The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906457	Legionella spiritensis strain NCTC11990 chromosome 1	3348070	737674	792765	3348070	transposase,tRNA,protease,integrase	Alteromonas_phage(12.5%)	45	767421:767436	796814:796829
WP_058482295.1|737674_738346_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_082642704.1|738358_739507_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_058482260.1|739606_740983_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_058482259.1|741152_742307_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_058482258.1|742307_743222_+|protease	protease modulator HflC	protease	R4VJU7	Alteromonas_phage	26.8	9.0e-06
WP_058482257.1|743467_744763_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	35.2	1.1e-68
WP_058482256.1|745103_746225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058482255.1|746741_748274_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_058482254.1|748587_749154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058482293.1|749258_750737_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_058482252.1|751068_752394_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	25.5	3.4e-22
WP_058482251.1|752489_753626_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_058482250.1|753609_755157_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_058482249.1|755517_756252_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	45.5	1.8e-25
WP_058482248.1|756244_757054_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_058482247.1|757044_758397_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_058482246.1|758647_760960_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_058482245.1|761071_761572_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_058482244.1|761575_762610_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_058482242.1|762792_763251_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_058482241.1|763240_764011_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_058482292.1|764030_764411_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_058482240.1|764407_764704_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_058482239.1|764730_766014_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.5	2.7e-96
WP_058482238.1|766056_767415_+	fused MFS/spermidine synthase	NA	NA	NA	NA	NA
767421:767436	attL	GTGAACAAAAATTTTC	NA	NA	NA	NA
WP_058484822.1|768073_769693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058484825.1|769930_770677_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058484821.1|770716_772021_+	M24 family peptidase	NA	NA	NA	NA	NA
WP_133141193.1|772032_772329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058484819.1|772339_773332_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_058484818.1|773328_774324_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_058484817.1|774313_775333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082642854.1|775417_776824_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_058484816.1|776830_777847_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.3	8.4e-21
WP_058484823.1|777848_778727_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_058484815.1|778886_780074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058484814.1|780204_781299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065238448.1|781732_782611_+	Abi family protein	NA	NA	NA	NA	NA
WP_058484812.1|782765_783989_+|integrase	site-specific integrase	integrase	H2BDD9	Pseudomonas_virus	29.2	3.0e-25
WP_058484811.1|784130_784805_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_095140564.1|786223_786880_+	endonuclease	NA	NA	NA	NA	NA
WP_095140566.1|786964_788155_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_095140567.1|788439_789888_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_082642812.1|790470_791325_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_095140569.1|791559_792765_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	8.7e-49
796814:796829	attR	GAAAATTTTTGTTCAC	NA	NA	NA	NA
>prophage 2
NZ_LT906457	Legionella spiritensis strain NCTC11990 chromosome 1	3348070	858930	868994	3348070		Micromonas_pusilla_virus(16.67%)	7	NA	NA
WP_058484083.1|858930_860880_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	50.6	1.2e-148
WP_058484082.1|861155_862292_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.9	3.6e-28
WP_058484081.1|862410_863535_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.0	2.9e-54
WP_058484080.1|863555_864704_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	59.0	6.4e-126
WP_162264433.1|864745_866062_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.4	1.8e-52
WP_058484078.1|866170_867175_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058484077.1|867311_868994_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.1	4.6e-16
>prophage 3
NZ_LT906457	Legionella spiritensis strain NCTC11990 chromosome 1	3348070	1263274	1270182	3348070		Acinetobacter_phage(42.86%)	9	NA	NA
WP_058482181.1|1263274_1264045_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	51.6	4.2e-57
WP_058482182.1|1264041_1265064_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.5	5.8e-78
WP_058482183.1|1265050_1265623_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.6	8.0e-53
WP_058482184.1|1265625_1266351_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	4.6e-21
WP_058482185.1|1266347_1266863_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_058482186.1|1266855_1267428_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_058482187.1|1267424_1267952_-	HAD-IIIA family hydrolase	NA	A0A140XBD6	Dickeya_phage	47.0	2.9e-25
WP_058482188.1|1267967_1268930_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.5	1.1e-38
WP_058482190.1|1269384_1270182_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.2	9.2e-23
