTCGCACT	NA	NA	NA	NA
WP_099324828.1|1723471_1723801_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_099324829.1|1723813_1724062_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_099327012.1|1724353_1725370_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	40.4	6.0e-67
WP_169703198.1|1725554_1726097_+	arginine decarboxylase, pyruvoyl-dependent	NA	NA	NA	NA	NA
WP_099324830.1|1726166_1727402_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_099324832.1|1727877_1729221_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_099324833.1|1729430_1729991_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_099324834.1|1730031_1731168_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.8	2.2e-38
WP_099324835.1|1731345_1731960_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	41.2	2.0e-25
WP_099327014.1|1732979_1733789_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_169703197.1|1734399_1735464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324838.1|1735647_1737222_+	hypothetical protein	NA	A0A1V0SGR3	Hokovirus	28.4	2.8e-07
WP_099324839.1|1737202_1738576_+	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.9	5.0e-08
WP_099324840.1|1738895_1739294_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_157820465.1|1739286_1740066_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	1783942	1825466	4406153	transposase	Wolbachia_phage(33.33%)	31	NA	NA
WP_099323573.1|1783942_1785679_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157820472.1|1785873_1786197_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_157820473.1|1786214_1786496_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099324880.1|1786492_1787917_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	33.3	1.5e-68
WP_099324881.1|1788377_1788719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324882.1|1788881_1789232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099327016.1|1789644_1789899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324884.1|1789924_1790071_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_099324885.1|1790083_1790341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324886.1|1790533_1790734_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_172953478.1|1790946_1791090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820475.1|1791228_1791699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820476.1|1791942_1792836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324889.1|1793438_1793729_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_099326979.1|1793784_1795440_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_076611654.1|1797515_1798619_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099324890.1|1798801_1801114_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099323573.1|1801224_1802961_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157820477.1|1803450_1803600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169703193.1|1803624_1804032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324892.1|1804046_1804715_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_157820478.1|1804826_1805150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324893.1|1805397_1806015_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_099324894.1|1806381_1810044_+	serine/threonine-protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	25.2	2.2e-18
WP_099324895.1|1811006_1812557_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_169703192.1|1812841_1813894_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_099324896.1|1814010_1814778_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_099324897.1|1814944_1816870_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099324898.1|1817009_1818131_-	aminofutalosine synthase MqnE	NA	S4VUH2	Pandoravirus	24.6	2.6e-15
WP_099324899.1|1818814_1823545_-	SBBP repeat-containing protein	NA	NA	NA	NA	NA
WP_099324900.1|1823783_1825466_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	2108188	2156872	4406153	tRNA,transposase	uncultured_virus(27.27%)	49	NA	NA
WP_099325144.1|2108188_2109403_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099325145.1|2109907_2110681_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	28.1	2.1e-19
WP_099325146.1|2110864_2111470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325147.1|2111564_2112371_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_099325148.1|2112840_2114511_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.9	3.2e-158
WP_099325149.1|2114600_2114891_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	42.2	1.4e-16
WP_099325150.1|2114940_2116560_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.3e-166
WP_099325151.1|2117078_2118197_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	4.0e-32
WP_099325152.1|2118273_2118561_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_099325153.1|2118547_2118751_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_099325154.1|2118743_2119949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325155.1|2120093_2121434_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_099327026.1|2121555_2122212_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099325156.1|2122208_2124398_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	40.2	1.4e-121
WP_099325157.1|2124419_2125583_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.2	3.1e-35
WP_099325158.1|2125611_2126058_+	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	58.4	6.1e-32
WP_099325159.1|2126100_2126331_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_099325160.1|2126665_2128348_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325162.1|2130233_2130479_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_099325163.1|2130596_2131586_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VY82	Leptospira_phage	27.8	3.0e-23
WP_099325164.1|2131587_2132526_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099325165.1|2132519_2133281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820507.1|2133486_2133624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325166.1|2134685_2135291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325167.1|2135357_2135972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325168.1|2136129_2137473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325170.1|2137663_2137882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325171.1|2137874_2138375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325172.1|2138620_2138962_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099323573.1|2139026_2140763_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325173.1|2140922_2141615_+	GDP-mannose 4,6-dehydratase	NA	A0A0P0YMS6	Yellowstone_lake_phycodnavirus	36.0	6.1e-23
WP_099325174.1|2141607_2142330_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_099325175.1|2142326_2143475_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_099325176.1|2143474_2144101_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_099325177.1|2144106_2144775_+	WbqC family protein	NA	NA	NA	NA	NA
WP_099325178.1|2144767_2145436_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_099325179.1|2145454_2146486_+	N-acetylneuraminate synthase family protein	NA	NA	NA	NA	NA
WP_099325180.1|2146472_2147201_+	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_099325181.1|2147176_2148220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169703040.1|2148353_2149280_+	radical SAM protein	NA	A0A1B1IVD8	uncultured_Mediterranean_phage	29.5	2.7e-26
WP_099325183.1|2149282_2150167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325184.1|2150168_2151227_+	sulfotransferase	NA	NA	NA	NA	NA
WP_157820508.1|2151836_2152274_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_099325187.1|2152518_2154384_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099325188.1|2154380_2154722_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099325189.1|2154749_2154998_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_099327027.1|2155403_2155637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820509.1|2155627_2155774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325190.1|2155843_2156872_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	2671348	2737373	4406153	protease,tRNA,transposase	Bacillus_phage(27.27%)	52	NA	NA
WP_157820573.1|2671348_2671897_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099325636.1|2672112_2673276_+	RCC1 repeat- and reductase domain-containing protein	NA	NA	NA	NA	NA
WP_099325637.1|2673421_2674348_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_164995544.1|2674372_2674774_-	response regulator	NA	NA	NA	NA	NA
WP_099325639.1|2675191_2677651_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_099325640.1|2677647_2679039_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_099325641.1|2679101_2680088_-	signal peptide peptidase SppA	NA	A0A0A0RQ86	Citrobacter_phage	33.3	5.7e-22
WP_099325642.1|2680365_2680773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325643.1|2681079_2681565_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_099325644.1|2682247_2683321_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_157820575.1|2683383_2684094_+	anion permease	NA	NA	NA	NA	NA
WP_157820576.1|2684148_2684793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323573.1|2684986_2686723_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325647.1|2686813_2687533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995541.1|2687836_2688013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325649.1|2688196_2689999_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	3.3e-52
WP_099325650.1|2690259_2691738_-	pilus assembly PilX N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099325651.1|2691737_2692505_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_099325652.1|2692513_2692885_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_099325653.1|2692905_2693403_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_099325654.1|2693506_2696041_-	hypothetical protein	NA	A7BJX1	Enterobacteria_phage	28.2	5.4e-08
WP_172953486.1|2696191_2696986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325656.1|2697001_2697907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820578.1|2698284_2700018_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_099325658.1|2700073_2701033_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_099325659.1|2701373_2701907_-	CvpA family protein	NA	NA	NA	NA	NA
WP_164995531.1|2701945_2702839_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099325661.1|2703288_2704545_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
