The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906481	Corynebacterium urealyticum strain NCTC12011 chromosome 1	2377532	940116	998459	2377532	protease,portal,capsid,integrase	Corynebacterium_phage(22.22%)	58	963927:963967	998599:998639
WP_012360626.1|940116_941391_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.8	1.1e-134
WP_012360627.1|941559_942180_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.5	1.2e-38
WP_012360628.1|942183_942780_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	49.7	3.0e-42
WP_041628496.1|943005_944568_-	trigger factor	NA	NA	NA	NA	NA
WP_012360630.1|945289_945763_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_012360631.1|945768_946473_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_012360632.1|946561_949228_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.0	2.3e-41
WP_081601246.1|949404_949815_+	globin	NA	NA	NA	NA	NA
WP_012360634.1|949811_950627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360635.1|950637_950829_-	RtcB family protein	NA	G8I4I6	Mycobacterium_phage	74.6	3.1e-17
WP_012360636.1|950899_951925_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_012360637.1|951982_953653_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	26.8	3.3e-46
WP_012360638.1|953871_954525_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_012360639.1|954718_957019_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_012360640.1|957367_958213_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012360641.1|958243_958873_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	38.8	7.8e-25
WP_012360644.1|960709_960976_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012360645.1|960972_961182_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_012360646.1|961285_962317_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_012360647.1|962326_963550_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
963927:963967	attL	CAGTGGGTCCGGGGTTCGAATCCCTGATGGCCCACCACTGA	NA	NA	NA	NA
WP_012360649.1|964351_964570_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012360650.1|964566_965013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360651.1|964999_965422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095075326.1|965445_965829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360653.1|965825_966275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360654.1|966274_966580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360655.1|966576_966840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360657.1|967451_968399_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	52.8	1.6e-69
WP_148264200.1|968860_969391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157727788.1|970272_970434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628498.1|970914_971316_+	bifunctional DNA primase/polymerase	NA	A0A220NQN1	Corynebacterium_phage	58.0	8.1e-36
WP_041628499.1|971391_971634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360660.1|971596_973039_+	hypothetical protein	NA	A0A0S1S2I3	Propionibacterium_phage	39.5	7.4e-79
WP_012360661.1|973035_974439_+|portal	phage portal protein	portal	S5XYN1	Mycobacterium_phage	41.7	4.8e-91
WP_012360662.1|974413_975688_+	EndoU domain-containing protein	NA	A0A2H4PEX4	Gordonia_phage	39.1	1.9e-06
WP_148264202.1|975693_975975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360664.1|976161_976698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360665.1|976749_977658_+|capsid	phage major capsid protein	capsid	A0A142KBU3	Gordonia_phage	55.7	1.3e-89
WP_041628500.1|977671_977857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360666.1|977878_978349_+	hypothetical protein	NA	A0A2H4IYA5	uncultured_Caudovirales_phage	53.7	2.0e-33
WP_012360668.1|978705_978888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360669.1|978887_979127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360670.1|979195_979495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041628503.1|979568_980234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360672.1|980306_980585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360673.1|980653_981001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360674.1|981031_987337_+	tape measure protein	NA	A0A1W6JQH4	Corynebacterium_phage	32.3	5.7e-75
WP_012360675.1|987361_988138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360676.1|988161_989043_+	immunity-specific protein	NA	A0A1L6BZG4	Pasteurella_phage	25.0	3.6e-12
WP_012360677.1|989049_990390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360678.1|990389_991568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360679.1|991572_992934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360680.1|993172_993325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360683.1|995045_995507_+	hypothetical protein	NA	A0A220NQQ7	Corynebacterium_phage	45.6	1.6e-27
WP_012360684.1|995496_995844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360685.1|995902_996760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360686.1|996762_997569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360687.1|997661_998459_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CCU8	Gordonia_phage	47.4	2.5e-52
998599:998639	attR	CAGTGGGTCCGGGGTTCGAATCCCTGATGGCCCACCACTGA	NA	NA	NA	NA
>prophage 2
NZ_LT906481	Corynebacterium urealyticum strain NCTC12011 chromosome 1	2377532	1011888	1054771	2377532	protease,transposase	Bacillus_phage(25.0%)	37	NA	NA
WP_148264203.1|1011888_1013123_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	43.3	3.8e-60
WP_141759501.1|1013324_1013657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360704.1|1014006_1015524_-	hypothetical protein	NA	A0A1I9SA50	Rhodococcus_phage	37.9	3.6e-36
