The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906434	Neisseria zoodegmatis strain NCTC12230 chromosome 1	2552522	142061	160841	2552522	terminase,transposase	Mannheimia_phage(18.75%)	31	NA	NA
WP_085364250.1|142061_143033_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	5.4e-33
WP_085364266.1|143606_144494_-	S24 family peptidase	NA	A0A2I7S9A5	Vibrio_phage	29.8	1.3e-09
WP_054599816.1|144829_145075_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085364249.1|145071_147210_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1C6ZDN4	Pseudomonas_phage	39.1	1.2e-122
WP_085364248.1|147439_148159_+	ATP-binding protein	NA	L7P7S2	Pseudomonas_phage	55.7	2.2e-63
WP_085364247.1|148155_148713_+	hypothetical protein	NA	M4SNW4	Rhodobacter_phage	33.0	8.1e-18
WP_085364265.1|148720_149026_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085364246.1|149103_149343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364245.1|149694_150162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157739131.1|150163_150754_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	35.9	1.6e-19
WP_085364243.1|150750_151581_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	50.0	5.1e-32
WP_157739132.1|151574_151724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364242.1|151728_152256_+	hypothetical protein	NA	C9DGL8	Escherichia_phage	43.9	9.4e-32
WP_157739133.1|152255_152432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364241.1|152474_152768_+	hypothetical protein	NA	A0A289ZTW9	Serratia_phage	46.4	7.1e-13
WP_054599803.1|152774_152981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054599802.1|152993_153206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364240.1|153335_153956_+	hypothetical protein	NA	A0A1B3B253	Gordonia_phage	41.0	5.3e-10
WP_085364239.1|154170_154527_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	42.6	1.2e-17
WP_085417944.1|154733_155195_+	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	35.2	1.7e-13
WP_085364237.1|155218_155428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364236.1|155706_156330_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	59.5	5.1e-53
WP_085364235.1|156329_156551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364233.1|156726_156960_+	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	43.1	4.3e-05
WP_085364232.1|156940_157360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364264.1|157379_157607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364263.1|157956_158217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364230.1|158213_158432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364229.1|158433_158937_+	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	39.5	8.9e-32
WP_085364228.1|158948_159200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085364227.1|159212_160841_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	60.4	1.1e-179
>prophage 2
NZ_LT906434	Neisseria zoodegmatis strain NCTC12230 chromosome 1	2552522	486751	555908	2552522	coat,holin,protease,transposase	Tupanvirus(12.5%)	56	NA	NA
WP_085363686.1|486751_487777_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_143773803.1|487755_490329_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_095197822.1|490369_491095_-	molecular chaperone	NA	NA	NA	NA	NA
WP_085356796.1|491302_491902_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_085363688.1|492100_492775_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_085363689.1|493042_493543_-	cytochrome c	NA	NA	NA	NA	NA
WP_054600053.1|493909_495163_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_054600034.1|495355_495808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085363690.1|496227_498555_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	38.6	6.5e-101
WP_085363691.1|500184_500922_+	pirin family protein	NA	NA	NA	NA	NA
WP_004284755.1|501013_501622_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004284753.1|501752_502436_+	hydrolase	NA	NA	NA	NA	NA
WP_004284751.1|502522_502744_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_085363692.1|502744_504637_+	amidohydrolase	NA	NA	NA	NA	NA
WP_085363693.1|504797_505697_+	pirin family protein	NA	NA	NA	NA	NA
WP_085363694.1|506067_507669_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	24.3	6.8e-09
WP_085363695.1|507933_508497_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_085363696.1|508598_509243_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_085363697.1|509412_509793_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_085363698.1|509869_510307_-	cytochrome c	NA	NA	NA	NA	NA
WP_085363699.1|510625_511879_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	43.7	2.2e-07
WP_085363700.1|512106_512775_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085363701.1|512863_513436_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_085363702.1|513688_514582_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.8	1.0e-22
WP_085363703.1|514663_515743_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_085363704.1|515901_516867_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_085363705.1|517010_518429_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_158087793.1|518745_520038_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_085363707.1|523065_524250_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_143773804.1|524366_524585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085363708.1|524561_525338_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_085363709.1|525413_525869_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_085363710.1|525871_526927_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_085363711.1|527021_527534_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_085363712.1|527568_529968_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_085363741.1|529973_531314_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_085363713.1|531538_532729_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_085363714.1|532802_533561_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_085363715.1|533608_534406_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_085363716.1|534409_535159_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.6	1.1e-17