WP_099325662.1|2704844_2705087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325663.1|2705568_2708058_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_099327051.1|2708256_2708481_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099325664.1|2708470_2708710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325665.1|2708691_2709339_-	transaldolase	NA	NA	NA	NA	NA
WP_157820579.1|2709740_2712560_+	radical SAM protein	NA	NA	NA	NA	NA
WP_099327052.1|2712667_2713903_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.4	2.5e-112
WP_099325668.1|2714309_2714897_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_099325669.1|2715065_2716019_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_157820580.1|2716308_2719890_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	29.5	2.3e-20
WP_099325671.1|2719904_2721287_+	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	6.8e-05
WP_099325672.1|2721298_2722270_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_164995527.1|2723080_2723260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325673.1|2723364_2723931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820582.1|2723909_2724125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325675.1|2724597_2724819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327053.1|2724882_2725362_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_099325554.1|2725529_2727797_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099325677.1|2728306_2730088_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.4e-49
WP_099325678.1|2730345_2732049_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	58.9	3.5e-189
WP_099325679.1|2732890_2733277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820583.1|2734241_2734973_+	caspase family protein	NA	R9TNL0	Vibrio_phage	54.5	4.4e-72
WP_099325681.1|2734984_2735443_+	hypothetical protein	NA	R9TPU4	Vibrio_phage	43.6	5.5e-28
WP_099323573.1|2735636_2737373_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	2778146	2813153	4406153	integrase,transposase	Virus_Rctr41k(33.33%)	36	2802053:2802072	2816017:2816036
WP_099323887.1|2778146_2779250_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099325705.1|2779552_2780230_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_099325706.1|2780226_2781645_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099325707.1|2781832_2782252_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_099323925.1|2782576_2783593_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157820593.1|2784168_2784411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325708.1|2784443_2786270_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_099325709.1|2786668_2787796_+	transaldolase	NA	NA	NA	NA	NA
WP_157820594.1|2788215_2788395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325711.1|2788455_2789010_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_099325712.1|2789237_2791889_+	glucosidase	NA	NA	NA	NA	NA
WP_099325713.1|2791924_2793031_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_157820595.1|2793470_2793632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820596.1|2793664_2794999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325717.1|2795261_2795714_+	DsrE family protein	NA	NA	NA	NA	NA
WP_099325718.1|2795770_2796442_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_164994264.1|2796605_2796749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325719.1|2796732_2797191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325720.1|2797187_2797637_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099325721.1|2797752_2798283_+	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_099325722.1|2798282_2799413_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_099325723.1|2799485_2799974_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_157820597.1|2800151_2800544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325725.1|2800494_2800692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325726.1|2800817_2801108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325727.1|2801192_2801795_-	cation transporter	NA	NA	NA	NA	NA
2802053:2802072	attL	GGCAAATGCTTCGCCCCTAC	NA	NA	NA	NA
WP_099327058.1|2802472_2803507_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	41.8	1.2e-62
WP_099327059.1|2804421_2805432_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099325728.1|2805613_2805829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820598.1|2805764_2806121_+	TolC family protein	NA	NA	NA	NA	NA
WP_099325730.1|2806709_2806931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325731.1|2806903_2807173_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2P1N333	Gordonia_phage	38.8	4.8e-08
WP_099327060.1|2807424_2808102_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_099323573.1|2808272_2810009_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325732.1|2810146_2811544_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_157820829.1|2812553_2813153_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	40.9	1.4e-31
2816017:2816036	attR	GGCAAATGCTTCGCCCCTAC	NA	NA	NA	NA
>prophage 13
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	2823060	2934410	4406153	integrase,protease,transposase	Ostreococcus_tauri_virus(17.65%)	110	2881099:2881113	2889913:2889927
WP_172953487.1|2823060_2823867_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_099325743.1|2824297_2825893_-	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_099325744.1|2826453_2827437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995483.1|2827768_2828869_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_157820600.1|2829689_2830499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820601.1|2830987_2831911_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_099325748.1|2831945_2832779_-	protein kinase	NA	NA	NA	NA	NA
WP_099325749.1|2833711_2835271_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	39.6	2.0e-66
WP_099325750.1|2835329_2835668_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_099327062.1|2835981_2837277_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.2	9.0e-68
WP_099325751.1|2837798_2838137_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_099325752.1|2838197_2839544_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.7	7.2e-36
WP_099325753.1|2839797_2841348_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.6	3.2e-19
WP_099325754.1|2841466_2843233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325755.1|2843165_2844176_-	cache domain-containing protein	NA	NA	NA	NA	NA
WP_099325756.1|2844371_2845274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325757.1|2845565_2846600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323638.1|2847308_2848412_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099325759.1|2849022_2849454_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_099325760.1|2849644_2850382_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	30.9	5.9e-08
WP_099325761.1|2850597_2851947_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	26.9	1.2e-38
WP_164995774.1|2851949_2852489_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_099327063.1|2852736_2853135_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_099325763.1|2853250_2854348_+	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.5	5.1e-40
WP_099325764.1|2854365_2855451_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.5	6.8e-53
WP_099325765.1|2855787_2856843_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099327064.1|2857475_2857991_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_099325767.1|2858594_2858837_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099325768.1|2858833_2859205_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_164995473.1|2859374_2859578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325769.1|2859694_2860108_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099325770.1|2860390_2860744_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099325771.1|2860938_2861757_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157820603.1|2861859_2862627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325773.1|2862607_2863021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325774.1|2863005_2863707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325775.1|2864012_2865173_+	hypothetical protein	NA	S5VL21	Leptospira_phage	26.8	1.1e-16
WP_099325776.1|2865185_2865536_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099325777.1|2865571_2866732_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.0	9.3e-40
WP_099325778.1|2866728_2867049_+	DsrE family protein	NA	NA	NA	NA	NA
WP_099325779.1|2867321_2868743_+|transposase	IS66-like element ISCku5 family transposase	transposase	NA	NA	NA	NA
WP_099325780.1|2868847_2869465_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099325781.1|2869557_2870394_+	deoxyribonuclease IV	NA	A0A1V0SFR4	Hokovirus	32.1	7.4e-31
WP_099325782.1|2870673_2870886_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099325783.1|2870878_2871904_+	2-oxoglutarate synthase subunit alpha	NA	NA	NA	NA	NA
WP_099325784.1|2871926_2872697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325785.1|2872738_2873038_-	UPF0175 family protein	NA	NA	NA	NA	NA
WP_157820604.1|2873039_2873453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325787.1|2874004_2876458_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099325788.1|2877401_2879012_+	hydroxylamine oxidoreductase	NA	NA	NA	NA	NA
WP_099327065.1|2879386_2880559_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_157820605.1|2880677_2881511_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
2881099:2881113	attL	TCTCATCCAAAAATG	NA	NA	NA	NA
WP_099325790.1|2881738_2882008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325791.1|2882252_2883383_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099323529.1|2883666_2884077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|2884182_2884455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775550.1|2884520_2884877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161081507.1|2884839_2886054_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099323525.1|2886056_2886848_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099325792.1|2886859_2887162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325793.1|2887457_2889290_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325794.1|2890140_2891397_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
2889913:2889927	attR	TCTCATCCAAAAATG	NA	NA	NA	NA