WP_012360705.1|1015740_1017090_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	7.2e-36
WP_148264203.1|1018178_1019413_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	43.3	3.8e-60
WP_012360708.1|1019883_1020327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360709.1|1020381_1020762_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_012360710.1|1020790_1022146_-	amidohydrolase	NA	NA	NA	NA	NA
WP_012360711.1|1022228_1022867_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_012360712.1|1022901_1023675_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_012360713.1|1023696_1024491_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012360714.1|1024658_1025525_-	glutamate racemase	NA	NA	NA	NA	NA
WP_012360715.1|1025634_1026219_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012360716.1|1026287_1027484_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_012360717.1|1027458_1028208_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_012360718.1|1028177_1028594_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_050816668.1|1028685_1030023_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012360720.1|1030104_1032108_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	28.5	3.5e-63
WP_012360721.1|1032257_1033829_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	31.2	6.6e-57
WP_012360722.1|1033908_1034706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360723.1|1034774_1036163_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_012360724.1|1036261_1037959_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_012360725.1|1038265_1039261_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	75.3	4.1e-137
WP_041628508.1|1039510_1040002_+	ferritin	NA	NA	NA	NA	NA
WP_012360727.1|1040131_1042291_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.4	9.9e-213
WP_012360728.1|1042381_1042816_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.4	2.5e-14
WP_012360729.1|1042823_1044158_-	MFS transporter	NA	NA	NA	NA	NA
WP_012360730.1|1044484_1044715_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	60.5	1.5e-18
WP_005288826.1|1045080_1045203_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_012360731.1|1045384_1046218_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.7	3.3e-79
WP_012360732.1|1046214_1046604_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_012360733.1|1046630_1047275_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_012360734.1|1047515_1049873_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_012360735.1|1049964_1050465_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169847092.1|1050727_1051918_+|transposase	IS256-like element ISCur3 family transposase	transposase	NA	NA	NA	NA
WP_081477615.1|1052032_1053412_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.9	2.5e-39
WP_012360738.1|1053592_1054771_+|transposase	IS256-like element ISCur2 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LT906481	Corynebacterium urealyticum strain NCTC12011 chromosome 1	2377532	1098842	1109793	2377532	transposase	Escherichia_phage(28.57%)	10	NA	NA
WP_011116984.1|1098842_1101728_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	3.2e-190
WP_012360777.1|1101853_1102261_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	57.9	2.4e-19
WP_001067855.1|1102206_1102911_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|1103061_1103877_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|1104033_1104738_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001082319.1|1105177_1105981_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1105980_1106817_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_005297378.1|1107020_1108196_-	chloramphenicol efflux MFS transporter Cmx	NA	NA	NA	NA	NA
WP_011113070.1|1108217_1108271_-	chloramphenicol resistance leader peptide	NA	NA	NA	NA	NA
WP_012360779.1|1108449_1109793_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	7.0e-31
>prophage 4
NZ_LT906481	Corynebacterium urealyticum strain NCTC12011 chromosome 1	2377532	1181507	1300349	2377532	tRNA,protease,transposase	Bacillus_phage(12.5%)	108	NA	NA
WP_012360833.1|1181507_1182857_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	7.2e-36
WP_041628514.1|1182950_1183859_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_012360835.1|1183924_1185304_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.9	2.5e-39
WP_041628515.1|1185798_1186212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158307922.1|1186406_1187540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360838.1|1187436_1187790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360840.1|1188972_1189485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360841.1|1189794_1191300_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_148264206.1|1191535_1192714_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_012360843.1|1192788_1193346_-	gluconokinase	NA	NA	NA	NA	NA
WP_012360844.1|1193404_1194556_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_012360845.1|1194608_1195628_-	mycothiol synthase	NA	NA	NA	NA	NA
WP_012360846.1|1195740_1196637_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_012360847.1|1196647_1197394_+	FABP family protein	NA	NA	NA	NA	NA
WP_041628516.1|1197406_1198297_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_012360849.1|1198483_1199659_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_012360850.1|1199876_1200050_+	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_012360851.1|1200289_1201468_+|transposase	IS256-like element ISCur2 family transposase	transposase	NA	NA	NA	NA
