The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906480	Stenotrophomonas maltophilia strain NCTC10257 chromosome 1	5004261	260892	317170	5004261	tRNA,holin,capsid,transposase,portal,terminase,integrase,plate,head,tail	Stenotrophomonas_phage(80.49%)	70	253294:253325	296987:297018
253294:253325	attL	GGTAGTGCCGGCCGCTGGCCGGCAACCTCATG	NA	NA	NA	NA
WP_095052078.1|260892_261309_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	58.3	5.3e-30
WP_024956203.1|261669_264366_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	83.5	0.0e+00
WP_024956202.1|264469_265105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095052080.1|265254_265491_-	hypothetical protein	NA	V9IQH4	Stenotrophomonas_phage	52.0	4.1e-11
WP_024956200.1|265511_265820_-	hypothetical protein	NA	V9IQM8	Stenotrophomonas_phage	52.4	2.4e-19
WP_024956199.1|265819_266062_-	hypothetical protein	NA	V9IQX5	Stenotrophomonas_phage	67.5	1.6e-23
WP_024956198.1|266385_266592_-	hypothetical protein	NA	V9IQL4	Stenotrophomonas_phage	73.5	5.5e-20
WP_032963111.1|266658_267003_-	ogr/Delta-like zinc finger family protein	NA	V9IQW3	Stenotrophomonas_phage	62.8	5.3e-36
WP_076738385.1|266999_267332_-	hypothetical protein	NA	A0A1B0VRL1	Pseudomonas_phage	52.5	1.7e-07
WP_050426929.1|267476_267848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956196.1|268232_269264_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	71.6	4.6e-123
WP_024956195.1|269260_269662_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	79.4	1.6e-52
WP_024956194.1|269673_272538_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	82.2	0.0e+00
WP_169800875.1|272560_272698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032963109.1|272710_272827_-|tail	GpE family phage tail protein	tail	V9IQH2	Stenotrophomonas_phage	97.4	8.9e-12
WP_024956193.1|272835_273147_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	83.2	8.2e-36
WP_024956192.1|273207_273717_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	91.7	2.7e-84
WP_024956191.1|273737_274907_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	65.2	6.3e-145
WP_024956190.1|274922_275273_-	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	67.2	2.6e-38
WP_024956189.1|275269_275818_-|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	52.6	7.0e-38
WP_024956188.1|276105_277272_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	48.3	2.3e-54
WP_024956187.1|277275_277827_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	57.7	3.6e-58
WP_024956186.1|277819_278710_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	66.2	2.0e-106
WP_024956185.1|278796_279258_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	85.3	2.1e-64
WP_024956184.1|279254_279740_-|tail	phage tail protein	tail	V9IQM0	Stenotrophomonas_phage	76.5	2.0e-60
WP_024956183.1|279736_280261_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	70.2	2.0e-50
WP_024956182.1|280260_280896_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	86.3	1.4e-77
WP_024956181.1|280897_281173_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	76.7	2.0e-33
WP_024956180.1|281165_281525_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	90.7	2.1e-43
WP_024956179.1|281527_281743_-|tail	tail protein X	tail	V9IQL8	Stenotrophomonas_phage	62.0	2.6e-17
WP_024956178.1|281742_282210_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	96.8	1.7e-77
WP_024956177.1|282314_283022_-|terminase	terminase	terminase	V9IQK3	Stenotrophomonas_phage	98.8	2.9e-84
WP_024956176.1|283024_284041_-|capsid	phage major capsid protein, P2 family	capsid	V9IQV7	Stenotrophomonas_phage	88.5	2.0e-163
WP_024956175.1|284074_284935_-|capsid	GPO family capsid scaffolding protein	capsid	V9IQG8	Stenotrophomonas_phage	96.1	1.7e-118
WP_024956174.1|285089_286847_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	97.0	0.0e+00
WP_024956173.1|286846_287860_+|portal	phage portal protein	portal	V9IQW4	Stenotrophomonas_phage	97.1	2.5e-174
WP_076738492.1|287856_288114_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	97.6	1.1e-41
WP_024956172.1|288031_288742_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	96.6	2.6e-133
WP_024956171.1|288807_289509_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_024956170.1|290672_291017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139338717.1|291112_291643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024956169.1|291611_292712_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	39.8	8.2e-62
WP_032963106.1|292837_293833_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005407693.1|294046_294421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136763.1|294494_295178_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032963125.1|295203_296628_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_169922258.1|297403_298195_-	zinc-dependent peptidase	NA	NA	NA	NA	NA
296987:297018	attR	GGTAGTGCCGGCCGCTGGCCGGCAACCTCATG	NA	NA	NA	NA