WP_099325795.1|2891763_2892018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325796.1|2892328_2893117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325797.1|2893213_2893816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325798.1|2893888_2894200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325799.1|2894271_2895072_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099325800.1|2895068_2895362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325801.1|2895586_2896981_-	magnesium transporter	NA	NA	NA	NA	NA
WP_099325802.1|2897101_2898292_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_099325803.1|2898403_2899219_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_099325804.1|2899471_2899888_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_099325805.1|2900079_2900685_+	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_157820606.1|2900777_2900939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820607.1|2900958_2901099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820608.1|2901122_2901818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325807.1|2901792_2902521_+	ABC transporter ATP-binding protein	NA	M1I0C3	Paramecium_bursaria_Chlorella_virus	26.1	8.2e-10
WP_099325808.1|2902601_2903609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325809.1|2903679_2904249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325810.1|2904656_2905820_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_099327067.1|2905898_2906924_+	heme transporter CcmC	NA	NA	NA	NA	NA
WP_099325805.1|2907252_2907858_+	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_157820610.1|2907950_2908271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820611.1|2908430_2908991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325807.1|2908965_2909694_+	ABC transporter ATP-binding protein	NA	M1I0C3	Paramecium_bursaria_Chlorella_virus	26.1	8.2e-10
WP_099325808.1|2909774_2910782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325809.1|2910852_2911422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325810.1|2911829_2912993_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_099327067.1|2913071_2914097_+	heme transporter CcmC	NA	NA	NA	NA	NA
WP_099325812.1|2914170_2916600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325813.1|2916759_2917806_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	24.9	1.1e-15
WP_099323535.1|2917893_2918169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325814.1|2918187_2919084_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.6	3.8e-33
WP_099325815.1|2919762_2920026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820612.1|2920534_2920960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994617.1|2920925_2921150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325817.1|2921447_2921654_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157820613.1|2921888_2922179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325819.1|2922372_2922909_-	HPP family protein	NA	NA	NA	NA	NA
WP_157820614.1|2922899_2923058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325820.1|2923643_2923874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325821.1|2924200_2924404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325822.1|2924754_2925969_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_099325823.1|2926121_2928047_+	aconitate hydratase	NA	NA	NA	NA	NA
WP_099325824.1|2928173_2928851_+	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_099325825.1|2928918_2929566_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.5	3.0e-32
WP_157820615.1|2929558_2930599_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_099325827.1|2930732_2931665_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
WP_099325828.1|2931849_2932296_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_099325829.1|2933243_2934410_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3051016	3097729	4406153	transposase	Ralstonia_phage(20.0%)	42	NA	NA
WP_099323887.1|3051016_3052120_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099325920.1|3053622_3053898_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099325921.1|3054159_3055059_-	DUF4438 domain-containing protein	NA	NA	NA	NA	NA
WP_099325922.1|3055500_3056736_+	RCC1 repeat- and reductase domain-containing protein	NA	NA	NA	NA	NA
WP_099325923.1|3057103_3057847_+	MIP family channel protein	NA	NA	NA	NA	NA
WP_099325924.1|3058008_3059727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325925.1|3059744_3060245_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099325926.1|3062019_3062265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327075.1|3062584_3064240_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325927.1|3064320_3065856_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_099325928.1|3066211_3067303_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_099325929.1|3067299_3067545_-	small basic protein	NA	NA	NA	NA	NA
WP_099325930.1|3067561_3068518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325931.1|3068974_3070999_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.6	2.2e-113
WP_099325932.1|3071127_3072489_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_099325933.1|3072489_3073539_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_099325934.1|3073558_3074665_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_099325935.1|3074762_3075008_-	HicB family protein	NA	NA	NA	NA	NA
WP_099325936.1|3075021_3075213_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_099325937.1|3075290_3076166_-|transposase	transposase	transposase	A0A0R6PHP9	Moraxella_phage	40.8	2.6e-50
WP_099325938.1|3076184_3076556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325939.1|3076835_3077234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325940.1|3077526_3077739_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_099325941.1|3077738_3077993_-	toxin HicA	NA	NA	NA	NA	NA
WP_099325942.1|3079013_3080408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325943.1|3081122_3081410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325944.1|3081549_3082191_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	43.1	1.2e-36
WP_099325945.1|3083160_3083493_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_099325946.1|3083485_3083788_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099325947.1|3084190_3084403_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_157820623.1|3085807_3086695_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_099325950.1|3086801_3087983_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	32.3	1.7e-36
WP_099325951.1|3087999_3088923_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_099325952.1|3088927_3089644_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_099325953.1|3089732_3090374_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_099325954.1|3090507_3091299_-	pyruvate synthase	NA	NA	NA	NA	NA
WP_099325955.1|3091304_3092726_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_172953488.1|3093447_3094683_-	pyruvate synthase	NA	NA	NA	NA	NA
WP_099325956.1|3094788_3095280_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_099327077.1|3095542_3096205_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.8	9.3e-37
WP_099325957.1|3096567_3097392_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_157820624.1|3097597_3097729_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3116955	3184891	4406153	protease,tRNA,transposase	Bacillus_virus(12.5%)	59	NA	NA
WP_157820629.1|3116955_3119223_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099325974.1|3119367_3119664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325975.1|3119754_3121779_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_099325976.1|3121790_3124349_-	PglZ domain-containing protein	NA	NA	NA	NA	NA
WP_099325977.1|3124364_3128018_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_099325978.1|3128041_3128419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325979.1|3128406_3128706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325980.1|3129202_3133252_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_099325981.1|3133261_3133840_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_157820630.1|3133814_3134585_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_099325983.1|3135286_3135604_-	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_157820831.1|3136060_3136198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325985.1|3136990_3137152_+	rubredoxin	NA	NA	NA	NA	NA
WP_164995425.1|3137360_3137777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325987.1|3137773_3138718_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	46.3	1.0e-68
WP_099325988.1|3138780_3139224_+	ferritin family protein	NA	NA	NA	NA	NA
WP_099325989.1|3140214_3141660_+	GAF domain-containing protein	NA	A0A1B1IWY2	uncultured_Mediterranean_phage	32.5	6.6e-27
WP_099325990.1|3141681_3142062_+	response regulator	NA	W8CYM9	Bacillus_phage	37.7	1.5e-15
WP_099325991.1|3142206_3142992_+	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
WP_099325992.1|3143017_3144604_+	DUF1957 domain-containing protein	NA	NA	NA	NA	NA
WP_099325993.1|3144657_3145098_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_099325994.1|3145267_3145774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325995.1|3145835_3146303_+	universal stress protein	NA	NA	NA	NA	NA
WP_099327080.1|3146454_3147636_+	methionine adenosyltransferase	NA	NA	NA	NA	NA
WP_099325996.1|3147809_3148469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325997.1|3148581_3151200_-	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_099325998.1|3151642_3153928_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_099325999.1|3154017_3154581_-	LemA family protein	NA	NA	NA	NA	NA
WP_157820633.1|3154802_3155483_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_099326001.1|3155565_3156321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820634.1|3156364_3156616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820635.1|3157048_3157924_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099326004.1|3157920_3158388_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099326005.1|3158393_3158864_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_099326006.1|3159178_3160216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326007.1|3160212_3161088_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_099326008.1|3161164_3161920_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	43.4	3.1e-20
WP_070065843.1|3162170_3163649_-|transposase	ISNCY-like element ISCku10 family transposase	transposase	NA	NA	NA	NA
WP_070065844.1|3163939_3164950_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	5.9e-67
