The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	375807	469466	4733003	terminase,head,tail,portal,integrase,capsid,lysis,plate	Salmonella_phage(81.25%)	104	376980:376996	474696:474712
WP_000089603.1|375807_376959_+|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	44.8	6.3e-49
376980:376996	attL	GTCATTTACGTGATTTA	NA	NA	NA	NA
WP_000455463.1|377055_377523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994659.1|377734_378610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149494.1|378797_379160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214158.1|379116_380031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001768408.1|380049_380790_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000013624.1|380768_381455_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000253629.1|381490_381991_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000626967.1|382000_382570_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000071290.1|382589_384680_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_010989289.1|384676_385435_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_000252871.1|385671_385926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251281.1|385925_386165_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000949576.1|386194_386557_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_000848326.1|386566_386941_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_000086082.1|386937_387591_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001240640.1|387590_388490_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001165842.1|388479_389958_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000244536.1|389944_390394_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_000054770.1|393383_393770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000821941.1|393924_394317_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000838927.1|394313_395282_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_010989292.1|395296_396727_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000213770.1|397059_398565_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000993574.1|398600_398990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000623988.1|399213_399456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283066.1|399860_401108_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	6.0e-61
WP_000502502.1|401092_401734_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	1.1e-55
WP_010989295.1|401944_402487_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_000907593.1|403752_404673_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_001020123.1|405396_405699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001103837.1|405794_406175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018145.1|406545_406755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979718.1|406772_407225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968700.1|407221_407518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000115421.1|407595_408054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|408142_410092_+	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
WP_000881183.1|410163_411072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000022216.1|411145_412045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000911568.1|412119_412446_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001222413.1|412545_412815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|412946_414221_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001039750.1|414440_414818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001775272.1|414904_415123_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001011750.1|415190_416291_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_000980405.1|416287_416773_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_161976233.1|416772_419319_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000763315.1|419545_419665_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|419679_419982_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_001207653.1|420036_420552_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046101.1|420561_421734_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_000388790.1|421836_422055_-	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000161708.1|422268_422991_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006337.1|423188_423596_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000104806.1|423602_425222_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_001086816.1|425218_425824_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000268327.1|425816_426725_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_000177408.1|426711_427071_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000993749.1|427067_427646_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000343944.1|427714_428161_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_001039966.1|428153_428585_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_024131238.1|428680_429109_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_000731034.1|429105_429483_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_001097942.1|429487_429997_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000171566.1|429977_430193_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_000868184.1|430196_430400_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673540.1|430399_430864_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000059175.1|430957_431608_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730751.1|431611_432676_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000216272.1|432692_433526_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_001098453.1|433668_435435_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_001681813.1|435434_436478_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_000080839.1|436526_437222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|437241_438306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|438302_439367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835188.1|439376_439595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|439690_439924_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154438.1|439935_440124_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_000104130.1|442677_443538_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001090717.1|443534_444119_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000785510.1|444115_444343_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001244240.1|444342_444576_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000963479.1|444643_444985_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_000956167.1|444948_445149_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000460852.1|445156_445666_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000102106.1|445698_445941_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000052560.1|446057_446690_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000027757.1|446693_447719_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_001681810.1|448825_449083_+	YjhX family toxin	NA	NA	NA	NA	NA
WP_001681808.1|449093_449984_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000354257.1|449983_450730_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000052242.1|451031_453002_-	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
WP_000431675.1|453021_454326_-	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000467404.1|454348_455044_-	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_001023498.1|455069_455864_-	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000720235.1|455873_456941_-	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_000632616.1|456985_458722_-	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_010989299.1|458721_461217_-	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000127915.1|461240_462287_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_000466893.1|462289_463567_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_001210944.1|463811_464351_-	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_001120833.1|465204_466716_+	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_000488995.1|466699_468289_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|468452_469466_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
474696:474712	attR	TAAATCACGTAAATGAC	NA	NA	NA	NA
>prophage 2
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	621641	629312	4733003	integrase	Enterobacteria_phage(33.33%)	7	612176:612189	625307:625320
612176:612189	attL	GTTAATGTTAAAAC	NA	NA	NA	NA
WP_000152561.1|621641_623132_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