WP_005411956.1|298161_298440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024956165.1|298584_299550_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_005407698.1|299546_300278_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_005411958.1|300287_301142_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_005407702.1|301449_301755_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	47.4	1.1e-19
WP_005407703.1|301795_302098_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	39.3	4.1e-08
WP_143568664.1|302355_302655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024956163.1|302735_303143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005411960.1|303737_304508_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_024956162.1|304532_304880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005407709.1|305010_305931_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.6	6.4e-28
WP_005407710.1|306091_306229_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004153772.1|306436_306658_+	CsbD family protein	NA	NA	NA	NA	NA
WP_024956161.1|306731_307541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024956160.1|307649_308942_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024956159.1|309109_309406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956158.1|309649_310582_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024956157.1|310687_312340_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024956156.1|312523_312823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005407717.1|312890_314225_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.1	6.5e-29
WP_024956155.1|314446_315574_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024956154.1|315564_316302_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	1.2e-13
WP_099482019.1|316288_317170_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT906480	Stenotrophomonas maltophilia strain NCTC10257 chromosome 1	5004261	629923	641053	5004261		Enterobacteria_phage(42.86%)	8	NA	NA
WP_012479083.1|629923_630979_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	2.4e-79
WP_012479084.1|630993_631881_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.9	9.7e-98
WP_024957341.1|631877_632435_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	3.2e-46
WP_024957340.1|632431_633337_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.2	4.1e-27
WP_044571172.1|633457_634825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957338.1|634877_636281_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.9	1.5e-39
WP_024957337.1|636292_637639_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.6	2.9e-29
WP_024957336.1|637735_641053_-	DEAD/DEAH box helicase	NA	Q9YNZ9	Choristoneura_fumiferana_nuclear_polyhedrosis_virus	30.0	1.9e-45
>prophage 3
NZ_LT906480	Stenotrophomonas maltophilia strain NCTC10257 chromosome 1	5004261	1017605	1153097	5004261	transposase,lysis,integrase,plate,tail	Pseudomonas_phage(35.29%)	148	1007666:1007691	1155920:1155945
1007666:1007691	attL	GCCGGCCAGCGGCCGGCACTACCGCC	NA	NA	NA	NA
WP_024957635.1|1017605_1018367_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	56.2	1.4e-76
WP_024957634.1|1018513_1019260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957633.1|1019265_1021530_-	hypothetical protein	NA	J9RWA5	Pseudomonas_phage	39.5	7.9e-136
WP_024957632.1|1021522_1021750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957631.1|1021749_1021980_-	hypothetical protein	NA	A0A0S0MV97	Pseudomonas_phage	62.7	8.8e-19
WP_024957630.1|1021990_1022773_-	DUF2163 domain-containing protein	NA	D2K0A8	Staphylococcus_phage	34.7	2.9e-37
WP_024957629.1|1022769_1024470_-	hypothetical protein	NA	J9SU43	Pseudomonas_phage	41.8	5.1e-111
WP_024957628.1|1024469_1025444_-	hypothetical protein	NA	A0A0U2KZ01	Pseudomonas_phage	25.6	1.9e-09
WP_024957627.1|1025451_1026426_-	hypothetical protein	NA	A0A0S0N918	Pseudomonas_phage	27.6	3.4e-19
WP_024957626.1|1026428_1029950_-	hypothetical protein	NA	L7P7M2	Pseudomonas_phage	26.7	3.7e-39
WP_153857040.1|1029952_1030093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957625.1|1030134_1030644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957624.1|1030643_1031399_-	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	28.9	2.2e-18
WP_024957623.1|1031402_1031624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957622.1|1031620_1032097_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	44.7	3.6e-30
WP_024957621.1|1032093_1032627_-	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	42.2	5.2e-30
WP_024957620.1|1032636_1033131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957619.1|1033292_1034237_-	hypothetical protein	NA	R9U4B8	Rhizobium_phage	43.5	2.9e-68
WP_024957618.1|1034262_1034604_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_143566002.1|1034626_1035742_-	peptidase	NA	J9SGT4	Pseudomonas_phage	48.8	5.5e-66
