The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906435	Pandoraea sputorum strain NCTC13161 chromosome 1	5743123	2151492	2171480	5743123	holin,plate	Burkholderia_phage(41.18%)	22	NA	NA
WP_039402928.1|2151492_2152170_-	LexA family transcriptional regulator	NA	B5WZX5	Pseudomonas_phage	36.7	4.6e-15
WP_157127366.1|2152346_2153306_+	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	40.9	1.2e-16
WP_052252752.1|2153346_2153952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052252754.1|2153948_2154572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039397763.1|2154713_2155268_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	48.1	3.3e-43
WP_039397765.1|2155443_2156919_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	42.6	6.8e-96
WP_039397767.1|2156931_2157372_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	51.4	1.7e-34
WP_039397769.1|2157371_2157863_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	35.1	8.2e-14
WP_052252756.1|2158043_2159777_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	35.7	4.9e-37
WP_039397771.1|2159773_2160358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039397773.1|2160359_2160674_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	42.4	1.2e-15
WP_039397775.1|2160673_2161666_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	59.6	1.5e-86
WP_039397776.1|2161742_2162489_+	phage protein	NA	A9YX06	Burkholderia_phage	73.8	9.6e-99
WP_039397778.1|2162491_2162839_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	70.1	3.4e-38
WP_039397780.1|2162835_2164017_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	66.2	3.7e-137
WP_039397782.1|2164018_2164681_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	68.2	1.2e-87
WP_039397783.1|2165742_2165934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039397785.1|2166015_2166309_+|holin	holin	holin	C7BGD7	Burkholderia_phage	52.8	1.3e-19
WP_039397787.1|2166376_2166853_+	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	60.4	1.3e-48
WP_039397789.1|2166852_2167338_+	DUF2514 family protein	NA	U6C7Z8	Ralstonia_phage	40.4	3.5e-09
WP_039397791.1|2167523_2167781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039397793.1|2169791_2171480_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.9	5.6e-62
>prophage 2
NZ_LT906435	Pandoraea sputorum strain NCTC13161 chromosome 1	5743123	4427227	4436561	5743123		Enterobacteria_phage(33.33%)	7	NA	NA
WP_039400703.1|4427227_4428265_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.4	1.7e-05
WP_039400704.1|4429579_4430128_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.2	5.7e-48
WP_039404041.1|4430183_4431065_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.6	6.7e-99
WP_039400706.1|4431079_4432144_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	2.5e-84
WP_039400707.1|4432172_4432757_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_039400708.1|4432837_4434589_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.4	1.3e-53
WP_039400709.1|4434752_4436561_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	35.7	1.5e-76
>prophage 3
NZ_LT906435	Pandoraea sputorum strain NCTC13161 chromosome 1	5743123	5253795	5289907	5743123	portal,head,holin,plate,integrase,tail,terminase,capsid,protease	Burkholderia_phage(40.0%)	45	5250864:5250909	5289253:5289298
5250864:5250909	attL	TTGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAA	NA	NA	NA	NA
WP_084104315.1|5253795_5254782_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	36.0	1.5e-43
WP_052253127.1|5255504_5256524_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	73.5	3.8e-138
WP_052253128.1|5256568_5258338_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	67.5	3.9e-231
WP_039393526.1|5258480_5259368_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S5NPS0	Burkholderia_phage	46.8	1.5e-53
WP_039393528.1|5259416_5260427_+|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	66.4	5.3e-132
WP_039393530.1|5260429_5261116_+	hypothetical protein	NA	A0A077K804	Ralstonia_phage	48.8	9.9e-50
WP_039393532.1|5261215_5261698_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	48.6	5.2e-29
WP_039393533.1|5261697_5261901_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	64.2	1.3e-18
WP_039393536.1|5261903_5262278_+	membrane protein	NA	E5E3R9	Burkholderia_phage	60.5	1.2e-28
WP_039393537.1|5262274_5262598_+|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	50.5	8.9e-17
WP_039393539.1|5262581_5263397_+	DUF3380 domain-containing protein	NA	E5E3R7	Burkholderia_phage	62.6	3.3e-84
WP_039393540.1|5263393_5263903_+	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	49.0	2.7e-28
WP_039393541.1|5263899_5264352_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	40.4	1.7e-26
WP_039393542.1|5264351_5264801_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	60.8	1.3e-42
WP_157127448.1|5264806_5265658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039393547.1|5265802_5266438_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	45.4	7.8e-41
WP_039393548.1|5266434_5266806_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	50.0	3.3e-23
WP_052252346.1|5266802_5267759_+|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	53.2	3.1e-73
WP_039393550.1|5267755_5268370_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	64.5	1.6e-62
WP_039393552.1|5270490_5270847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393554.1|5270849_5271845_-|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	35.9	1.6e-32
WP_084104088.1|5272220_5272412_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	74.1	6.8e-17
WP_095178489.1|5272452_5273118_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	65.8	1.2e-84
WP_039393558.1|5273234_5274413_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	71.9	6.5e-166
WP_039393560.1|5274437_5274950_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	57.6	2.3e-51
WP_052252349.1|5275001_5275328_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	55.6	5.4e-22
WP_125347820.1|5275285_5275429_+|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	60.5	4.3e-08
WP_039393562.1|5275425_5278086_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	52.9	4.3e-234
WP_072633367.1|5278096_5278735_+|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	57.0	5.6e-39
WP_095178491.1|5278782_5279940_+	phage late control D family protein	NA	E5E3P7	Burkholderia_phage	54.6	8.8e-99
WP_052253129.1|5279987_5281118_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_052252350.1|5281174_5281900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039393564.1|5281958_5282378_-	helix-turn-helix domain-containing protein	NA	A4JWR8	Burkholderia_virus	51.8	2.0e-29
WP_039393565.1|5282426_5282714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039401584.1|5282736_5282928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393568.1|5282956_5283151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393570.1|5283147_5283408_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	54.9	2.2e-18
WP_157127450.1|5283506_5283722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157127453.1|5283875_5284136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157127454.1|5284148_5284814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393576.1|5284953_5285202_+	hypothetical protein	NA	I6NMK4	Burkholderia_virus	46.4	4.3e-11
WP_039393578.1|5285213_5287925_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	55.5	7.7e-287
WP_072633368.1|5287894_5288149_+	DUF4224 domain-containing protein	NA	E5E3T1	Burkholderia_phage	65.4	5.0e-15
WP_039393580.1|5288149_5289178_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3T0	Burkholderia_phage	63.5	5.0e-122
WP_039393581.1|5289448_5289907_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	43.3	2.2e-21
5289253:5289298	attR	TTGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAA	NA	NA	NA	NA