WP_099327081.1|3165409_3167065_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326009.1|3167293_3167746_-	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_099326010.1|3167762_3168248_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_099326011.1|3168819_3169227_-	bifunctional nuclease family protein	NA	NA	NA	NA	NA
WP_099326012.1|3169624_3170464_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_099326013.1|3170460_3171171_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099326014.1|3171181_3171787_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_099326015.1|3171824_3172115_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_099326016.1|3172121_3173210_+	signal peptide peptidase SppA	NA	K4HZZ6	Acidithiobacillus_phage	31.6	2.3e-16
WP_099326018.1|3173411_3174890_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.0	9.0e-56
WP_099326019.1|3174894_3176508_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_099326020.1|3176620_3176875_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_099326021.1|3176909_3177530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326022.1|3178059_3178413_+	DMT family protein	NA	NA	NA	NA	NA
WP_099326023.1|3178493_3179756_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_157820637.1|3179791_3180343_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_099327082.1|3180493_3180919_+	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_099326025.1|3181174_3181861_-	bacillithiol biosynthesis deacetylase BshB1	NA	NA	NA	NA	NA
WP_164995416.1|3182267_3183590_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099326027.1|3183634_3184891_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
>prophage 16
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3271465	3325681	4406153	tRNA,transposase	Tupanvirus(27.27%)	45	NA	NA
WP_099326096.1|3271465_3271891_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	27.4	1.3e-10
WP_099326097.1|3272082_3273507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324900.1|3273827_3275510_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326098.1|3275833_3276730_+	flagellin	NA	NA	NA	NA	NA
WP_099326099.1|3276897_3278685_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_157820833.1|3278754_3279909_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	35.2	2.9e-54
WP_157820645.1|3280111_3280564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326102.1|3280594_3280906_+	flagellar protein FliS	NA	NA	NA	NA	NA
WP_099326103.1|3281045_3281579_+	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_099326104.1|3281764_3283042_-	glycosyltransferase	NA	A0A2K9L5M2	Tupanvirus	23.6	8.7e-07
WP_099326105.1|3283347_3284247_-	flagellin	NA	NA	NA	NA	NA
WP_169704261.1|3284291_3285995_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_099326107.1|3286575_3287184_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099326108.1|3287186_3287819_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099327088.1|3288147_3289560_-	sugar transferase	NA	NA	NA	NA	NA
WP_099326109.1|3289848_3290268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326110.1|3290925_3291225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326111.1|3291513_3293034_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	6.7e-14
WP_099326112.1|3293307_3293640_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_099326113.1|3293835_3296046_-	EAL domain-containing protein	NA	W8CYM9	Bacillus_phage	29.7	1.8e-07
WP_099326114.1|3296271_3298404_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_099326115.1|3299046_3300687_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	37.6	5.1e-36
WP_099326116.1|3300933_3301866_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	34.8	1.1e-46
WP_099326117.1|3302044_3302440_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_099326118.1|3302449_3302884_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_099327089.1|3303347_3303722_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_164995386.1|3303865_3304570_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_099327090.1|3305155_3306754_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	35.8	2.7e-13
WP_099323573.1|3307072_3308809_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326120.1|3309026_3310064_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326121.1|3310095_3310566_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	3.8e-24
WP_099326122.1|3310572_3311118_-	DUF4416 family protein	NA	NA	NA	NA	NA
WP_099326123.1|3311124_3312855_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_157820646.1|3313342_3313861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326125.1|3314773_3315181_+	cytochrome c	NA	NA	NA	NA	NA
WP_099326126.1|3315226_3315607_+	cytochrome c	NA	NA	NA	NA	NA
WP_099326127.1|3315833_3318353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326128.1|3318672_3319209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326129.1|3319277_3319739_-	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
WP_099326130.1|3319735_3320533_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_099326131.1|3320915_3321428_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.4	1.9e-13
WP_099326132.1|3321481_3322444_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	1.7e-10
WP_099326133.1|3322475_3322919_+	DUF116 domain-containing protein	NA	NA	NA	NA	NA
WP_099326134.1|3322899_3324309_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_157820834.1|3324529_3325681_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3329513	3359022	4406153	integrase,tRNA,transposase	Streptococcus_phage(33.33%)	31	3333312:3333327	3348680:3348695
WP_161081507.1|3329513_3330728_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157775550.1|3330690_3331047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|3331112_3331385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|3331490_3331901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326138.1|3332780_3333053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326139.1|3333223_3334561_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	1.1e-28
3333312:3333327	attL	TTTTACCGGTATTGAA	NA	NA	NA	NA
WP_099326140.1|3334956_3335442_+	ferritin family protein	NA	NA	NA	NA	NA
WP_099326141.1|3335925_3336174_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099326142.1|3336175_3336838_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_157820647.1|3337248_3337620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|3337975_3338386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|3338491_3338764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775550.1|3338829_3339186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161081507.1|3339148_3340363_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099323525.1|3340365_3341157_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099326145.1|3342161_3342689_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326146.1|3342871_3345064_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099323679.1|3345152_3345707_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326147.1|3345722_3346364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326148.1|3346473_3346704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820648.1|3346693_3347761_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172953459.1|3347747_3347999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326150.1|3347965_3348145_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099326151.1|3348659_3351161_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.6	8.5e-208
3348680:3348695	attR	TTTTACCGGTATTGAA	NA	NA	NA	NA
WP_157820649.1|3351435_3351897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323535.1|3352105_3352381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326153.1|3352399_3353296_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.3	1.4e-32
WP_099326154.1|3353928_3354264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099327091.1|3354279_3355389_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_099324133.1|3355931_3357815_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326155.1|3357984_3359022_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3677845	3779997	4406153	bacteriocin,integrase,transposase	Lactococcus_phage(10.0%)	90	3699932:3699959	3778679:3778706
WP_099326417.1|3677845_3678625_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099327104.1|3678814_3679114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326418.1|3679692_3679977_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
WP_099326419.1|3680013_3681051_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172953494.1|3681254_3683390_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.1	1.1e-65
WP_099326421.1|3683784_3684729_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_099326422.1|3684916_3686287_-|transposase	IS66-like element ISCku7 family transposase	transposase	NA	NA	NA	NA
WP_099325006.1|3686273_3687155_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_157820691.1|3687860_3688022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326423.1|3688209_3689511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326424.1|3689551_3690346_-	cyclase family protein	NA	NA	NA	NA	NA
WP_099326425.1|3690690_3691719_+	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_099326426.1|3691865_3693227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326427.1|3693276_3694308_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_157820692.1|3694304_3695768_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_099326429.1|3696035_3697745_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	5.0e-18
WP_099326430.1|3697768_3698152_+	response regulator	NA	NA	NA	NA	NA
WP_099326431.1|3698135_3699368_+	glucose-1-phosphate adenylyltransferase	NA	A0A291LA53	Escherichia_phage	26.0	5.6e-11
WP_099326432.1|3699418_3699727_-	hypothetical protein	NA	NA	NA	NA	NA
3699932:3699959	attL	CCCCTGCACCCCCGCCAGCGGGGGACAT	NA	NA	NA	NA
WP_099326433.1|3700309_3701785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326434.1|3701902_3703330_+	FAD-dependent oxidoreductase	NA	I6ZVL5	Aeromonas_phage	24.0	8.8e-08
WP_099326435.1|3703605_3705273_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_099326436.1|3705480_3705900_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_099327105.1|3706111_3707467_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_099326437.1|3707629_3708616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326438.1|3708612_3708942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326439.1|3709593_3711276_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326440.1|3711345_3712320_+	cation transporter	NA	NA	NA	NA	NA