WP_024957616.1|1036128_1036698_-	phage virion morphogenesis protein	NA	J9SU29	Pseudomonas_phage	38.5	2.3e-20
WP_024957615.1|1036697_1037975_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	60.1	5.2e-84
WP_024957614.1|1037978_1039505_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	57.4	4.2e-165
WP_024957613.1|1039501_1041238_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	44.0	1.7e-101
WP_050426959.1|1041238_1041787_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	38.7	2.6e-24
WP_049397751.1|1041800_1042061_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	60.5	1.8e-23
WP_024957610.1|1042120_1042438_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	39.4	6.0e-10
WP_024957609.1|1042434_1042941_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_024957608.1|1042940_1043459_-	lysozyme	NA	U3TK98	Ralstonia_phage	41.4	7.1e-24
WP_024957607.1|1043677_1044097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957606.1|1044175_1044547_-	helix-turn-helix domain-containing protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	39.8	2.9e-11
WP_024957605.1|1044660_1044870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957604.1|1044866_1045100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008267142.1|1045096_1045390_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024957603.1|1045389_1046322_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	34.4	2.2e-20
WP_024957602.1|1046323_1048126_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	45.5	8.5e-125
WP_024957601.1|1048122_1049298_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	53.2	6.2e-100
WP_024957600.1|1049299_1049698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957599.1|1049699_1049936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957598.1|1049928_1050168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957597.1|1050167_1050476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957596.1|1050477_1050867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957595.1|1050856_1051132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957594.1|1051124_1051352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957593.1|1051348_1051828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957592.1|1051827_1052082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957591.1|1052078_1052690_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	62.1	3.7e-64
WP_024957590.1|1052691_1053384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957589.1|1053370_1054276_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.8	5.5e-40
WP_024957588.1|1054284_1054653_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_024957587.1|1054645_1054852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154699832.1|1054851_1055028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024957586.1|1055024_1055489_+	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	40.2	1.3e-16
WP_152907779.1|1055485_1055842_+	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	37.7	2.4e-07
WP_005408281.1|1056679_1057084_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.3	1.3e-17
WP_012479274.1|1057161_1058208_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_024958155.1|1058228_1058978_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_005408284.1|1058977_1059745_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005408285.1|1059741_1060131_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005408286.1|1060606_1060924_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_038645586.1|1061282_1072187_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_024956128.1|1072243_1072687_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032963083.1|1073061_1073436_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_024956126.1|1073815_1075879_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.4	2.1e-47
WP_005408298.1|1075885_1076206_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_024956125.1|1076317_1076917_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005408300.1|1076984_1077344_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_005408301.1|1077421_1077949_-	membrane protein	NA	NA	NA	NA	NA
WP_024956124.1|1077945_1079895_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_005408303.1|1079887_1080832_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_024956122.1|1080834_1081788_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024956121.1|1081830_1083672_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024956120.1|1083919_1084489_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_012479287.1|1084602_1085112_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_005408308.1|1085219_1085414_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_005408309.1|1085505_1086483_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_005408310.1|1086561_1087344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956119.1|1087583_1088528_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_005408312.1|1088610_1089354_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	4.7e-13