WP_012360852.1|1201611_1202679_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FK46	Synechococcus_phage	40.6	2.2e-59
WP_012360853.1|1202729_1204340_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.0	1.7e-47
WP_043951934.1|1204355_1204790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360854.1|1204946_1206011_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012360855.1|1206060_1207371_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_012360856.1|1207441_1208101_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012360857.1|1208140_1210603_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	55.7	8.9e-234
WP_012360858.1|1210661_1211330_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012360859.1|1211326_1211572_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012360860.1|1211730_1213947_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_012360861.1|1214328_1215144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360862.1|1215356_1216250_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.9	2.0e-42
WP_012360863.1|1216317_1217535_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_012360864.1|1217580_1218000_-	NfeD family protein	NA	NA	NA	NA	NA
WP_012360865.1|1218048_1219491_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_012360866.1|1219546_1220449_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_041628517.1|1220467_1221745_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012360868.1|1221810_1222275_+	HIT family protein	NA	NA	NA	NA	NA
WP_012360869.1|1222297_1223161_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012360870.1|1223099_1224689_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	3.1e-22
WP_012360871.1|1224701_1225472_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	3.1e-31
WP_012360872.1|1225692_1226499_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_012360873.1|1226599_1227130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012360874.1|1227160_1228924_-	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_012360875.1|1228923_1229349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157727790.1|1229329_1229470_+	plantazolicin family RiPP	NA	NA	NA	NA	NA
WP_012360876.1|1229577_1230174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360877.1|1230175_1230883_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012360878.1|1230885_1231587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360879.1|1231593_1232565_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_012360880.1|1232566_1233961_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_012360881.1|1233972_1234806_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_012360882.1|1234802_1235381_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095075328.1|1236845_1237058_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012360886.1|1237080_1238430_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	4.2e-36
WP_081477620.1|1238366_1238969_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.7	7.4e-17
WP_095075329.1|1240117_1241345_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	50.9	5.7e-64
WP_041628620.1|1241643_1242834_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_012360892.1|1243076_1244804_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012360893.1|1244892_1245294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360894.1|1245348_1246908_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_012360895.1|1246907_1247420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360896.1|1247483_1248437_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_012360897.1|1248526_1249657_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012360898.1|1249763_1250804_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012360899.1|1250800_1251502_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	29.6	1.1e-11
WP_012360900.1|1251498_1252506_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012360901.1|1252591_1253545_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_012360902.1|1253639_1254230_-	thiamine biosynthesis protein X	NA	NA	NA	NA	NA
WP_012360903.1|1254329_1255379_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012360904.1|1255368_1256556_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012360905.1|1256555_1257332_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.3e-16
WP_012360906.1|1257354_1258026_+	biliverdin-producing heme oxygenase	NA	Q58M64	Prochlorococcus_phage	38.6	2.0e-31
WP_012360907.1|1258080_1259544_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L4N2	Tupanvirus	32.7	8.6e-43
WP_012360908.1|1259742_1260573_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012360909.1|1260691_1260976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360910.1|1260944_1261433_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_012360911.1|1261478_1262276_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012360912.1|1262338_1262911_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_012360913.1|1263233_1263806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360914.1|1263941_1265342_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_012360915.1|1265345_1266113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360916.1|1266262_1267090_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_012360917.1|1267164_1268148_+	DNA glycosylase	NA	NA	NA	NA	NA
WP_012360918.1|1268337_1269729_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_012360919.1|1269813_1271187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360920.1|1271415_1274100_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	39.8	2.0e-130