WP_157820694.1|3712392_3713478_+|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_099326442.1|3713481_3716040_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_157820695.1|3716148_3717192_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_099326444.1|3717266_3717584_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_099326445.1|3717995_3718658_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_099326446.1|3718660_3720952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326448.1|3721525_3721996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326449.1|3722171_3723923_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_172953495.1|3723876_3724428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820697.1|3724705_3724819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157820836.1|3724799_3725777_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_099326452.1|3726155_3726395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326453.1|3726410_3726932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820698.1|3728052_3728241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326455.1|3728343_3729537_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_099326456.1|3729941_3730703_+	precorrin-6A reductase	NA	NA	NA	NA	NA
WP_157820699.1|3730800_3730956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326457.1|3731033_3731693_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_099326458.1|3731754_3732912_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_157820700.1|3733024_3734566_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_099326460.1|3734809_3735442_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_099326461.1|3735686_3737237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326462.1|3737596_3737893_-	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_099326463.1|3738302_3738608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326464.1|3738759_3740790_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_099326466.1|3741168_3742452_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326467.1|3742592_3742928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326468.1|3743170_3743497_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_157820701.1|3743705_3743981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099327106.1|3745076_3746300_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	61.1	1.2e-10
WP_099326469.1|3746750_3747011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326470.1|3747059_3747509_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_099326471.1|3747527_3748748_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_099326472.1|3748846_3750085_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_099326473.1|3750090_3751560_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099326474.1|3751564_3753025_+	radical SAM protein	NA	NA	NA	NA	NA
WP_099326475.1|3753212_3754637_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.9	7.4e-39
WP_099326476.1|3754951_3756862_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099323535.1|3757050_3757326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326477.1|3757344_3758241_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.6	1.3e-33
WP_157820703.1|3758904_3759249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820838.1|3759496_3759589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327107.1|3759601_3759838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326479.1|3759972_3761847_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326480.1|3762427_3763351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157820704.1|3763721_3764561_-	alpha/beta fold hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	23.0	1.4e-05
WP_099326482.1|3764884_3766081_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_099326483.1|3766106_3766664_+	elongation factor P	NA	NA	NA	NA	NA
WP_099326484.1|3766879_3767863_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_157820705.1|3767919_3769029_+	glycoside hydrolase family 99-like domain-containing protein	NA	NA	NA	NA	NA
WP_099326486.1|3769018_3769942_+	radical SAM protein	NA	NA	NA	NA	NA
WP_099326487.1|3770067_3770610_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	44.4	3.3e-32
WP_099326488.1|3771008_3771647_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_099326489.1|3771819_3773241_+	DUF4139 domain-containing protein	NA	NA	NA	NA	NA
WP_099326490.1|3773449_3773698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326491.1|3773684_3773879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326492.1|3775609_3776212_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_099326493.1|3776522_3776774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820706.1|3776894_3777146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326495.1|3777233_3777392_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	62.2	1.4e-07
WP_099326496.1|3777700_3778645_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076611654.1|3778893_3779997_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
3778679:3778706	attR	ATGTCCCCCGCTGGCGGGGGTGCAGGGG	NA	NA	NA	NA
>prophage 19
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3791874	3840605	4406153	integrase,tRNA,transposase	Shigella_phage(33.33%)	46	3797447:3797506	3824212:3824316
WP_099326506.1|3791874_3792402_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326507.1|3792412_3792946_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326508.1|3793085_3793238_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099326509.1|3793234_3793414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172953496.1|3793729_3795787_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_164994943.1|3795773_3795941_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_099326511.1|3796807_3797029_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_172953497.1|3797085_3797463_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
3797447:3797506	attL	TAAGGCACTGTAAATAAATAAAGGTATCAAGTAGATCAATTTCATGCTCTGGAAACATGC	NA	NA	NA	NA
WP_099326513.1|3797719_3798688_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_099327112.1|3799210_3799498_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_099326514.1|3799662_3799869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326515.1|3799865_3800555_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_099326516.1|3800812_3801109_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	46.2	9.3e-13
WP_099326517.1|3801782_3802511_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_157820710.1|3802764_3803733_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_164995735.1|3804268_3805000_+	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_099326520.1|3805165_3806239_+	cobalamin biosynthesis protein CbiD	NA	NA	NA	NA	NA
WP_099326521.1|3806223_3806874_+	precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE	NA	NA	NA	NA	NA
WP_157820711.1|3806965_3807121_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_099326522.1|3807289_3807493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326523.1|3807470_3807803_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_099326524.1|3807946_3808741_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_099326525.1|3808816_3809539_+	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_169703238.1|3809886_3813888_+	SBBP repeat-containing protein	NA	NA	NA	NA	NA
WP_099326527.1|3814406_3815510_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099326528.1|3815661_3818910_+	SBBP repeat-containing protein	NA	NA	NA	NA	NA
WP_099326529.1|3819387_3820521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326530.1|3821243_3824183_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_099326531.1|3824213_3826529_+	hypothetical protein	NA	NA	NA	NA	NA
3824212:3824316	attR	GCATGTTTCCAGAGCATGAAATTGATCTACTTGATACCTTTATTTATTTACAGTGCCTTACCTTGAGTTCAGGTAATGGAAATAAGACCGTATACTTTAAGGTTA	NA	NA	NA	NA
WP_157820712.1|3826624_3826855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820713.1|3827186_3827336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326534.1|3827431_3828007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326535.1|3828430_3829525_-	deoxyhypusine synthase	NA	NA	NA	NA	NA
WP_099326536.1|3829730_3830786_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_099326537.1|3830937_3831327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326538.1|3831742_3832759_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_099326539.1|3832817_3833072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326540.1|3833169_3833670_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_099326541.1|3833697_3834885_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_099326542.1|3834977_3835955_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_099326543.1|3836189_3837887_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	36.6	4.4e-91
WP_099327113.1|3838288_3838921_+	endonuclease III	NA	NA	NA	NA	NA
WP_099326544.1|3839101_3839305_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326545.1|3839481_3839820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326096.1|3839887_3840313_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	27.4	1.3e-10
WP_099326546.1|3840377_3840605_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3899042	3947399	4406153	integrase,tRNA,transposase	Streptococcus_phage(33.33%)	52	3902425:3902484	3948487:3949633
WP_099324132.1|3899042_3900413_-|transposase	IS66-like element ISCku7 family transposase	transposase	NA	NA	NA	NA
WP_099325006.1|3900399_3901281_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099326592.1|3902161_3902440_-	hypothetical protein	NA	NA	NA	NA	NA
3902425:3902484	attL	TTGCTAAGCCCCACAATAAATGAACCTGGAATTCTCAGATTAAGTGGAATTAATATATTG	NA	NA	NA	NA
WP_099323525.1|3902777_3903569_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099323532.1|3903571_3904156_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_157775553.1|3904321_3904786_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157775550.1|3904748_3905105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|3905170_3905443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|3905548_3905959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326593.1|3907086_3908196_+	peptidase C39 family protein	NA	NA	NA	NA	NA
WP_099326594.1|3908275_3909778_+	RimK family protein	NA	NA	NA	NA	NA
WP_099326595.1|3909839_3910490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326596.1|3910709_3911627_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_099326597.1|3911678_3912830_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_099326598.1|3912967_3913993_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_099326599.1|3913994_3914672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326600.1|3914731_3914950_-	NifU family protein	NA	NA	NA	NA	NA
