The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	168183	177408	2435419	protease,tRNA	Clostridium_phage(33.33%)	8	NA	NA
WP_089866137.1|168183_169200_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	35.6	9.6e-33
WP_168944056.1|169358_170072_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_089866036.1|170170_170425_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	62.7	1.5e-19
WP_089866033.1|170508_171540_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_089866135.1|171559_172105_-|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	40.0	1.4e-25
WP_089866030.1|172178_172895_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	35.9	3.4e-32
WP_089866027.1|173777_174953_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	70.4	1.3e-150
WP_095177198.1|175176_177408_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	33.2	1.5e-75
>prophage 2
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	313334	322148	2435419		Erysipelothrix_phage(37.5%)	9	NA	NA
WP_095177257.1|313334_313616_+	rRNA biogenesis protein rrp5	NA	A0A2K5B2A7	Erysipelothrix_phage	42.0	7.7e-09
WP_095177258.1|313615_314776_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	56.4	1.0e-118
WP_095177259.1|314777_315314_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	58.8	6.1e-55
WP_095177260.1|315320_317267_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	64.7	1.2e-241
WP_095178343.1|317305_317641_+	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	45.8	3.0e-23
WP_169712334.1|317633_317798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177261.1|317781_320193_+	hypothetical protein	NA	A0A1S7FZ15	Listeria_phage	49.1	1.8e-226
WP_095178344.1|320493_320772_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	58.9	1.6e-22
WP_095177262.1|320768_322148_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	64.8	3.6e-176
>prophage 3
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	325651	384014	2435419	capsid,holin,tail,portal,transposase,integrase,terminase,protease,head	Paenibacillus_phage(25.0%)	55	358200:358216	363778:363794
WP_095177269.1|325651_326908_+	site-specific DNA-methyltransferase	NA	A0A1B0RXJ0	Streptococcus_phage	52.9	4.4e-128
WP_095177270.1|327626_328523_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_095177271.1|328640_329381_+	virulence-related protein	NA	NA	NA	NA	NA
WP_095177272.1|329370_329559_+	hypothetical protein	NA	A0A127AWS3	Bacillus_phage	60.0	2.9e-12
WP_095177273.1|329652_330570_+	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	40.6	5.4e-51
WP_095177274.1|330716_331175_+	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	35.1	2.4e-15
WP_095177275.1|331327_331798_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXI5	Streptococcus_phage	70.6	3.0e-58
WP_095177276.1|331797_333360_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	74.2	4.6e-228
WP_095177277.1|333373_334654_+|portal	phage portal protein	portal	A0A2H4JDX8	uncultured_Caudovirales_phage	59.0	4.8e-138
WP_095177278.1|334631_335336_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.4	2.3e-54
WP_095177279.1|335369_336542_+|capsid	phage major capsid protein	capsid	A0A2I7SBY4	Paenibacillus_phage	49.7	2.0e-95
WP_095177280.1|336579_336870_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	54.8	1.0e-24
WP_095177281.1|336866_337193_+|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	55.6	1.1e-25
WP_095177282.1|337185_337557_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	33.3	1.2e-12
WP_095177283.1|337553_337880_+	hypothetical protein	NA	A0A2I7SC10	Paenibacillus_phage	44.7	9.6e-19
WP_095177284.1|337880_338447_+|tail	phage tail protein	tail	E2ELJ1	Clostridium_phage	47.5	8.2e-34
WP_095177285.1|338450_338750_+	hypothetical protein	NA	H0USX2	Bacillus_phage	30.5	7.0e-08
WP_169712335.1|338761_338917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177286.1|339006_339273_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_095177287.1|339259_339580_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_095177288.1|339759_342993_+|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	48.6	9.9e-116
WP_095177289.1|343003_343855_+|tail	phage tail family protein	tail	A0A2I7SBZ7	Paenibacillus_phage	47.4	3.1e-69
WP_095177290.1|344897_346109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177291.1|346151_347249_+	hypothetical protein	NA	A0A0C5AMZ5	Paenibacillus_phage	40.7	1.1e-79
WP_095177292.1|347297_347699_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	55.6	1.9e-37
WP_095177293.1|347699_348377_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	37.4	2.4e-27
WP_095177294.1|348535_349393_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	24.4	4.2e-13
WP_095177295.1|349404_350157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177296.1|350219_351080_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_157726515.1|351120_351291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177298.1|352439_353702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177299.1|354551_355121_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095177300.1|356374_357298_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_095177301.1|357406_358291_+	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
