The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT855380	Pseudomonas viridiflava strain CFBP 1590 isolate E12-5 chromosome I	6093513	583230	654795	6093513	integrase,tRNA,plate,tail	Pseudomonas_phage(45.45%)	69	576908:576923	656437:656452
576908:576923	attL	TGACCGCTGCCGGACT	NA	NA	NA	NA
WP_010924794.1|583230_584193_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	26.6	5.5e-06
WP_002556076.1|584529_584778_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_003304103.1|584790_585141_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_103365183.1|585792_587178_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_088234448.1|587381_588137_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_088234449.1|588177_588552_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_088234450.1|588844_589123_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
WP_088236353.1|589189_589915_-	phage replication protein	NA	NA	NA	NA	NA
WP_003316232.1|590036_590255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167383072.1|590555_591629_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	37.5	1.7e-48
WP_167383073.1|591887_594338_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	2.4e-13
WP_058431050.1|594757_596608_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	2.0e-36
WP_088234453.1|596675_598631_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.7	5.3e-72
WP_002551877.1|599036_599252_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_058431048.1|599450_600476_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.1	3.6e-104
WP_004887799.1|600484_601054_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_004887801.1|601128_601482_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_088234454.1|601472_602000_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_043305471.1|602409_603642_-	multifunctional CCA addition/repair protein	NA	A0A1V0E714	Klebsiella_phage	42.7	1.3e-76
WP_088234455.1|603738_605301_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_004885330.1|605297_606569_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	38.9	4.9e-10
WP_004885332.1|606705_608628_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_004885333.1|608911_609235_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_088234456.1|609231_610134_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A291L9W7	Bordetella_phage	40.5	4.7e-07
WP_004885335.1|610133_610514_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_004885336.1|610630_611437_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_088234457.1|611433_612423_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_057409966.1|612419_613742_-	molecular chaperone SurA	NA	NA	NA	NA	NA
WP_088234458.1|613722_616503_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_088234459.1|616632_617658_+	phosphotransferase	NA	NA	NA	NA	NA
WP_088234460.1|617699_618374_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_088234461.1|618370_619138_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_058431035.1|619477_620443_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_058431075.1|620510_622559_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004885362.1|622555_623185_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025995960.1|623481_624606_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.3e-27
WP_004885367.1|624688_625723_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004885368.1|625801_627049_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004885370.1|627060_627885_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_029243361.1|628059_628734_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_025995962.1|628730_629549_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_029243360.1|629619_631101_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_088234462.1|631480_633412_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_004885381.1|633525_633768_-	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	50.0	1.9e-16
WP_088234463.1|634085_634343_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_025995966.1|634491_635103_-	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	50.3	1.0e-50
WP_088234464.1|635278_635716_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	48.2	7.0e-25
WP_004885392.1|636020_636410_+	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	74.8	1.5e-42
WP_025995968.1|636390_636729_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	53.2	6.4e-18
WP_058431030.1|636815_637406_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	56.1	4.7e-56
WP_004885397.1|637402_637588_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	76.6	1.5e-13
WP_088234465.1|637606_639103_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	77.1	1.3e-224
WP_029243354.1|639170_639518_+|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	67.8	2.5e-41
WP_025995972.1|639514_639811_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	76.3	1.6e-33
WP_088234466.1|639941_642224_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	41.7	1.3e-82
WP_088234467.1|642220_643714_+	hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	41.2	4.6e-100
WP_029243351.1|643717_644824_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	57.4	3.2e-106
WP_004885410.1|644820_645330_+|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	73.2	1.8e-64
WP_004885412.1|645329_645728_+	phage GP46	NA	B5TK74	Pseudomonas_phage	65.9	5.6e-45
WP_058431025.1|645717_646758_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	70.3	2.4e-132
WP_025995979.1|646745_647345_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	71.4	9.2e-84
WP_088234468.1|647355_649158_+|tail	phage tail protein	tail	A4PE45	Ralstonia_virus	58.7	4.6e-38
WP_088234469.1|649168_649681_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088234470.1|649816_650821_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_029243347.1|650844_651390_+	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	70.6	7.1e-67
WP_058431020.1|651386_651896_+	lysozyme	NA	B5TK84	Pseudomonas_phage	49.7	3.6e-28
WP_029243345.1|652291_652891_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.2	1.6e-72