WP_099326601.1|3914968_3915193_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_099326602.1|3915444_3916341_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_099326603.1|3916566_3917859_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_099326604.1|3917925_3918603_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2I2L6M4	Escherichia_phage	31.4	5.6e-21
WP_099326605.1|3918606_3919242_-	radical SAM protein	NA	S4TZT1	uncultured_phage	38.5	1.1e-31
WP_099323544.1|3919553_3920891_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	7.7e-30
WP_099327116.1|3921085_3921559_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_099326606.1|3921997_3922213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326607.1|3922199_3922763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820723.1|3922937_3923093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326608.1|3923353_3924085_-	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_099326609.1|3924138_3924504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326610.1|3924771_3925179_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_099326611.1|3925511_3927218_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099326612.1|3927518_3927788_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099326613.1|3927784_3928048_+	DNA helicase	NA	NA	NA	NA	NA
WP_099326614.1|3928153_3929659_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	1.8e-06
WP_099326615.1|3929663_3931148_+	shikimate dehydrogenase	NA	W6LP76	Streptococcus_phage	26.8	1.6e-12
WP_099326616.1|3931246_3931810_+	shikimate kinase	NA	NA	NA	NA	NA
WP_099326617.1|3931899_3932202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326618.1|3932782_3933136_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_099326619.1|3933267_3935400_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_099326620.1|3935532_3936081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820724.1|3936113_3936854_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_099326622.1|3937249_3937648_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_099326623.1|3937671_3939153_+	radical SAM protein	NA	NA	NA	NA	NA
WP_099326624.1|3939256_3940468_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_099326625.1|3940486_3941722_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_099326626.1|3941786_3942134_-	GxxExxY protein	NA	A0A0P0YNF4	Yellowstone_lake_phycodnavirus	32.9	4.4e-06
WP_099323638.1|3942665_3943769_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099326627.1|3943944_3944748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|3945011_3945422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|3945527_3945800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775550.1|3945865_3946222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161081507.1|3946184_3947399_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
3948487:3949633	attR	CAATATATTAATTCCACTTAATCTGAGAATTCCAGGTTCATTTATTGTGGGGCTTAGCAATTACCCCTTTTCCCTTCGTGATGTATGTTCAAACGCATTAACCAGAGATGGTTTTACTTAATCTGTTTATCCATCTCCAACAAAGGACATTGTCAGTGCTTCGCTGAGAAATGGCAGTTGGCACGGAATAACACGCCACACTCATACACCCCAAAAGGTCGTCTGTACCTCGTAACTCCGTCATACCCCTCACGGGTATATGCTATCTTTCTACGCATACGGATTGCTCCATTGTGTGCGCATAGGCACAAACTTCTCTACGAGGATTAGGCTCGCAGAGGTGGTATTTTCAACCACTCAGGTATTCCATACTTCAAGGCACACACAACTCTATGTCTTCTAACCGCACATTCCCTGAAAGCACTATGATCCGAAACCGTTTCTCTATTTTCCGTTTCCTTTCACTATCTTAACCAGTAAATTCAGGCATTTCAACCTACTTTAACTCTCTCAGATTAAAAAATTACGCTTGTTTTAGGATTAGATCCATCCCATGAGGAGAATTATCAAATTCCCCTCATGAGAGGGATTGGGATGAGTAAAAATGAATGCCGTTGGGTTTTTGCCTTTTAAAAACTCAGCCTAATTTCAGAACCCAGGAAGTGCCTTTTTAGTCAAAAAGTATGTAAGCTATTGAATTGTGTAGAGATAGGTGTATATAGAGAGAAGGCATTGCCATACGTGGGTGGAAAATGATATGATCCCTTTTTTTCGGAGAAAGGGCGGGTACTCATGCCACAGTTAGTATTACCCCTATTTTCCCCTGACTGCAAACTGATAAATAATCAGGTAGGTTTTGAGAAAATAGGTAGCAAGATATATTATTTTCACGGAAGACTTCCTGTGTTTAGTCATGAGGAAGACGACCTGGAATCATTTCGGTTCATCACCAGTCAATTAGTAGTCGGCGGTAATGTCAAGCAACAACAAATAGTGAAGGCCTTCGGTGTTTCGGCAATAAGTGTTAAGCGTAGTGTAAAGCGGCTAAGAGAACATGGGCCTAAGGGATTTTTCCGTCAGTCAGCGCGAACAAGGTCAGCCCATGTGCTTACGCCAGAGGTAAAAGCGAAGGTGCAAAAGTGCCTGG	NA	NA	NA	NA
>prophage 21
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	3952161	4006199	4406153	integrase,transposase	Catovirus(25.0%)	44	3942569:3942593	4006366:4006390
3942569:3942593	attL	GCCCCATAAGCGCTAACTTGTTTTA	NA	NA	NA	NA
WP_099326629.1|3952161_3952416_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326631.1|3954409_3955561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327117.1|3956158_3964723_+	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
WP_099326632.1|3965281_3966373_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	29.0	1.1e-31
WP_099326633.1|3966557_3967367_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_099326634.1|3967360_3968119_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_099326635.1|3968260_3969298_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_099326636.1|3969294_3970122_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_099326637.1|3970118_3970859_+	NADH:ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_099326638.1|3970878_3972168_+	Ni/Fe hydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_099326639.1|3972567_3973962_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099323525.1|3974292_3975084_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_161081507.1|3975086_3976301_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157775550.1|3976263_3976620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|3976685_3976958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|3977063_3977474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326640.1|3978336_3979068_+	EcsC family protein	NA	NA	NA	NA	NA
WP_099323573.1|3979279_3981016_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326641.1|3981175_3983344_+	dynamin family protein	NA	NA	NA	NA	NA
WP_099326642.1|3983340_3983991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326643.1|3983987_3987131_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_099326644.1|3987151_3987718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326645.1|3987719_3988295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326646.1|3988348_3988858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326647.1|3989017_3989272_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_099326648.1|3989271_3989541_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_099326649.1|3989873_3990149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326650.1|3990401_3990884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326120.1|3991446_3992484_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326651.1|3992615_3992912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326652.1|3993024_3993210_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326653.1|3993357_3993561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172953499.1|3993547_3993700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326654.1|3993719_3993920_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_157820725.1|3996031_3996343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326656.1|3996489_3996792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326657.1|3997018_3997774_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	1.6e-24
WP_099326658.1|3997866_3999372_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099326659.1|3999378_3999945_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_099326660.1|4000104_4001541_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	34.8	1.5e-63
WP_099326661.1|4001577_4003275_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	37.0	3.0e-39
WP_099326662.1|4003443_4004154_-	endonuclease V	NA	NA	NA	NA	NA
WP_157820726.1|4004406_4004565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323887.1|4005095_4006199_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
4006366:4006390	attR	TAAAACAAGTTAGCGCTTATGGGGC	NA	NA	NA	NA
>prophage 22
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	4032708	4229910	4406153	integrase,protease,tRNA,transposase	Streptococcus_phage(14.29%)	167	4140460:4140519	4170602:4171053
WP_099323988.1|4032708_4034046_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
WP_099326681.1|4034887_4035844_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_157820728.1|4035969_4036554_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_099326683.1|4036573_4036792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326684.1|4036805_4039502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820729.1|4039507_4040110_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_099326686.1|4040686_4041022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326687.1|4041063_4042446_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326688.1|4042506_4042857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323535.1|4043045_4043321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323530.1|4043339_4044236_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.6	1.3e-33
WP_076612121.1|4045929_4047384_+|transposase	IS66-like element ISCku6 family transposase	transposase	NA	NA	NA	NA
WP_099326690.1|4048456_4049761_+	TolC family protein	NA	NA	NA	NA	NA
WP_172953500.1|4049795_4051247_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099326692.1|4051251_4054404_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.6	3.0e-77
WP_099327119.1|4054541_4054871_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	36.8	1.2e-13
WP_099326693.1|4055087_4055477_-	virulence RhuM family protein	NA	NA	NA	NA	NA
WP_099326694.1|4055884_4056097_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099326695.1|4056156_4057926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326696.1|4058777_4059521_-	winged helix-turn-helix transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	28.3	1.5e-14
WP_157820730.1|4059477_4060116_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_099326698.1|4060141_4060579_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_099326699.1|4060579_4060861_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_157820731.1|4060993_4061149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820732.1|4061480_4061876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326702.1|4062236_4063529_+	TolC family protein	NA	NA	NA	NA	NA
WP_157820733.1|4063609_4065142_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099326704.1|4065176_4065527_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_099326705.1|4065628_4068748_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.0	1.0e-77