358200:358216	attL	TATCTAAATTGGATTTA	NA	NA	NA	NA
WP_095177302.1|358476_358854_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEB1	Paenibacillus_phage	50.4	3.7e-30
WP_096636469.1|359313_360153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177304.1|360282_360495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177305.1|360857_361565_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	1.2e-37
WP_095177306.1|361554_362478_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_095177307.1|362854_363817_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
363778:363794	attR	TAAATCCAATTTAGATA	NA	NA	NA	NA
WP_157726516.1|363905_365243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157726517.1|365367_365793_-	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_095177308.1|366610_366976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089866773.1|367200_368514_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_096636146.1|368702_369152_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_095177310.1|369155_370469_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_089866781.1|370483_371200_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	6.1e-34
WP_095177311.1|371196_372408_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_089866786.1|372423_373674_+	TolC family protein	NA	NA	NA	NA	NA
WP_095177312.1|373685_374882_+	TolC family protein	NA	NA	NA	NA	NA
WP_095177313.1|374974_376465_+	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_089866795.1|376788_377949_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_095177314.1|377945_381209_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_095177315.1|381222_382701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169712377.1|383090_384014_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	481087	491459	2435419	transposase	Tupanvirus(25.0%)	10	NA	NA
WP_095177362.1|481087_482674_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	4.5e-53
WP_089865214.1|482677_483187_+	nucleoside 2-deoxyribosyltransferase	NA	Q2WG40	Clostridium_botulinum_D_phage	45.6	2.2e-33
WP_089865217.1|483318_483867_+	DUF2284 domain-containing protein	NA	NA	NA	NA	NA
WP_089865223.1|483945_485502_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	2.3e-54
WP_095177363.1|485679_486147_-	superoxide dismutase family protein	NA	Q9EMF1	Amsacta_moorei_entomopoxvirus	37.4	8.6e-13
WP_095177364.1|486262_486595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177365.1|486588_486939_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.3	4.6e-19
WP_095177366.1|487028_488663_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.7e-55
WP_168943748.1|488877_489996_-	hypothetical protein	NA	A0A125RNN9	Pseudomonas_phage	22.1	7.1e-05
WP_089865232.1|490046_491459_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	30.6	5.2e-53
>prophage 5
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	884160	973003	2435419	capsid,protease,transposase	Bacillus_phage(15.0%)	66	NA	NA
WP_089862891.1|884160_884859_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.7	2.6e-45
WP_089862890.1|884869_886573_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	41.8	6.1e-40
WP_095177576.1|886757_889859_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.6	2.7e-25
WP_095177577.1|889855_891109_-	restriction endonuclease subunit S	NA	E3T5F4	Cafeteria_roenbergensis_virus	37.2	1.6e-05
WP_095177578.1|891105_892674_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	7.7e-106
WP_024822623.1|892678_892900_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	64.6	1.5e-15
WP_095177579.1|893547_894813_+	hypothetical protein	NA	R9TSC7	Rhizobium_phage	31.1	1.7e-26
WP_089862884.1|895084_895600_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_095177580.1|895675_895879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089867487.1|897442_898327_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_169712382.1|898379_899273_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_095177583.1|899272_900160_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_095177584.1|900170_900920_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	1.9e-17
WP_089867496.1|902366_903683_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_095177585.1|903684_904680_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_089867498.1|904812_906291_+	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_095177587.1|906725_907676_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_095177588.1|907738_908476_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_095178359.1|908489_910181_+	type I-B CRISPR-associated protein Cas8b1/Cst1	NA	NA	NA	NA	NA
WP_095177590.1|910170_911073_+	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_095177591.1|911081_911813_+	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_095177592.1|911874_914184_+	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	24.7	4.4e-33