>prophage 4
NZ_LT906457	Legionella spiritensis strain NCTC11990 chromosome 1	3348070	1447956	1507234	3348070	transposase,protease,bacteriocin,integrase	Bacillus_virus(16.67%)	53	1481021:1481075	1491579:1491633
WP_058482596.1|1447956_1448910_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_058482519.1|1449059_1449662_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	26.6	4.2e-12
WP_058482520.1|1449658_1450339_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_162264419.1|1450412_1451174_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_058482522.1|1451170_1451338_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_058482523.1|1451334_1451781_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_058482524.1|1451781_1453737_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_058482525.1|1453736_1454273_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_058482526.1|1454269_1454671_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_058482527.1|1454663_1455323_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058482528.1|1455360_1455567_+	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_058482529.1|1455847_1456795_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095140548.1|1457065_1458216_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_058482532.1|1458311_1460153_-	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	38.3	8.8e-85
WP_058482533.1|1460496_1461651_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_058482534.1|1461663_1462440_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_058482535.1|1462443_1463505_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_058482536.1|1463673_1465515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058482537.1|1465724_1467305_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	2.3e-09
WP_065238371.1|1467368_1467749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058482539.1|1467931_1468639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095140548.1|1468927_1470078_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_095140593.1|1470376_1471537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058483588.1|1471781_1473338_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_058483589.1|1473484_1474882_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_058483590.1|1474905_1475202_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_058483591.1|1475194_1476334_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_157737714.1|1476555_1478739_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.8	1.4e-25
WP_082642782.1|1478814_1479960_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_058483593.1|1480402_1480825_+	hypothetical protein	NA	NA	NA	NA	NA
1481021:1481075	attL	ATTCGTAATCAATAGGTCTGCGGTTCGATTCCGCACAACGGCATAGTAAAATCAA	NA	NA	NA	NA
WP_133141205.1|1481257_1481596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058483852.1|1481776_1482982_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	8.7e-49
WP_058483333.1|1483137_1483401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058483334.1|1483658_1485413_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	30.5	2.3e-58
WP_058483335.1|1485490_1485739_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058483563.1|1486264_1486924_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	28.3	2.5e-13
WP_058483337.1|1487378_1487660_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_058483338.1|1487669_1487993_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	36.8	1.4e-06
WP_058483339.1|1488669_1488918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058483340.1|1489131_1490127_-	virulence protein RhuM/Fic/DOC family protein	NA	Q9JMN3	Wolbachia_phage	41.5	3.0e-23
WP_058483341.1|1490167_1491412_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHM8	Moraxella_phage	33.5	7.1e-54
WP_058483342.1|1491670_1492858_-	HipA domain-containing protein	NA	NA	NA	NA	NA
1491579:1491633	attR	ATTCGTAATCAATAGGTCTGCGGTTCGATTCCGCACAACGGCATAGTAAAATCAA	NA	NA	NA	NA
WP_058483343.1|1492850_1493099_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058483344.1|1493634_1494330_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_133141134.1|1494502_1495051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058483346.1|1495389_1495686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058483347.1|1496137_1496614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058483348.1|1496836_1498219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058483564.1|1498334_1499390_-	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058483349.1|1499595_1501281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058483350.1|1501644_1503783_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.6	7.2e-14
WP_058483351.1|1503779_1505957_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.0	4.8e-21
WP_058483352.1|1505953_1507234_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_LT906457	Legionella spiritensis strain NCTC11990 chromosome 1	3348070	2129796	2138948	3348070		Staphylococcus_phage(42.86%)	8	NA	NA
WP_058482931.1|2129796_2130624_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.5e-52
WP_058482932.1|2130620_2132261_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	2.8e-151
WP_058482933.1|2132496_2132964_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.1	1.9e-23
WP_058482934.1|2132977_2134186_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.6	5.9e-98
WP_058482935.1|2134182_2134797_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.2	3.0e-21
WP_058482936.1|2134781_2135855_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.6	2.8e-38
WP_082642737.1|2136007_2137450_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_058482938.1|2137616_2138948_-	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	32.8	3.1e-07