WP_099326706.1|4069187_4070027_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	27.1	3.2e-18
WP_157820734.1|4070553_4070721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327120.1|4070786_4071881_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.3	2.0e-44
WP_099327121.1|4071892_4073161_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_099326707.1|4073501_4075478_+	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_099326708.1|4076216_4076426_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_099323544.1|4076828_4078166_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	7.7e-30
WP_099326710.1|4078395_4079370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326711.1|4079576_4080200_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_099326712.1|4080246_4081146_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_099327122.1|4081146_4082682_-	alternate F1F0 ATPase, F1 subunit alpha	NA	NA	NA	NA	NA
WP_099326713.1|4082690_4083458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326714.1|4083457_4083739_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_099326715.1|4083745_4084456_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_157820735.1|4084469_4084775_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_099326717.1|4084828_4085143_-	AtpZ/AtpI family protein	NA	NA	NA	NA	NA
WP_099326718.1|4085135_4085528_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_169702823.1|4085524_4086913_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_099326719.1|4087353_4088463_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_099327124.1|4088588_4090160_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_099326720.1|4090152_4092549_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_099326721.1|4092736_4094422_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.6	1.6e-45
WP_099326722.1|4095036_4096278_+	aspartate kinase	NA	NA	NA	NA	NA
WP_099327125.1|4096274_4097351_-	radical SAM protein	NA	NA	NA	NA	NA
WP_099327126.1|4097914_4099486_+	citramalate synthase	NA	NA	NA	NA	NA
WP_099327127.1|4099566_4102251_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	44.3	1.9e-184
WP_172953501.1|4102396_4103686_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_099323544.1|4103820_4105158_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	7.7e-30
WP_099326725.1|4105928_4106852_+	agmatinase	NA	NA	NA	NA	NA
WP_099326726.1|4108722_4110477_-	hydroxylamine oxidoreductase	NA	NA	NA	NA	NA
WP_157820736.1|4110560_4111652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326727.1|4111689_4112412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326728.1|4112453_4113224_-	cytochrome b N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099326729.1|4113306_4115052_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099326730.1|4115086_4115608_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_169702827.1|4115971_4116217_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_099326731.1|4116262_4116682_-	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_099327130.1|4116723_4117638_-	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	37.3	4.4e-45
WP_099326732.1|4117671_4118091_-	DsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
WP_099327131.1|4118104_4118995_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099326733.1|4119141_4119780_-	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_099326734.1|4119793_4121083_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_099326735.1|4121088_4122471_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_099326736.1|4122761_4123097_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_099326737.1|4124047_4124494_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_099326738.1|4124486_4124723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326739.1|4124817_4125102_-	addiction module protein	NA	NA	NA	NA	NA
WP_099326740.1|4125347_4125530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326741.1|4125610_4125916_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_099326742.1|4125912_4126134_-	addiction module protein	NA	NA	NA	NA	NA
WP_099326743.1|4126611_4126878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326744.1|4127609_4127831_-	addiction module protein	NA	NA	NA	NA	NA
WP_099327132.1|4128124_4128334_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_099326745.1|4128381_4128690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326746.1|4128806_4129844_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326747.1|4131061_4131328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326748.1|4132032_4132848_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	8.0e-14
WP_099327133.1|4133005_4133947_-	hypothetical protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	37.4	6.4e-31
WP_099326749.1|4134207_4135836_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.3	1.6e-42
WP_099326750.1|4135966_4136422_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_099326751.1|4136384_4136573_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_157820737.1|4136886_4137036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326752.1|4137813_4138083_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099326753.1|4138444_4138693_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_099326755.1|4139743_4140847_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
4140460:4140519	attL	TATAATGAATGCGCCAAAGACTTCCTGTTTTCCCAGGTTCCTTTACTGTTGTTGCATCAA	NA	NA	NA	NA
WP_157820738.1|4141175_4142189_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099326757.1|4142160_4143201_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_099326758.1|4143182_4144001_+	UDP-2,3-diacylglucosamine diphosphatase LpxI	NA	NA	NA	NA	NA
WP_157820739.1|4144290_4144914_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_099326760.1|4145738_4146869_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099327134.1|4147097_4148234_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099327135.1|4148330_4149317_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.9	3.0e-23
WP_099326761.1|4149327_4150257_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	2.2e-23
WP_099326762.1|4150262_4151261_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099326764.1|4151813_4152047_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_099326695.1|4152976_4154746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326765.1|4154845_4155427_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326766.1|4155567_4155849_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099325925.1|4156102_4156603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326767.1|4156620_4157430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323638.1|4158436_4159540_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099323525.1|4160080_4160872_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_099323532.1|4160874_4161459_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_157775553.1|4161624_4162089_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157775550.1|4162051_4162408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|4162473_4162746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323529.1|4162851_4163262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820740.1|4164449_4164899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326769.1|4164977_4166414_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326770.1|4166713_4167079_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326771.1|4167490_4168228_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_099324671.1|4169551_4170589_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326772.1|4171247_4173287_+	ammonium transporter	NA	A0A1V0SGX0	Hokovirus	38.6	1.1e-35
4170602:4171053	attR	TATAATGAATGCGCCAAAGACTTCCTGTTTTCCCAGGTTCCTTTACTGTTGTTGCATCAAATAAGCGAAGATGAAAATTATTCCGTTTATTAATTTGGAGGCCACGCTCACGGAATAAAGATAAACATAATTTATATAGCCATTCTTTGCTCTTTTTTAATCGCTTTAATAAGGCAACATCGGATAAATCTGCTAAGTTAGCACGCTTGGCTCGAACTACTGTTTCACGCAATGAATAGCCACATCCTAAATGAATTAATAATGTTCGAAGAAGCTTTTCTTCAGATTTATCCTTGCGCAAGCCTTTTAAAGCATTTGTATCAACGGCTAAACTTTTCCAATCGTTTGGGAAGAAAGTTCTTAGAAGATCCCAATCTTCTCTCATCATGGCTTTATCCTCCTATAGAGTGATTAGCGGGATAATTAATATAAAAATACCATGATGAATAAAA	NA	NA	NA	NA
WP_157820741.1|4173633_4173834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820742.1|4173982_4175206_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_099326467.1|4175553_4175889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326687.1|4175930_4177313_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326774.1|4177727_4177928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326776.1|4178623_4178932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326777.1|4179136_4180873_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	27.5	2.7e-19
WP_099326778.1|4181524_4182694_-	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	31.4	8.7e-46
WP_099326779.1|4182789_4183107_-	adenylylsulfate reductase	NA	NA	NA	NA	NA
WP_099326780.1|4183106_4184780_-	adenylyl-sulfate reductase subunit alpha	NA	NA	NA	NA	NA
WP_157820743.1|4185200_4185674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327136.1|4185715_4186039_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099326782.1|4186234_4187521_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_099326783.1|4187553_4188042_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_099326784.1|4188034_4188319_-	PqqD family protein	NA	NA	NA	NA	NA
WP_099323534.1|4188464_4189496_-	radical SAM protein	NA	NA	NA	NA	NA
WP_099323925.1|4189763_4190780_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099326785.1|4191924_4192911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820744.1|4193131_4193308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326786.1|4193404_4195330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172953502.1|4195390_4200085_-	SBBP repeat-containing protein	NA	NA	NA	NA	NA
WP_099326788.1|4200898_4202272_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099323529.1|4203955_4204366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131493604.1|4204471_4204744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157775550.1|4204809_4205166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172953460.1|4205128_4206343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323525.1|4206345_4207137_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099323638.1|4207583_4208687_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099323925.1|4209091_4210108_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099325441.1|4211459_4212398_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099326789.1|4212391_4213153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326790.1|4213230_4213722_+	SBBP repeat-containing protein	NA	NA	NA	NA	NA