WP_012360921.1|1274500_1276276_+	bile acid CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	6.0e-30
WP_012360922.1|1276419_1278027_-	inorganic phosphate transporter	NA	V5LQA0	Emiliania_huxleyi_virus	28.6	1.2e-37
WP_012360923.1|1278265_1279471_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012360924.1|1279536_1280937_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012360925.1|1281129_1282677_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	33.4	7.9e-71
WP_012360926.1|1282863_1284072_-	hemoglobin flavoprotein	NA	NA	NA	NA	NA
WP_012360927.1|1284109_1284604_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_012360928.1|1284747_1285167_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_012360929.1|1285186_1286179_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_012360930.1|1286184_1287132_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_012360931.1|1287179_1288397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012360932.1|1288423_1288900_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_012360933.1|1288910_1289579_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_012360934.1|1289583_1289961_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_012360935.1|1289953_1290907_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	34.2	6.9e-25
WP_012360936.1|1290979_1291594_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	56.0	8.3e-48
WP_012360937.1|1291614_1294128_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	49.4	3.8e-107
WP_012360938.1|1294206_1294809_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	26.1	1.6e-11
WP_095075342.1|1294801_1295962_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_012360940.1|1296114_1297491_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_012360941.1|1297634_1298117_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	47.0	8.6e-32
WP_012360942.1|1298365_1299070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012360943.1|1299170_1300349_+|transposase	IS256-like element ISCur2 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LT906481	Corynebacterium urealyticum strain NCTC12011 chromosome 1	2377532	1481104	1600338	2377532	tRNA,protease,transposase,holin	Staphylococcus_phage(21.43%)	95	NA	NA
WP_012361095.1|1481104_1481623_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012361096.1|1481711_1482581_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012361097.1|1482623_1483817_-|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_012361098.1|1483828_1484641_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_095075343.1|1484645_1485290_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_012361101.1|1485498_1486368_-	endonuclease III	NA	NA	NA	NA	NA
WP_012361100.1|1486354_1487038_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_041628534.1|1487214_1488078_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012361103.1|1488112_1488601_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	34.4	6.2e-14
WP_095075344.1|1488603_1488759_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_158307924.1|1488943_1489264_-	WhiB family transcriptional regulator	NA	A0A159B6S6	Tsukamurella_phage	47.8	4.7e-10
WP_012361106.1|1489851_1492032_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_141759404.1|1492135_1493209_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_169847096.1|1493505_1494537_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	1.2e-38
WP_012361109.1|1495202_1496381_-|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_012361110.1|1497014_1500386_+	DUF4040 family protein	NA	NA	NA	NA	NA
WP_012361111.1|1500382_1500898_+	cation:proton antiporter subunit C	NA	NA	NA	NA	NA
WP_012361112.1|1500897_1502664_+	monovalent cation/H+ antiporter subunit D family protein	NA	NA	NA	NA	NA
WP_012361113.1|1502663_1503377_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_012361114.1|1503377_1503656_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_012361115.1|1503659_1504082_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_012361116.1|1504172_1504598_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_012361117.1|1504649_1506266_-	catalase	NA	A0A2K9L572	Tupanvirus	40.9	1.2e-88
WP_012361118.1|1506494_1507157_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012361119.1|1507203_1508688_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_012361120.1|1508691_1509957_+	ferrochelatase	NA	NA	NA	NA	NA
WP_012361121.1|1510113_1511637_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012361122.1|1511862_1512900_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012361123.1|1512953_1514219_-	aspartate kinase	NA	NA	NA	NA	NA
WP_012361124.1|1514384_1515233_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012361125.1|1515335_1517111_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.6e-22
WP_012361126.1|1517362_1518799_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_050816651.1|1518829_1520272_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_012361128.1|1520418_1523661_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_012361129.1|1523666_1524512_-	surface-anchored protein (fimbrial subunit)	NA	NA	NA	NA	NA
WP_012361130.1|1524504_1525443_-	class C sortase	NA	NA	NA	NA	NA
WP_012361131.1|1525541_1527023_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_012361134.1|1528977_1530819_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_157727792.1|1530993_1531590_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012361136.1|1531593_1533006_-	APC family permease	NA	NA	NA	NA	NA