WP_095177594.1|914199_914721_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_095177596.1|914720_915707_+	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_095177598.1|915711_915975_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_095178360.1|919174_919870_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.6	2.6e-53
WP_095177364.1|919967_920300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177365.1|920293_920644_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.3	4.6e-19
WP_095177366.1|920733_922368_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.7e-55
WP_095178361.1|922517_922919_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_095177600.1|923041_923245_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	68.7	1.6e-19
WP_095177602.1|923320_924040_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	45.2	1.5e-64
WP_095178362.1|924070_927349_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.3	4.9e-62
WP_095177604.1|927432_927624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177606.1|927727_929167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089867519.1|929298_931239_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_095178363.1|931881_933210_+	CZB domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.0	2.2e-08
WP_095177607.1|933322_933904_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_089867524.1|934161_934818_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_089867528.1|934957_935566_-	YjgB family protein	NA	NA	NA	NA	NA
WP_095177608.1|938292_938622_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_095177609.1|938848_939130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177610.1|939180_940125_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095177611.1|940428_943956_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_089867610.1|944120_944288_-	DUF3787 domain-containing protein	NA	NA	NA	NA	NA
WP_095177612.1|944387_946025_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_095177613.1|946179_948123_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.6	3.8e-54
WP_095177614.1|948351_949887_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_095177615.1|949947_950478_+	YcxB family protein	NA	NA	NA	NA	NA
WP_095177616.1|950717_951611_-	radical SAM protein	NA	NA	NA	NA	NA
WP_095177617.1|951768_952086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177509.1|952563_954075_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095177618.1|954936_955620_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_095177619.1|955794_956478_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_095177620.1|956499_956727_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_095177621.1|956741_957269_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_095177622.1|957298_958189_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	20.5	2.4e-11
WP_089867649.1|958841_960542_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_089867652.1|960627_961851_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_095177623.1|961979_963257_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_089867657.1|963421_963778_+	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_089867660.1|963859_964426_+	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_160110524.1|964483_965506_-	G5 domain-containing protein	NA	A0A173GB44	Bacillus_phage	44.1	5.3e-15
WP_169712383.1|966476_967232_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_095177624.1|967384_969727_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.1	1.5e-20
WP_095177625.1|971749_973003_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	1257279	1269810	2435419	transposase	Leptospira_phage(22.22%)	12	NA	NA
WP_147269573.1|1257279_1258020_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.3	1.2e-08
WP_095177771.1|1258051_1259686_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.4	2.9e-55
WP_095177365.1|1259775_1260126_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.3	4.6e-19
WP_095177364.1|1260119_1260452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095177772.1|1260707_1262501_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	38.4	7.4e-113
WP_095177773.1|1262680_1263169_-	tryptophan-rich sensory protein	NA	A0A1V0S976	Catovirus	29.5	9.3e-10
WP_095177774.1|1263311_1263530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095177775.1|1263549_1265424_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	32.2	5.2e-85
WP_095177776.1|1265591_1266920_-	chloride channel protein	NA	NA	NA	NA	NA
WP_089866655.1|1267071_1267326_-	hypothetical protein	NA	A0A0A7RUL4	Clostridium_phage	64.3	2.2e-23
WP_089866558.1|1267629_1268328_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	3.3e-40
WP_095177777.1|1268364_1269810_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.3	4.1e-21
>prophage 7
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	1307109	1314134	2435419		uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_089865065.1|1307109_1308234_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.2	5.3e-24
WP_157726549.1|1308363_1308870_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_089865059.1|1308895_1309330_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_089865056.1|1309544_1310117_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	40.4	3.9e-23