WP_000772672.1|623602_624868_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000573583.1|624930_626007_-	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
625307:625320	attR	GTTTTAACATTAAC	NA	NA	NA	NA
WP_000700163.1|626003_627062_-	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000493739.1|627051_628215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214423.1|628490_629057_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000468230.1|629072_629312_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
>prophage 3
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	1290466	1296497	4733003		Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|1290466_1290613_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_106417236.1|1290628_1290772_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_044790602.1|1291761_1293684_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.0	3.6e-299
WP_000703599.1|1293700_1293955_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001682026.1|1293923_1294313_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000377769.1|1295555_1296497_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
>prophage 4
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	1531006	1540177	4733003	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1531006_1531954_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1531937_1532669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1532649_1532757_-	protein YohO	NA	NA	NA	NA	NA
WP_001240415.1|1532816_1533548_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272853.1|1533770_1535456_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_000598632.1|1535452_1536172_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1536218_1536686_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1536742_1537273_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1537444_1537903_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195338.1|1538143_1540177_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	1616068	1626575	4733003		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111852.1|1616068_1617472_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
WP_000981469.1|1617649_1618543_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1618919_1620005_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023656.1|1620004_1620904_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000857536.1|1620951_1621830_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_000973711.1|1621830_1622382_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018220.1|1622387_1623362_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1623377_1624151_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565909.1|1624155_1625235_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000126347.1|1625261_1626575_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	1732875	1740109	4733003		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1732875_1733295_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457648.1|1733297_1734566_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000208507.1|1735011_1735224_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_024131163.1|1735234_1735423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|1735683_1736868_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_000107435.1|1737518_1737830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377043.1|1737909_1738605_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_001157299.1|1738678_1740109_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	1943963	1948375	4733003		Escherichia_phage(50.0%)	7	NA	NA
WP_000281950.1|1943963_1944377_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_001766395.1|1944393_1945122_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000158843.1|1945313_1945856_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|1946003_1946381_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_001529135.1|1946453_1947263_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001036668.1|1947759_1947924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497459.1|1948135_1948375_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
>prophage 8
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	2129412	2202887	4733003	transposase,tail,integrase,capsid,protease,tRNA,plate	Burkholderia_virus(42.11%)	84	2168781:2168797	2201795:2201811
WP_000168626.1|2129412_2130687_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
WP_000765713.1|2131435_2132041_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100913.1|2132145_2133651_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030324.1|2134251_2134887_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289628.1|2134886_2135579_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920820.1|2135581_2136202_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231887.1|2136205_2137264_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915581.1|2137264_2139286_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_001092600.1|2139278_2139857_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133179.1|2139856_2140438_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214061.1|2140514_2140955_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217946.1|2141043_2141259_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_031608772.1|2141557_2141683_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_000998242.1|2141890_2142931_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000565566.1|2143004_2144006_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000753325.1|2144711_2146220_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170615.1|2146322_2147498_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066606.1|2147697_2149344_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_000259129.1|2149511_2150915_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000092483.1|2150911_2151841_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001681605.1|2151916_2153218_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000928668.1|2153328_2155035_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000824321.1|2155187_2156339_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_001080045.1|2156819_2157551_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524877.1|2157677_2158013_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000412353.1|2158074_2159457_-	amino acid permease	NA	NA	NA	NA	NA
WP_001165548.1|2159737_2160310_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_024131175.1|2160381_2160915_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.8	2.8e-44
WP_087795079.1|2162900_2163854_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	52.1	2.5e-59
WP_000852584.1|2163856_2164435_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_001219103.1|2164427_2165531_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000859114.1|2165521_2165869_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_000148263.1|2165925_2166453_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000808000.1|2166449_2167604_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000478221.1|2167591_2167804_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000458383.1|2167803_2168688_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_000135574.1|2168687_2171153_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
2168781:2168797	attL	GGCAGGCGCTGCGGTTT	NA	NA	NA	NA
WP_001148841.1|2171246_2171384_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084228.1|2171328_2171664_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110118.1|2171761_2172043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162828734.1|2172045_2172570_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000729859.1|2172566_2173994_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_000666498.1|2173983_2174235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|2174234_2174699_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|2174698_2175145_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|2175146_2175485_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286905.1|2175494_2176448_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_001273072.1|2176462_2177578_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_000135517.1|2177792_2178251_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_000117561.1|2178253_2179075_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000090679.1|2179055_2180552_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_170825686.1|2180551_2182093_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000124060.1|2182143_2182689_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|2182688_2183000_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|2182999_2183326_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264664.1|2183322_2183973_-	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_001104436.1|2183956_2184685_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000793143.1|2184687_2185038_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_100208317.1|2185281_2185878_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_144079282.1|2185921_2186305_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	58.9	1.7e-27