WP_005408313.1|1089506_1089746_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	4.6e-10
WP_005412446.1|1089889_1091152_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024956118.1|1091342_1092707_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_024956117.1|1092905_1093967_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_005408317.1|1093963_1094629_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.9	5.5e-21
WP_024956116.1|1094625_1095582_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_005412452.1|1095578_1095932_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_024956115.1|1096351_1096732_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_024956114.1|1096762_1097836_-|tail	phage tail protein	tail	D5LGY1	Escherichia_phage	52.2	8.4e-96
WP_005408322.1|1097826_1098042_-|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	54.3	1.6e-14
WP_005408323.1|1098025_1098493_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	35.2	1.1e-15
WP_024956113.1|1098495_1100943_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	23.0	1.6e-25
WP_005412456.1|1101063_1101354_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	58.5	1.5e-18
WP_005412457.1|1101434_1101938_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	51.2	1.4e-40
WP_024956112.1|1101940_1103143_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	54.2	3.6e-127
WP_012479299.1|1103249_1103909_-	hypothetical protein	NA	V9IQM3	Stenotrophomonas_phage	32.9	6.2e-17
WP_024956111.1|1103910_1105878_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	38.9	1.8e-104
WP_024956110.1|1105885_1106665_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	50.6	1.2e-43
WP_024956109.1|1106657_1107554_-|plate	baseplate J/gp47 family protein	plate	V5YTH6	Pseudomonas_phage	56.1	1.2e-79
WP_005408332.1|1107556_1107895_-	GPW/gp25 family protein	NA	A0A193GYY8	Enterobacter_phage	62.2	7.8e-32
WP_024956108.1|1107947_1108538_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	37.7	3.6e-24
WP_024956107.1|1108534_1109089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158079763.1|1109213_1109357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956106.1|1109441_1109819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024956105.1|1109815_1110301_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	55.0	6.0e-41
WP_024956104.1|1110297_1110648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005408338.1|1110644_1111094_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005408339.1|1111428_1111812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024956103.1|1111964_1112603_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	37.6	2.0e-20
WP_024956102.1|1112644_1112872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024956101.1|1113223_1115560_-	toprim domain-containing protein	NA	D5LH15	Escherichia_phage	43.1	6.2e-136
WP_024956100.1|1116046_1116271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005408345.1|1116282_1116537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956099.1|1116748_1117135_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_024956098.1|1117263_1119402_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024956097.1|1119413_1120919_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024956096.1|1120928_1122062_-	MFS transporter	NA	NA	NA	NA	NA
WP_024956095.1|1122073_1122850_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_024956094.1|1123007_1123655_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_024956093.1|1123658_1124333_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024956092.1|1124420_1125119_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_024956091.1|1125234_1126179_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024956090.1|1126117_1127497_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005412480.1|1127630_1128494_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024956089.1|1128652_1129534_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024956088.1|1129572_1130451_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024956087.1|1130464_1131364_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	21.2	9.5e-08
WP_024956086.1|1131471_1132989_+	MFS transporter	NA	NA	NA	NA	NA
WP_005408360.1|1133268_1133673_-	GFA family protein	NA	NA	NA	NA	NA
WP_005408361.1|1133844_1134819_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024956085.1|1134818_1136840_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024956084.1|1136928_1138350_-	MFS transporter	NA	NA	NA	NA	NA