WP_095177797.1|1310088_1310853_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.1	6.1e-08
WP_095177798.1|1310930_1312118_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	29.4	5.8e-05
WP_095177799.1|1312372_1313188_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	42.4	8.7e-61
WP_095177800.1|1313219_1314134_-	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	26.7	2.1e-15
>prophage 8
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	1661476	1669141	2435419	integrase	Clostridium_phage(50.0%)	12	1662236:1662258	1677546:1677568
WP_095177999.1|1661476_1662160_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RVQ3	Clostridium_phage	51.8	1.2e-39
1662236:1662258	attL	TTCACTATTAATTATTCACTAAA	NA	NA	NA	NA
WP_095178000.1|1662290_1662509_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_095178001.1|1662529_1662754_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_095178002.1|1662845_1663025_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_095178003.1|1663060_1663603_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_169712361.1|1663745_1664222_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_095178005.1|1664248_1665175_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	38.0	2.9e-44
WP_095178006.1|1665187_1665412_-	helix-turn-helix domain-containing protein	NA	A0A2I7SCU5	Paenibacillus_phage	63.5	1.1e-10
WP_095178007.1|1665453_1665675_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_095178008.1|1665926_1666481_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	29.2	2.0e-08
WP_095178009.1|1666563_1667703_+|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	55.5	8.6e-115
WP_095178010.1|1667782_1669141_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	32.1	5.9e-62
1677546:1677568	attR	TTCACTATTAATTATTCACTAAA	NA	NA	NA	NA
>prophage 9
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	1685917	1693786	2435419	tRNA	Synechococcus_phage(33.33%)	7	NA	NA
WP_089867693.1|1685917_1687237_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	32.5	6.2e-48
WP_095178016.1|1687414_1688662_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_095178017.1|1688684_1690184_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.0	1.0e-62
WP_089867714.1|1690197_1690818_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.5	1.5e-17
WP_095178018.1|1690855_1691851_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.9	1.9e-65
WP_169712363.1|1691869_1693282_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.2	3.5e-57
WP_095178020.1|1693306_1693786_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.7	2.2e-27
>prophage 10
NZ_LT906477	Clostridium cochlearium strain NCTC13027 chromosome 1	2435419	1998004	2026007	2435419	protease,transposase,coat	Staphylococcus_phage(28.57%)	27	NA	NA
WP_095177509.1|1998004_1999516_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_089863590.1|1999706_2000642_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_089863588.1|2000669_2002187_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.1e-19
WP_089863586.1|2002186_2002582_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_089863584.1|2002584_2003514_-	ribokinase	NA	NA	NA	NA	NA
WP_095178164.1|2003756_2004368_+|coat	SafA/ExsA family spore coat assembly protein	coat	U5Q0C0	Bacillus_phage	58.5	3.1e-63
WP_089863580.1|2004434_2004932_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_089863578.1|2005183_2006476_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_089863576.1|2006499_2007819_-	aspartate kinase	NA	NA	NA	NA	NA
WP_089863574.1|2007835_2008723_-	homoserine kinase	NA	NA	NA	NA	NA
WP_095178397.1|2008732_2010211_-	threonine synthase	NA	NA	NA	NA	NA
WP_089863571.1|2010365_2010779_+	hemerythrin family protein	NA	NA	NA	NA	NA
WP_089863569.1|2010827_2011229_-	HNH endonuclease	NA	A0A0A7RUU3	Clostridium_phage	41.2	3.8e-17
WP_095178165.1|2011399_2012308_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089863565.1|2012458_2013118_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	6.0e-12
WP_089863563.1|2013135_2013924_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_089863559.1|2014021_2014441_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_095178166.1|2014482_2015694_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089863555.1|2016012_2016312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095177509.1|2016508_2018020_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089863553.1|2018245_2018434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089863551.1|2018476_2018854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095178167.1|2018997_2019705_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_089863547.1|2019789_2020380_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_089863546.1|2020395_2022711_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.2	3.2e-169
WP_089863543.1|2022892_2024581_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	27.1	2.3e-07
WP_089863541.1|2024717_2026007_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.3	8.4e-143