WP_000567456.1|2186314_2186479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990529.1|2186482_2188252_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_000960673.1|2188262_2189429_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000843446.1|2189431_2189701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2189728_2190259_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000632575.1|2190547_2190820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197790.1|2190829_2191132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2191128_2191512_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_153781233.1|2191519_2191720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2191716_2192400_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_000631816.1|2192396_2192627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989166.1|2192616_2192832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315282.1|2192824_2193274_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	9.4e-25
WP_001281695.1|2193245_2193635_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000769298.1|2193816_2194761_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001219360.1|2195287_2196817_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014056.1|2196827_2198216_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118268.1|2198390_2199425_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000500278.1|2199841_2200204_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001183821.1|2200190_2200520_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000549642.1|2200554_2201376_-|protease	serine protease	protease	NA	NA	NA	NA
WP_001766314.1|2201644_2201896_-	acid shock protein	NA	NA	NA	NA	NA
2201795:2201811	attR	GGCAGGCGCTGCGGTTT	NA	NA	NA	NA
WP_000431187.1|2202289_2202472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502118.1|2202428_2202887_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	2644817	2723017	4733003	terminase,head,holin,transposase,tail,protease,plate	Salmonella_phage(71.67%)	92	NA	NA
WP_000938184.1|2644817_2645498_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.1	4.1e-80
WP_000502118.1|2645705_2646164_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000374046.1|2646827_2647487_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2647573_2647903_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2647899_2648181_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000502118.1|2648917_2649376_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000140485.1|2650507_2651719_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2651776_2652094_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2652138_2652552_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2652725_2653388_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2653482_2653941_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420526.1|2653976_2656031_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|2656154_2656601_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950867.1|2656619_2658773_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202371.1|2658759_2659365_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2659581_2660091_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_010989142.1|2660445_2661498_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877174.1|2661569_2662022_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156455.1|2662207_2663968_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2664036_2664555_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001764860.1|2664654_2664822_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2665075_2665639_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2665635_2667276_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2667280_2668534_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053045.1|2668548_2670456_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086472.1|2670468_2672577_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000224084.1|2672675_2673785_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2673781_2674324_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291724.1|2674489_2675500_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193884.1|2675707_2678320_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000480169.1|2679336_2680038_+	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000421106.1|2680959_2681478_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_001681975.1|2681492_2683004_-	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000049938.1|2683003_2683684_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001197092.1|2683680_2684880_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_001270647.1|2684880_2685234_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001685627.1|2685474_2686230_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001144794.1|2686288_2686717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050472.1|2686716_2687448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000826019.1|2687642_2687978_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000042301.1|2687974_2689006_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000388505.1|2689008_2689311_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000346974.1|2689314_2689965_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000990867.1|2689964_2691917_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000389047.1|2692094_2692547_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000257259.1|2692550_2692991_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_001135544.1|2693002_2694148_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000389379.1|2694151_2694715_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001142488.1|2694689_2695079_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000008737.1|2695065_2695620_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001125675.1|2695616_2696024_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_001040702.1|2695989_2696358_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_000627464.1|2696399_2697341_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_000128060.1|2697352_2697850_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873182.1|2697854_2699087_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_138010671.1|2699101_2699839_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000113511.1|2699723_2701193_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_000204794.1|2701192_2702596_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_001118118.1|2702561_2703314_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_001070544.1|2703403_2703631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495544.1|2703727_2704105_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001075998.1|2704682_2705297_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000226307.1|2705296_2705578_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294876.1|2705564_2705954_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000798706.1|2706170_2706620_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|2706755_2706881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047634.1|2707279_2708077_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001617856.1|2708066_2708213_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096560.1|2708209_2708821_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_000929790.1|2709029_2709632_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001804676.1|2709671_2709911_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_001217670.1|2709966_2710206_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000963896.1|2710390_2710888_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000509711.1|2710898_2711078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208074.1|2711923_2712496_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000445792.1|2712499_2712973_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2712972_2713497_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2713493_2713841_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2713851_2714601_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001681803.1|2714603_2715587_-	replication protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_001574095.1|2715671_2716046_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869365.1|2716011_2716248_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001009036.1|2716377_2716782_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000186242.1|2717070_2717271_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995349.1|2717361_2717658_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_001764962.1|2717663_2718449_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000187053.1|2718445_2719126_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_000034527.1|2719203_2720268_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_010989138.1|2720264_2721146_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_001754984.1|2721151_2721391_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_000065276.1|2721431_2721680_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262313.1|2721724_2723017_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	5.0e-252
