The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT897797	Vibrio cholerae isolate Vibrio cholerae str. BC1071 chromosome I	2976768	695307	701924	2976768		Staphylococcus_phage(66.67%)	7	NA	NA
WP_101410228.1|695307_696441_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	9.0e-64
WP_000366561.1|696452_697703_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	1.5e-99
WP_000543544.1|697802_698252_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_101410230.1|698277_699381_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.3	3.5e-44
WP_000493874.1|699385_700039_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001122865.1|700079_701189_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000864130.1|701453_701924_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
>prophage 2
NZ_LT897797	Vibrio cholerae isolate Vibrio cholerae str. BC1071 chromosome I	2976768	2230844	2238036	2976768		Anguillid_herpesvirus(16.67%)	9	NA	NA
WP_001162850.1|2230844_2231273_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
WP_000107237.1|2231476_2232766_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_000872176.1|2232985_2233180_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124187.1|2233227_2233566_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_101410982.1|2233579_2235430_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	4.1e-106
WP_001105750.1|2235453_2235969_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000301571.1|2236017_2236341_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_000331703.1|2236401_2236785_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000775249.1|2236821_2238036_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.8	8.8e-33
>prophage 3
NZ_LT897797	Vibrio cholerae isolate Vibrio cholerae str. BC1071 chromosome I	2976768	2470729	2477954	2976768		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_101411053.1|2470729_2471617_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
WP_101411359.1|2471885_2474474_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	7.6e-34
WP_000116735.1|2474566_2475574_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_101411055.1|2475647_2476583_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000002982.1|2476582_2477209_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_000698379.1|2477201_2477954_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	8.0e-69
>prophage 4
NZ_LT897797	Vibrio cholerae isolate Vibrio cholerae str. BC1071 chromosome I	2976768	2512595	2583640	2976768	transposase,integrase	Klebsiella_phage(14.29%)	59	2533001:2533021	2566738:2566758
WP_101411091.1|2512595_2513963_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	31.0	4.1e-39
WP_084981219.1|2514352_2515444_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.2	9.6e-47
WP_101411093.1|2515658_2518274_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101411095.1|2518276_2518603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047459450.1|2519731_2519971_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_084981215.1|2519972_2520317_+	TraK family protein	NA	NA	NA	NA	NA
WP_101411097.1|2520660_2521023_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_101411099.1|2521028_2522801_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_101411101.1|2522830_2523607_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_101411103.1|2523609_2523798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101411105.1|2523800_2524892_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_055467080.1|2524992_2525238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101411107.1|2525405_2526131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101411109.1|2526628_2526904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101411111.1|2527009_2527777_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_145958147.1|2527863_2528706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101411115.1|2529788_2531549_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000028568.1|2531805_2532885_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
2533001:2533021	attL	AACAATAAAGTTTGAAACTAA	NA	NA	NA	NA
WP_172440145.1|2533254_2533569_-	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_145958148.1|2533714_2534275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078925056.1|2534293_2534848_-	copper-binding protein	NA	NA	NA	NA	NA
WP_101411121.1|2534917_2538043_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_101411123.1|2538042_2539752_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101411125.1|2539765_2541157_-	TolC family protein	NA	NA	NA	NA	NA
WP_101411127.1|2541737_2543057_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_101411129.1|2543053_2543737_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	3.9e-30
WP_145958153.1|2543767_2544109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101411131.1|2544182_2544548_-	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_145958149.1|2544805_2545762_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_074373097.1|2545858_2546101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074373098.1|2546120_2546408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101411133.1|2546741_2547650_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.5	3.5e-103