WP_005412484.1|1138379_1138814_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_024956083.1|1138886_1139489_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_024956082.1|1139587_1140463_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024956081.1|1140639_1141461_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024956080.1|1141479_1142157_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004147099.1|1142244_1143282_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_005408369.1|1143382_1144525_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_024956079.1|1144732_1145716_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024956078.1|1145763_1146663_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005412490.1|1146756_1146966_+	DUF4287 domain-containing protein	NA	NA	NA	NA	NA
WP_024956077.1|1147076_1147784_+	YitT family protein	NA	NA	NA	NA	NA
WP_024956076.1|1147867_1148413_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024956075.1|1148409_1150197_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_005408377.1|1150288_1150855_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005408378.1|1150847_1151342_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024956074.1|1151357_1152308_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_005408380.1|1152605_1153097_+|transposase	transposase	transposase	NA	NA	NA	NA
1155920:1155945	attR	GGCGGTAGTGCCGGCCGCTGGCCGGC	NA	NA	NA	NA
>prophage 4
NZ_LT906480	Stenotrophomonas maltophilia strain NCTC10257 chromosome 1	5004261	2063164	2076893	5004261	capsid,portal,terminase,head,tail,protease	Pseudomonas_phage(50.0%)	22	NA	NA
WP_024956453.1|2063164_2064058_+	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	41.0	6.7e-30
WP_024956454.1|2064047_2064710_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	38.8	4.8e-25
WP_024956455.1|2064706_2064904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956456.1|2064903_2065272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956457.1|2065268_2065478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956458.1|2065467_2065896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956459.1|2066077_2066365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956460.1|2066430_2066919_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	78.8	3.7e-67
WP_024956461.1|2066915_2067230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956462.1|2067368_2067740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956464.1|2068540_2068885_+	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	66.7	6.7e-39
WP_024956465.1|2069047_2069311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956466.1|2069310_2069709_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	45.1	1.4e-11
WP_024956467.1|2069787_2070168_+	hypothetical protein	NA	Q9XJT7	Pseudomonas_phage	53.2	9.7e-31
WP_024956468.1|2070171_2071842_+|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	69.0	1.7e-223
WP_024956469.1|2071841_2073146_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	29.9	5.9e-43
WP_024956470.1|2073132_2073867_+|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	50.0	4.5e-48
WP_024956471.1|2073935_2075180_+|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	46.8	6.3e-95
WP_024956472.1|2075237_2075642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024956473.1|2075645_2076068_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_024956474.1|2076064_2076397_+|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	36.4	1.4e-12
WP_005408963.1|2076389_2076893_+	HK97 gp10 family phage protein	NA	Q8W6U1	Burkholderia_virus	32.5	4.3e-10
>prophage 5
NZ_LT906480	Stenotrophomonas maltophilia strain NCTC10257 chromosome 1	5004261	2533269	2540357	5004261		Stenotrophomonas_phage(75.0%)	10	NA	NA
WP_024957387.1|2533269_2534388_-	sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	38.1	5.0e-59
WP_024957388.1|2534374_2534944_-	hypothetical protein	NA	S0F2J2	Stenotrophomonas_phage	70.1	5.5e-38
WP_024957389.1|2535076_2535310_+	hypothetical protein	NA	S0F3S0	Stenotrophomonas_phage	69.6	2.6e-10
WP_024957390.1|2535299_2536406_+	replication initiation factor domain-containing protein	NA	S0F3I3	Stenotrophomonas_phage	86.1	1.3e-189
WP_005413368.1|2536410_2536710_+	hypothetical protein	NA	S0F3B2	Stenotrophomonas_phage	94.9	8.4e-46
WP_024957392.1|2537409_2538135_+	hypothetical protein	NA	Q4LAU2	Stenotrophomonas_phage	63.2	1.2e-21
WP_024957393.1|2538134_2538419_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_024957394.1|2538415_2539633_+	hypothetical protein	NA	A0A077JGB2	Xanthomonas_phage	31.6	4.8e-39
WP_143568600.1|2539646_2539964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024957395.1|2540033_2540357_-	hypothetical protein	NA	S0F2C0	Stenotrophomonas_phage	95.3	1.3e-52
>prophage 6
NZ_LT906480	Stenotrophomonas maltophilia strain NCTC10257 chromosome 1	5004261	3429070	3468903	5004261	tRNA,capsid,portal,terminase,head,tail	Acidithiobacillus_phage(45.71%)	54	NA	NA
WP_032964312.1|3429070_3429919_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.3	4.1e-05