>prophage 10
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	2794155	2801467	4733003	protease,integrase	Ralstonia_phage(16.67%)	7	2789024:2789038	2800203:2800217
2789024:2789038	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2794155_2794533_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2794694_2794892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934058.1|2795103_2797380_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_000520789.1|2797410_2797731_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2798054_2798276_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125880.1|2798405_2800352_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2800203:2800217	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201759.1|2800348_2801467_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 11
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	3414119	3501281	4733003	tail,tRNA,plate	Salmonella_phage(40.0%)	67	NA	NA
WP_000118732.1|3414119_3415463_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007105.1|3415466_3416003_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000312802.1|3416069_3416555_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001171575.1|3416791_3417217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147174.1|3417188_3417590_-	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_000996818.1|3419174_3419717_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000175184.1|3419780_3420071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449770.1|3420156_3422820_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.8	9.8e-77
WP_000806676.1|3423187_3424090_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750542.1|3424076_3424901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108006.1|3424897_3425392_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371495.1|3425407_3427291_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145233.1|3427287_3428283_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001670675.1|3429877_3430609_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3430672_3431140_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801233.1|3431136_3431859_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052766.1|3431893_3432649_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3432720_3434088_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207227.1|3434143_3434914_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230964.1|3434991_3435792_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127546.1|3435923_3437099_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648539.1|3437203_3438118_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154870.1|3438138_3438942_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.7e-38
WP_001235094.1|3444974_3447548_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992642.1|3447677_3448409_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|3448405_3449386_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197667.1|3449517_3450255_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|3450526_3450865_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|3450968_3451016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200079.1|3451115_3452276_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210976.1|3452236_3453145_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|3453202_3454324_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|3454333_3455404_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|3455843_3456362_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|3456354_3457575_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|3457731_3458079_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|3458119_3458887_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|3458931_3459480_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|3459498_3459747_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|3460090_3461452_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|3461617_3462409_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|3462428_3463715_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001682111.1|3463835_3464393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|3464474_3465065_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|3465188_3466067_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880973.1|3466152_3467814_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|3467962_3468301_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|3468466_3468757_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|3468746_3469223_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|3469372_3469855_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237649.1|3470474_3481349_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533850.1|3481412_3482822_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196137.1|3482818_3484975_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989217.1|3485006_3486170_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000151542.1|3486712_3487486_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_000380485.1|3487454_3487628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972389.1|3487889_3488108_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_001011760.1|3488198_3489299_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000980381.1|3489295_3489781_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001282793.1|3489777_3492855_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3492847_3492967_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001280897.1|3492981_3493284_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_001207656.1|3493338_3493854_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046142.1|3493863_3495036_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_000905046.1|3495178_3495745_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_001221113.1|3496428_3497544_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111827.1|3497624_3501281_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 12
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	3818713	3861895	4733003	bacteriocin,transposase,integrase,protease,tRNA	Bacillus_virus(25.0%)	47	3808829:3808842	3867826:3867839
3808829:3808842	attL	TTCACAACGCCAGC	NA	NA	NA	NA
WP_001204111.1|3818713_3819172_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000034386.1|3819361_3820441_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000111274.1|3820542_3821706_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000218338.1|3821727_3822774_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000218564.1|3823147_3823573_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000124001.1|3823598_3824177_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000553254.1|3824177_3824885_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001775599.1|3824872_3825550_+	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000956919.1|3825543_3826200_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_000502119.1|3826304_3826763_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000098658.1|3826951_3828943_-	transketolase	NA	NA	NA	NA	NA
WP_000701830.1|3829218_3829977_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000105550.1|3830077_3830998_-	agmatinase	NA	NA	NA	NA	NA
WP_001278580.1|3831225_3833202_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000729109.1|3833210_3833342_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_077905074.1|3833475_3833640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001803086.1|3833636_3833936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062140.1|3833991_3835146_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001113171.1|3835638_3837033_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000856775.1|3837111_3837609_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286121.1|3837704_3838412_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001800534.1|3838488_3839220_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593242.1|3839239_3840187_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053167.1|3840402_3840966_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_001285491.1|3840965_3841382_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000098333.1|3841428_3842115_-	global regulatory protein	NA	NA	NA	NA	NA