WP_042521796.1|2548476_2550237_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_042521878.1|2550251_2551076_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_095664554.1|2551116_2551605_+	cupredoxin family protein	NA	NA	NA	NA	NA
WP_095664556.1|2551849_2552581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095664557.1|2552561_2552867_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_095664560.1|2553570_2553984_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095664561.1|2554490_2554871_-	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
WP_101411135.1|2555409_2558130_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	2.1e-98
WP_095664563.1|2558131_2558596_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101411137.1|2558955_2560584_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_101411139.1|2560593_2562111_-	TniQ family protein	NA	NA	NA	NA	NA
WP_101411141.1|2562113_2563772_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_101411143.1|2563771_2565871_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_101411145.1|2565842_2566673_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000334132.1|2566811_2568644_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	43.0	1.1e-130
2566738:2566758	attR	TTAGTTTCAAACTTTATTGTT	NA	NA	NA	NA
WP_001906605.1|2568706_2569477_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000751457.1|2569904_2571317_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_000764703.1|2571850_2572546_-	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_001214483.1|2572646_2573543_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_001104702.1|2573707_2574343_+	amino acid transporter	NA	NA	NA	NA	NA
WP_000896747.1|2574406_2575270_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_000034368.1|2575566_2576643_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000111267.1|2576798_2577962_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000946626.1|2578110_2579136_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000086053.1|2579287_2581246_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.1	5.8e-10
WP_001153529.1|2581390_2582287_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101411147.1|2582317_2583640_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_LT897798	Vibrio cholerae isolate Vibrio cholerae str. BC1071 chromosome II	1217808	82470	142361	1217808	tail,plate,transposase,head	Vibrio_phage(84.0%)	75	NA	NA
WP_101411269.1|82470_83511_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	82.1	1.3e-170
WP_084981268.1|83776_84826_-	potassium channel protein	NA	NA	NA	NA	NA
WP_084981269.1|84827_85481_-	DUF2491 family protein	NA	NA	NA	NA	NA
WP_084981270.1|85541_86231_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_172440148.1|86249_86645_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_101411443.1|86658_87825_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	34.7	6.0e-63
WP_084981273.1|87842_88781_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_084981274.1|88792_89203_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_101411445.1|90127_91258_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000478181.1|91257_91647_-	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_057568069.1|91781_93362_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.3	3.3e-16
WP_000361580.1|93342_94830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132380.1|94984_96454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224891.1|96518_97229_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001195137.1|97550_98504_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000226962.1|98493_99291_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	31.2	1.5e-17
WP_057568071.1|99300_100710_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.7	8.8e-61
WP_000270236.1|100718_101639_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_001038496.1|101724_101973_-	membrane protein	NA	NA	NA	NA	NA
WP_001159703.1|102514_103861_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.0	2.6e-41
WP_101411147.1|105005_106328_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_101411447.1|108312_108846_-	hypothetical protein	NA	H9C146	Vibrio_phage	62.2	9.5e-32
WP_101411449.1|108845_109757_-|tail	phage tail protein	tail	A0A1V0E875	Vibrio_phage	63.0	3.5e-50
WP_101411451.1|109756_110344_-	DUF2313 domain-containing protein	NA	A0A2I7S9L6	Vibrio_phage	79.5	9.6e-94
WP_101411453.1|110328_111396_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	71.8	4.7e-147
WP_000095018.1|111385_111835_-	phage GP46 family protein	NA	M4MB61	Vibrio_phage	73.6	1.1e-54
WP_172440201.1|111837_112419_-|plate	phage baseplate assembly protein V	plate	M4MCP6	Vibrio_phage	72.6	1.6e-72
WP_101411457.1|112448_113525_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	75.4	4.4e-161
WP_095459057.1|113517_114837_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	67.6	9.5e-166
WP_101411459.1|114848_116600_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	68.3	7.8e-216
WP_000996594.1|116725_117070_-|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	81.4	2.8e-45
WP_000024434.1|117069_117423_-|tail	phage tail tube protein	tail	A0A2I7S9D5	Vibrio_phage	68.4	8.7e-42