WP_012361137.1|1532998_1534624_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_050816652.1|1534620_1535088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361139.1|1535244_1537065_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_148264220.1|1537096_1538569_+	DUF1727 domain-containing protein	NA	NA	NA	NA	NA
WP_012361141.1|1538568_1539675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012361142.1|1540249_1542190_-	calcineurin-like phosphoesterase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012361143.1|1542597_1543623_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.9	1.6e-48
WP_012361144.1|1543969_1544791_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_012361145.1|1544880_1545198_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_012361146.1|1545316_1548625_-	DNA polymerase III subunit gamma and tau	NA	A0A1L2BWV7	Bacteriophage	33.2	1.0e-46
WP_012361147.1|1548680_1549355_-	NINE protein	NA	NA	NA	NA	NA
WP_012361148.1|1549405_1550086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361149.1|1550118_1551417_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012361150.1|1551547_1552897_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	9.4e-36
WP_012361151.1|1553145_1554330_+|transposase	IS256-like element IS3503 family transposase	transposase	NA	NA	NA	NA
WP_012361152.1|1554551_1555730_+|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_005323424.1|1555920_1557099_+|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_148264209.1|1557650_1557953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361151.1|1558080_1559265_-|transposase	IS256-like element IS3503 family transposase	transposase	NA	NA	NA	NA
WP_012361154.1|1559419_1560769_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	9.4e-36
WP_012361155.1|1560859_1561045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361156.1|1561177_1562065_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_050816653.1|1562061_1563120_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_081477624.1|1563112_1564468_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.9	8.8e-58
WP_012361159.1|1564505_1566911_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_012361160.1|1567252_1567849_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_012361161.1|1567763_1568333_-|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
WP_012361162.1|1568425_1569475_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_012361163.1|1569779_1570757_+	diaminopimelate dehydrogenase	NA	NA	NA	NA	NA
WP_012361165.1|1571818_1572937_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.3	1.2e-07
WP_050816673.1|1573047_1574586_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_012361167.1|1575038_1575887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012361168.1|1575965_1576364_+	membrane protein	NA	NA	NA	NA	NA
WP_012361169.1|1576476_1579215_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_012361170.1|1579214_1581446_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_012361171.1|1581805_1582873_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_012361172.1|1583023_1584340_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_012361173.1|1584725_1585592_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012361174.1|1585635_1586430_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	8.9e-10
WP_012361175.1|1586544_1587486_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_012361176.1|1587874_1589179_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_169847099.1|1589204_1589588_-	GtrA family protein	NA	NA	NA	NA	NA
WP_012361178.1|1589785_1590442_-	GtrA family protein	NA	NA	NA	NA	NA
WP_012361179.1|1590683_1591469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361181.1|1591488_1592178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012361180.1|1592176_1592578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012361182.1|1592725_1593100_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012361183.1|1593254_1594670_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012361184.1|1594701_1595460_+	decaprenylphospho-beta-D-erythro-pentofuranosid- 2-ulose 2-reductase	NA	NA	NA	NA	NA
WP_012361185.1|1595650_1596556_-	cutinase family protein	NA	NA	NA	NA	NA
WP_012361186.1|1596808_1597690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141759414.1|1597984_1598206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081477625.1|1598442_1598892_+	EndoU domain-containing protein	NA	A0A220NQN8	Corynebacterium_phage	35.7	6.8e-23
WP_012361189.1|1598888_1599128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169847096.1|1599306_1600338_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	1.2e-38
>prophage 6
NZ_LT906481	Corynebacterium urealyticum strain NCTC12011 chromosome 1	2377532	1699226	1764614	2377532	integrase,protease,transposase	Pandoravirus(15.38%)	53	1699032:1699081	1710865:1710914
1699032:1699081	attL	CATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGATTCTCCTATGCTCCAC	NA	NA	NA	NA
WP_081477605.1|1699226_1700390_+|integrase	tyrosine-type recombinase/integrase	integrase	Q1WDJ5	Streptomyces_phage	24.3	1.1e-11
WP_012359279.1|1700901_1701906_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012359280.1|1701902_1702574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359283.1|1705273_1705756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359284.1|1706172_1707033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359285.1|1707327_1707900_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012359286.1|1707917_1709417_-	MFS transporter	NA	NA	NA	NA	NA
WP_012359287.1|1709688_1710228_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	47.2	1.1e-32