WP_001055657.1|3842244_3843225_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997790.1|3843242_3843947_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001094848.1|3843965_3844532_+	YggT family protein	NA	NA	NA	NA	NA
WP_001277205.1|3844528_3844819_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174773.1|3844826_3845420_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001096530.1|3845412_3846549_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000252198.1|3846639_3847647_-	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_000394189.1|3847779_3848826_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000502119.1|3849144_3849603_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000984827.1|3849725_3850445_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107559.1|3850494_3850821_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786887.1|3850820_3851540_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001148958.1|3851694_3852747_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091706.1|3852774_3853050_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000976287.1|3853162_3854248_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_001049802.1|3854464_3855721_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000234466.1|3858331_3859039_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001681938.1|3859380_3859665_+	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_014341481.1|3859849_3860194_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001141622.1|3861314_3861632_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000768134.1|3861628_3861895_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
3867826:3867839	attR	TTCACAACGCCAGC	NA	NA	NA	NA
>prophage 13
NZ_LT882486	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 chromosome 1	4733003	4592224	4615421	4733003	integrase,transposase	Escherichia_phage(30.0%)	24	4591122:4591181	4616949:4617716
4591122:4591181	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000427619.1|4592224_4593229_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|4593307_4593742_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|4593813_4594164_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|4594177_4594453_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|4594488_4594911_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|4594962_4596657_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|4596674_4597037_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|4597033_4597270_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|4597305_4597974_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|4599363_4600068_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|4600823_4601675_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|4601982_4602798_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_024261901.1|4602858_4603662_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4603661_4604498_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4604558_4605263_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|4605762_4606623_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4607220_4607925_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000259031.1|4608158_4608998_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4608991_4609339_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000703418.1|4609568_4610042_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000845048.1|4610199_4611213_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|4611415_4611766_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|4611891_4612452_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|4612454_4615421_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
4616949:4617716	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
>prophage 1
NZ_LT882487	Salmonella enterica subsp. enterica serovar Typhi isolate 4714STDY6831631 plasmid 2	79940	2560	72778	79940	integrase,holin,protease,transposase	Salmonella_phage(18.18%)	56	45373:45432	77300:77362
WP_000608644.1|2560_3823_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|4078_4954_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|5000_5333_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001516695.1|9594_10251_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|11030_12422_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|12458_13031_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|13167_13758_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000534857.1|14008_14248_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	2.0e-18
WP_005032116.1|14628_16626_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_000625667.1|16689_17967_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001764183.1|18180_18870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067852.1|19213_19918_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_021546941.1|22100_22319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|22364_22646_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021546940.1|22642_22912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012600012.1|24301_24481_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
WP_032156934.1|24704_25022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000617209.1|25090_26017_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001021938.1|26026_26626_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000645940.1|26622_27207_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_000687847.1|27225_30903_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_021546938.1|30919_32683_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_021546937.1|32698_36328_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_004011547.1|36327_38985_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_048659818.1|39046_41092_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_021546935.1|41767_42772_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|44667_45372_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
45373:45432	attL	GTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGT	NA	NA	NA	NA
WP_000600827.1|46596_47574_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_000891983.1|49304_50219_-	response regulator	NA	NA	NA	NA	NA
WP_000062770.1|50532_50841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001112907.1|50833_51049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958205.1|51051_51714_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000175462.1|51724_52024_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_048659795.1|52033_54784_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_000770034.1|54802_55519_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000769859.1|55530_55815_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000014166.1|55832_56840_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000873539.1|56916_57057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293055.1|57049_57736_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001045307.1|57728_58622_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_000980841.1|58618_59815_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000342114.1|59818_60868_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_000979494.1|60854_61256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000683352.1|61346_61664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610141.1|61690_62026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212005.1|62001_62310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281073.1|62306_64508_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_001079960.1|64504_64897_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_033546593.1|65605_67513_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_000909125.1|67527_68274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048659789.1|68266_68794_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	2.8e-20
WP_001776120.1|68825_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013438824.1|69388_69565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023281075.1|69736_70702_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.3e-58
WP_048230572.1|71380_71569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|71578_72778_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
77300:77362	attR	ACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATG	NA	NA	NA	NA