WP_054600055.1|535301_535859_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_085363717.1|536103_536292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085363718.1|536478_538986_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157739142.1|539193_540159_-	DUF4349 domain-containing protein	NA	NA	NA	NA	NA
WP_085356680.1|540208_540787_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_085363720.1|541006_541210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085363721.1|541374_542100_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_085363722.1|542242_543097_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_054600429.1|543370_544090_+	UMP kinase	NA	NA	NA	NA	NA
WP_095197823.1|544311_546588_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_054600044.1|546765_547449_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_085363724.1|547781_549245_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085363725.1|549331_549610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085363726.1|549682_551542_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.7	1.2e-49
WP_085363727.1|552030_553719_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.7	2.4e-52
WP_085363728.1|553895_555908_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	23.7	2.1e-15
>prophage 3
NZ_LT906434	Neisseria zoodegmatis strain NCTC12230 chromosome 1	2552522	970326	978891	2552522		Gordonia_phage(16.67%)	8	NA	NA
WP_085364004.1|970326_971682_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	28.9	4.7e-35
WP_085364003.1|971999_973538_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.7	7.5e-13
WP_169709797.1|973751_973910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085364002.1|974190_976656_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	2.6e-68
WP_095197902.1|976691_976967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085364000.1|977104_977737_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1V0DYC7	Dinoroseobacter_phage	34.8	3.1e-13
WP_085363999.1|977741_978164_-	6-carboxytetrahydropterin synthase QueD	NA	E7DN67	Pneumococcus_phage	43.9	1.2e-24
WP_085363998.1|978240_978891_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	53.5	4.7e-57
>prophage 4
NZ_LT906434	Neisseria zoodegmatis strain NCTC12230 chromosome 1	2552522	1060452	1070125	2552522	tRNA,integrase	Salicola_phage(16.67%)	8	1055609:1055628	1075454:1075473
1055609:1055628	attL	GGGTTTTGCAAAGGTCTCAG	NA	NA	NA	NA
WP_085363893.1|1060452_1061316_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	4.2e-45
WP_085363892.1|1061382_1061883_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_085363891.1|1062278_1063175_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.7	1.8e-22
WP_085363889.1|1063473_1064997_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.7	2.0e-82
WP_085363888.1|1065559_1066636_-	peptide chain release factor 1	NA	G0YKC3	Acinetobacter_phage	45.5	5.3e-05
WP_085363887.1|1067073_1067400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054598949.1|1067383_1067686_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.5	6.8e-11
WP_085363886.1|1067761_1070125_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.6	3.0e-05
1075454:1075473	attR	CTGAGACCTTTGCAAAACCC	NA	NA	NA	NA
>prophage 5
NZ_LT906434	Neisseria zoodegmatis strain NCTC12230 chromosome 1	2552522	2041076	2050175	2552522		Tupanvirus(33.33%)	9	NA	NA
WP_085363658.1|2041076_2041835_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.3	4.5e-19
WP_085363659.1|2041976_2042819_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_085363660.1|2042808_2043525_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_085363661.1|2043534_2044293_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	2.1e-37
WP_085363662.1|2044557_2046711_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	33.8	7.8e-08
WP_085363663.1|2046736_2046943_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_085363664.1|2047003_2047621_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	34.3	3.9e-13
WP_085363665.1|2047809_2048373_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.7	1.8e-33
WP_085363666.1|2048546_2050175_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.5	2.4e-57
>prophage 6
NZ_LT906434	Neisseria zoodegmatis strain NCTC12230 chromosome 1	2552522	2063909	2073651	2552522	protease	uncultured_Mediterranean_phage(33.33%)	12	NA	NA
WP_085364449.1|2063909_2064569_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.8	2.2e-30
WP_085364450.1|2064568_2065321_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.4	5.4e-65
WP_085364451.1|2065600_2066749_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_085364464.1|2066846_2068412_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.3	3.1e-22
WP_085364452.1|2068553_2068892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085364453.1|2068967_2069417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085364454.1|2069487_2069934_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.5	1.3e-26
WP_085364455.1|2070020_2070236_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_085364465.1|2070238_2070463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002217533.1|2070611_2070815_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	78.8	3.4e-22
WP_085364456.1|2071056_2071371_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_085364457.1|2071371_2073651_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.5	7.4e-166