WP_101411461.1|117437_118922_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	72.9	7.8e-209
WP_000437436.1|118924_119125_-	DUF2635 domain-containing protein	NA	A0A2I7S9K4	Vibrio_phage	43.5	2.6e-06
WP_101411463.1|119138_119738_-	hypothetical protein	NA	M4MHF0	Vibrio_phage	60.7	1.3e-66
WP_101411465.1|119734_120277_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	76.5	2.4e-75
WP_001029275.1|120276_120711_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	88.2	3.3e-67
WP_101411467.1|120716_121292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101411469.1|121357_122257_-|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	63.7	1.1e-109
WP_001262461.1|122271_123225_-	hypothetical protein	NA	M1Q578	Vibrio_phage	58.0	5.9e-93
WP_001249581.1|123557_123842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101411471.1|123841_124477_-	hypothetical protein	NA	A0A1V0E8A2	Vibrio_phage	46.7	5.1e-40
WP_071917805.1|124473_124986_-	hypothetical protein	NA	A0A0F6N5P8	Escherichia_phage	47.5	1.4e-32
WP_000246042.1|124982_125231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101411473.1|125242_126016_-	hypothetical protein	NA	M1PVV7	Vibrio_phage	76.3	3.1e-116
WP_101411475.1|126111_127671_-	DUF935 domain-containing protein	NA	M4M9P3	Vibrio_phage	74.8	7.4e-226
WP_101411477.1|127667_129233_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	78.0	7.7e-231
WP_001195539.1|129233_129815_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	70.0	3.0e-63
WP_000008606.1|129826_130117_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	82.3	3.9e-40
WP_000230647.1|130125_130428_-	DUF2730 family protein	NA	M4M9P7	Vibrio_phage	51.5	3.6e-20
WP_001281317.1|130427_130658_-	TraR/DksA C4-type zinc finger protein	NA	M4MHG5	Vibrio_phage	63.2	8.8e-19
WP_001120998.1|130654_131254_-	hypothetical protein	NA	M1NVP4	Vibrio_phage	57.3	5.8e-46
WP_000828641.1|131229_131517_-	hypothetical protein	NA	M4MCR6	Vibrio_phage	50.5	3.3e-15
WP_032474402.1|131516_132074_-	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	72.1	2.2e-71
WP_001070512.1|132158_132578_-	hypothetical protein	NA	M4MHG9	Vibrio_phage	43.0	7.2e-27
WP_101411479.1|132655_132904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101411481.1|132890_133469_-	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	59.3	1.1e-54
WP_000404914.1|133481_133760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466683.1|133762_133996_-	hypothetical protein	NA	M4M9N5	Vibrio_phage	67.5	8.3e-25
WP_101411484.1|134076_134283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762331.1|134282_134813_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	42.9	2.2e-28
WP_101411486.1|134809_135280_-	hypothetical protein	NA	M4MHH2	Vibrio_phage	62.9	2.0e-49
WP_101411488.1|135276_135474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551393.1|135457_135700_-	hypothetical protein	NA	M4MCS5	Vibrio_phage	62.0	4.2e-19
WP_101411490.1|135692_135965_-	hypothetical protein	NA	A0A2I7S9G2	Vibrio_phage	61.2	1.0e-21
WP_001192101.1|135974_136589_-	DUF3164 family protein	NA	M4MHH7	Vibrio_phage	79.6	2.6e-86
WP_000806306.1|136575_136773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032732.1|136769_137090_-	hypothetical protein	NA	M4MB90	Vibrio_phage	60.6	1.8e-25
WP_032474409.1|137099_137516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157299.1|137525_137750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800334.1|137757_138702_-	AAA family ATPase	NA	M4M9P4	Vibrio_phage	73.7	1.1e-126
WP_101411492.1|138728_140693_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2I7S9A8	Vibrio_phage	71.7	3.1e-282
WP_000442472.1|140740_140965_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	83.8	9.1e-29
WP_101411494.1|141139_141883_+	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	73.9	1.1e-102
WP_046126509.1|142031_142361_-	DUF3486 family protein	NA	M4MCT3	Vibrio_phage	67.3	1.2e-32
>prophage 2
NZ_LT897798	Vibrio cholerae isolate Vibrio cholerae str. BC1071 chromosome II	1217808	964364	975505	1217808	holin	Vibrio_phage(44.44%)	14	NA	NA
WP_101412113.1|964364_965972_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	45.3	6.6e-129
WP_000117294.1|968561_969191_-	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	33.3	1.5e-23
WP_057573328.1|969190_969790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101412115.1|969792_970257_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	48.6	1.4e-26
WP_000149719.1|970314_970695_-	hypothetical protein	NA	M4MCI2	Vibrio_phage	31.1	1.8e-08
WP_101412117.1|970709_971915_-	DUF4043 family protein	NA	A0A088CC32	Shigella_phage	58.5	1.2e-135
WP_101412119.1|971977_972982_-	ATPase	NA	A0A1I9KFD1	Aeromonas_phage	32.6	1.5e-22
WP_032470296.1|973099_973360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228309.1|973371_973950_-	hypothetical protein	NA	A0A1V0E8A2	Vibrio_phage	36.9	7.9e-24
WP_000835320.1|973952_974174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172440184.1|974268_974445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359320.1|974449_974608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101412121.1|974617_975136_-	secretion activator protein	NA	Q6VT55	Vibrio_phage	62.6	8.0e-60
WP_001128531.1|975193_975505_-|holin	phage holin family protein	holin	R9TR41	Vibrio_phage	47.4	2.2e-20