WP_099326791.1|4213709_4214372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820746.1|4214368_4214533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820747.1|4214519_4214945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326793.1|4215224_4215896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326789.1|4216292_4217054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326794.1|4217047_4217965_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099326795.1|4218818_4220105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326796.1|4220471_4220717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326797.1|4220969_4221203_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099326798.1|4221363_4224642_-	SBBP repeat-containing protein	NA	NA	NA	NA	NA
WP_099326799.1|4225027_4226092_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_099327137.1|4226130_4227501_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_099326800.1|4228872_4229910_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_LT934425	Candidatus Kuenenia stuttgartiensis isolate kuenenia_mbr1_ru-nijmegen chromosome Kuenenia_stuttgartiensis_MBR1	4406153	4258555	4384721	4406153	integrase,transposase	Burkholderia_virus(27.27%)	111	4314554:4314571	4390247:4390264
WP_099326027.1|4258555_4259812_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
WP_157820760.1|4260389_4260767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326818.1|4262105_4262231_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_099326819.1|4262531_4263251_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_099326820.1|4263256_4264135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327138.1|4266943_4268218_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	45.5	1.3e-100
WP_099326821.1|4268772_4268961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326822.1|4268957_4269980_-	cache domain-containing protein	NA	NA	NA	NA	NA
WP_099326823.1|4270188_4270836_-	fructose-6-phosphate aldolase	NA	M1PR54	Cyanophage	46.3	1.3e-46
WP_099326824.1|4270897_4271908_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_099326825.1|4271888_4272410_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_157820762.1|4272543_4273299_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_099326827.1|4275984_4276542_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_099326828.1|4276581_4277970_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_099326829.1|4278692_4279343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326830.1|4279817_4280210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326831.1|4280206_4280416_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_099326832.1|4280513_4280723_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_157820766.1|4280679_4280832_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_099326833.1|4280809_4282339_-	glucose-6-phosphate dehydrogenase	NA	M1UG55	Synechococcus_phage	36.5	5.6e-85
WP_099326834.1|4282340_4283759_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	25.6	4.2e-34
WP_099326835.1|4283810_4284953_-	transaldolase	NA	NA	NA	NA	NA
WP_099326837.1|4285179_4285620_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_099326838.1|4285668_4287675_-	transketolase	NA	NA	NA	NA	NA
WP_099327139.1|4287873_4288326_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_099323573.1|4289382_4291119_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157820768.1|4291288_4291426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326839.1|4292200_4292419_-	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_099326840.1|4292862_4293102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326841.1|4293854_4295372_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099326842.1|4295371_4296121_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	4.9e-18
WP_099326843.1|4296459_4297917_-	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_099326844.1|4297903_4299541_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_099326845.1|4299537_4301418_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_099326846.1|4301419_4301728_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_099327140.1|4301724_4302279_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_099326847.1|4302303_4302819_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_099326848.1|4302854_4303811_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_099326849.1|4304310_4307025_-	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_099327141.1|4307028_4308303_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_099326850.1|4308308_4308773_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_099326851.1|4308788_4310534_-	NADH-quinone oxidoreductase subunit C/D	NA	NA	NA	NA	NA
WP_099326852.1|4310568_4311207_-	NADH-quinone oxidoreductase subunit NuoB	NA	NA	NA	NA	NA
WP_099326853.1|4311213_4311630_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_099326855.1|4311932_4313603_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099326856.1|4313852_4314176_-	hypothetical protein	NA	NA	NA	NA	NA
4314554:4314571	attL	CAAAAGAAGGCAAAAAGA	NA	NA	NA	NA
WP_099326342.1|4315182_4316439_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
WP_099326857.1|4317290_4319165_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326858.1|4319151_4319526_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326979.1|4320287_4321943_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172953505.1|4322622_4324035_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_157820770.1|4324116_4324356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326860.1|4325097_4325298_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_099327142.1|4325313_4325520_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_099323887.1|4326204_4327308_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_157820771.1|4327631_4327958_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_099326653.1|4327944_4328148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326862.1|4328470_4328794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157820772.1|4329105_4329975_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099325441.1|4330015_4330954_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_157820773.1|4330947_4331709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326865.1|4332022_4334215_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157820774.1|4334369_4334840_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_099326867.1|4335054_4336338_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326869.1|4336796_4337285_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099326870.1|4337743_4337986_+	YggT family protein	NA	NA	NA	NA	NA
WP_157820775.1|4338343_4339612_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_099326872.1|4339631_4340855_+	U32 family peptidase	NA	Q6DW11	Phage_TP	34.1	9.7e-48
WP_099326873.1|4340981_4342022_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_099326874.1|4342045_4342759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326875.1|4342974_4343649_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099326695.1|4343995_4345765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326876.1|4345846_4345987_-	HicB family protein	NA	NA	NA	NA	NA
WP_099326877.1|4345988_4346663_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326027.1|4346687_4347944_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
WP_099326878.1|4348064_4348415_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099325160.1|4348546_4350229_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099324900.1|4350737_4352420_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157820776.1|4352587_4352758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326879.1|4352758_4352941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326880.1|4352937_4353462_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_099326881.1|4353888_4354827_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099326882.1|4354820_4355582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820778.1|4356883_4357495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326884.1|4358061_4360629_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_099326885.1|4360629_4361160_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_099323647.1|4361337_4362894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323573.1|4363196_4364933_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_157820779.1|4365156_4365570_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_099326888.1|4365893_4366718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326889.1|4366710_4367739_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	52.0	9.9e-86
WP_157820845.1|4367731_4368184_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_099326890.1|4368486_4369503_-	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_157820781.1|4369523_4370918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326892.1|4371650_4372496_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_157820782.1|4372536_4373265_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_099326894.1|4373959_4374646_+	MIP family channel protein	NA	NA	NA	NA	NA
WP_164994983.1|4374749_4375403_+	endonuclease III	NA	NA	NA	NA	NA
WP_099326896.1|4375486_4376371_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_099326897.1|4376579_4377416_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_099326898.1|4377864_4378500_+	HNH endonuclease	NA	H6WG01	Cyanophage	31.1	1.3e-16
WP_157820783.1|4378599_4379655_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_099326900.1|4379669_4379840_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099326901.1|4380011_4380983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326902.1|4380975_4381620_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_099326903.1|4381756_4382026_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_157820789.1|4382027_4382237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326905.1|4382482_4383172_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_157820790.1|4383241_4384198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820792.1|4384356_4384488_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_157820793.1|4384484_4384721_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
4390247:4390264	attR	TCTTTTTGCCTTCTTTTG	NA	NA	NA	NA