WP_024958079.1|3430038_3430788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076738371.1|3430877_3431093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958077.1|3431089_3431563_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	51.4	1.4e-34
WP_024958076.1|3431559_3432972_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.3	6.2e-139
WP_024958075.1|3432968_3433433_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	37.3	2.4e-15
WP_020200569.1|3433607_3433871_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024958074.1|3433882_3434359_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	63.9	4.3e-52
WP_024958073.1|3434364_3434646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958072.1|3434648_3435407_+	hypothetical protein	NA	K4I1D2	Acidithiobacillus_phage	68.1	8.6e-87
WP_095052067.1|3435403_3436267_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	70.9	1.8e-109
WP_024958070.1|3436272_3436902_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	69.9	1.9e-79
WP_024958069.1|3436911_3437400_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	81.8	4.1e-74
WP_024958068.1|3437396_3438134_+|tRNA	isoleucyl-tRNA synthetase	tRNA	K4HZA0	Acidithiobacillus_phage	73.4	2.8e-106
WP_024958067.1|3438130_3438358_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024958066.1|3438350_3440642_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.5	3.0e-292
WP_024958065.1|3440767_3441232_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	71.8	5.1e-58
WP_024958064.1|3441233_3441437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958063.1|3441429_3441816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032964308.1|3442144_3443578_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	61.3	3.5e-166
WP_024958062.1|3443574_3444816_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	89.4	1.2e-215
WP_024958061.1|3444760_3445000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024958060.1|3444999_3445362_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	88.3	2.8e-59
WP_024958059.1|3445459_3445819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024958058.1|3445948_3446512_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	74.3	6.9e-33
WP_024958057.1|3446606_3446804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024958056.1|3446921_3447458_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	86.5	5.2e-78
WP_024958055.1|3447457_3449419_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	90.2	0.0e+00
WP_024958054.1|3449436_3449928_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	50.6	5.9e-28
WP_024958053.1|3449927_3450320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958052.1|3450319_3450541_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	56.2	6.9e-13
WP_024958051.1|3450543_3452076_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.5	9.1e-152
WP_024958050.1|3452077_3453385_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	52.9	1.3e-66
WP_024958049.1|3453388_3453766_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	52.0	2.5e-26
WP_024958048.1|3453840_3454863_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	62.7	8.0e-120
WP_024958047.1|3454862_3455141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958046.1|3455151_3455577_+	hypothetical protein	NA	F4YCS3	Synechococcus_phage	31.7	3.6e-10
WP_032964302.1|3455584_3455797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958045.1|3455799_3456552_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.2	2.1e-56
WP_024958044.1|3456551_3456953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169800872.1|3456982_3457138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958043.1|3457141_3457783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958042.1|3457782_3460488_+|tail	tail protein	tail	A0A0U2BXT9	Paracoccus_phage	33.3	4.7e-26
WP_024958041.1|3460493_3461552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958040.1|3461548_3463132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024958039.1|3463137_3463926_+	DUF2163 domain-containing protein	NA	A0A0S0MV27	Pseudomonas_phage	33.5	5.5e-28
WP_009521704.1|3463944_3464172_+	hypothetical protein	NA	A0A2D0W9G1	Bordetella_phage	71.1	1.5e-10
WP_032964326.1|3464201_3464384_+	hypothetical protein	NA	A0A2D0W982	Bordetella_phage	60.4	2.6e-10
WP_024958037.1|3464383_3466654_+|tail	tail assembly protein	tail	A0A0S0MX47	Pseudomonas_phage	38.2	2.1e-128
WP_024958036.1|3466653_3467250_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024958035.1|3467253_3467604_+	DUF2793 domain-containing protein	NA	A0A1X9IAR6	Xanthomonas_phage	58.6	5.4e-36
WP_020200523.1|3467669_3467975_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	64.6	4.1e-24
WP_024958034.1|3467971_3468448_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	89.2	3.9e-77
WP_032964294.1|3468444_3468903_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	79.5	2.3e-63