WP_012359288.1|1710378_1710702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081477606.1|1711046_1712024_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
1710865:1710914	attR	CATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGATTCTCCTATGCTCCAC	NA	NA	NA	NA
WP_012359290.1|1712026_1712830_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012359291.1|1713042_1713381_+	transglycosylase family protein	NA	A0A1I9SA30	Rhodococcus_phage	60.6	1.4e-28
WP_012359292.1|1713835_1715020_-|transposase	IS256-like element IS3503 family transposase	transposase	NA	NA	NA	NA
WP_012359293.1|1715203_1716115_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_012359294.1|1716238_1717606_+	MFS transporter	NA	NA	NA	NA	NA
WP_012359295.1|1717631_1718129_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_012359296.1|1718247_1718595_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012359297.1|1718675_1719794_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012359298.1|1719790_1720210_+	low molecular weight phosphatase family protein	NA	A0A2H4PQT9	Staphylococcus_phage	31.9	2.6e-08
WP_012359300.1|1722900_1724250_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	9.4e-36
WP_012359301.1|1724369_1724717_+	hypothetical protein	NA	Q6NE04	Leptospira_phage	39.1	5.8e-14
WP_012359302.1|1724918_1726097_+|transposase	IS256-like element IS1249 family transposase	transposase	NA	NA	NA	NA
WP_012359303.1|1726373_1727054_+	Abi family protein	NA	NA	NA	NA	NA
WP_012359307.1|1728512_1729172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041628436.1|1729624_1729918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359308.1|1730066_1730771_-	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_012359309.1|1730940_1731423_-	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
WP_012359312.1|1732916_1734047_+	alanine--glyoxylate aminotransferase family protein	NA	A0A0N9QIZ2	Chrysochromulina_ericina_virus	41.0	1.2e-76
WP_012359313.1|1734163_1734511_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012359314.1|1734573_1736646_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	40.9	2.5e-56
WP_012359315.1|1736654_1738352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359316.1|1738535_1739060_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.3	6.7e-22
WP_012359317.1|1739067_1739760_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012359318.1|1739804_1740083_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_012359319.1|1740227_1740914_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	42.2	4.3e-37
WP_012359320.1|1740944_1743122_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8JE84	Murine_leukemia_virus	30.5	2.7e-16
WP_012359321.1|1743299_1744943_-	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	29.6	5.4e-17
WP_012359322.1|1744945_1746394_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_012359323.1|1746390_1747776_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_012359324.1|1747777_1749346_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_012359325.1|1749342_1749858_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_012359326.1|1750042_1751275_-	DUF3662 domain-containing protein	NA	NA	NA	NA	NA
WP_012359327.1|1751786_1752413_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012359328.1|1752455_1754126_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	30.3	7.1e-09
WP_015381080.1|1754122_1755847_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_012359330.1|1755846_1756812_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012359331.1|1756808_1758524_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012359332.1|1758759_1759323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012359333.1|1759461_1760262_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_012359334.1|1760338_1761601_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_012359335.1|1761545_1762682_+	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_012359336.1|1762804_1763797_-	asparaginase	NA	NA	NA	NA	NA
WP_012359337.1|1763984_1764614_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_LT906481	Corynebacterium urealyticum strain NCTC12011 chromosome 1	2377532	2301766	2321123	2377532	protease,integrase,transposase	Staphylococcus_phage(33.33%)	14	2308661:2308698	2321230:2321267
WP_169847095.1|2301766_2303437_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_012359763.1|2303619_2304696_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_041628461.1|2304731_2305268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359765.1|2305409_2308412_+	UPF0182 family protein	NA	NA	NA	NA	NA
2308661:2308698	attL	AACCCAGAGGTCGTAGGTTCGAATCCTGCCCCCGCTAC	NA	NA	NA	NA
WP_095075338.1|2308814_2309993_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_169847096.1|2310182_2311214_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	1.2e-38
WP_012359880.1|2311894_2313073_-|transposase	IS256-like element ISCur2 family transposase	transposase	NA	NA	NA	NA
WP_012360835.1|2313254_2314634_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.9	2.5e-39
WP_012359767.1|2314952_2315357_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012359768.1|2315526_2317086_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	50.0	1.1e-112
WP_012359769.1|2317255_2317732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012359770.1|2317769_2319380_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_012359771.1|2319360_2319723_-	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_041628568.1|2320592_2321123_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2321230:2321267	attR	AACCCAGAGGTCGTAGGTTCGAATCCTGCCCCCGCTAC	NA	NA	NA	NA