WP_057410148.1|652912_653962_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.0	1.2e-110
WP_088234471.1|653958_654795_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	55.4	2.3e-69
656437:656452	attR	AGTCCGGCAGCGGTCA	NA	NA	NA	NA
>prophage 2
NZ_LT855380	Pseudomonas viridiflava strain CFBP 1590 isolate E12-5 chromosome I	6093513	3588997	3600482	6093513	tRNA,protease	uncultured_Caudovirales_phage(75.0%)	12	NA	NA
WP_088235501.1|3588997_3590794_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.7	4.2e-15
WP_029244542.1|3590867_3591257_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_029244543.1|3591314_3592754_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004884720.1|3593250_3593922_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.9	1.9e-106
WP_025993112.1|3594270_3594663_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	81.5	2.1e-57
WP_058430527.1|3594664_3595027_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	66.9	1.0e-37
WP_088235502.1|3595026_3595323_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	59.6	1.6e-25
WP_029244549.1|3595319_3595655_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	3.0e-44
WP_088235503.1|3595651_3596653_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	82.3	4.8e-162
WP_029244551.1|3596762_3597761_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_025993118.1|3597806_3599201_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_004884697.1|3599201_3600482_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.0	3.1e-97
>prophage 3
NZ_LT855380	Pseudomonas viridiflava strain CFBP 1590 isolate E12-5 chromosome I	6093513	5737899	5815927	6093513	capsid,portal,head,tRNA,terminase,lysis,transposase,tail,integrase	Pseudomonas_phage(60.61%)	82	5749419:5749447	5822956:5822984
WP_025993333.1|5737899_5738355_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004883102.1|5738678_5739170_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_029243875.1|5739208_5739460_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	38.5	3.9e-12
WP_004883098.1|5739462_5739876_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_025993335.1|5740021_5741554_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_004883095.1|5741707_5743018_+	murein hydrolase activator EnvC	NA	NA	NA	NA	NA
WP_025993337.1|5743051_5744383_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.8	6.7e-26
WP_088236200.1|5744386_5745169_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_088236201.1|5745172_5745928_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025993341.1|5746117_5746888_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_029243878.1|5746923_5747661_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004883087.1|5747684_5747945_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_029243879.1|5747950_5748589_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_004883084.1|5748588_5749182_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
5749419:5749447	attL	CATCGCCGGCAAGCCGCCTCCCACAGTCC	NA	NA	NA	NA
WP_088236202.1|5749737_5750934_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_088236203.1|5751200_5752211_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_088236477.1|5752390_5753290_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043306308.1|5753397_5755059_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_029241407.1|5755322_5755727_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_088236204.1|5755830_5758053_+	AsmA family protein	NA	NA	NA	NA	NA
WP_004883066.1|5758250_5759318_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004883065.1|5759314_5759587_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_088236205.1|5760177_5760423_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_004883057.1|5760605_5760887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029244072.1|5761151_5762498_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_088236206.1|5762669_5763155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236207.1|5763420_5764812_-	GABA permease	NA	NA	NA	NA	NA
WP_029244070.1|5765349_5766123_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.6	4.6e-19
WP_088236208.1|5766136_5766907_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_043306318.1|5766973_5767669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004883040.1|5767665_5768355_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088236209.1|5768408_5769623_+	methyltransferase	NA	NA	NA	NA	NA
WP_043306320.1|5769924_5770251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236210.1|5770705_5771029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236211.1|5771935_5772949_-	J domain-containing protein	NA	A0A2K9L1L4	Tupanvirus	41.7	9.0e-07
WP_088236212.1|5774426_5774897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958191.1|5775541_5776201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236214.1|5776202_5778350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958192.1|5778423_5779398_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	63.7	3.8e-119
WP_088236215.1|5779370_5780081_-	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	37.8	1.2e-37
WP_088236216.1|5780077_5780614_-	DNA-binding protein	NA	A0A0U4J942	Pseudomonas_phage	56.7	1.6e-47
WP_088236217.1|5780610_5781543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236218.1|5781532_5782036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236219.1|5782032_5784375_-|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	52.2	5.5e-108
WP_088236220.1|5784383_5784908_-|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	75.9	2.9e-73
WP_088236221.1|5784904_5786074_-	hypothetical protein	NA	A0A0U4JJ14	Pseudomonas_phage	70.0	6.7e-155
WP_003342289.1|5786070_5786388_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	78.4	1.3e-36
WP_088236222.1|5786387_5788757_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	42.9	5.2e-114
WP_003342293.1|5788762_5788906_-	hypothetical protein	NA	A0A0U4B0S4	Pseudomonas_phage	73.9	1.1e-14
WP_003342295.1|5788926_5789217_-	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	64.4	1.1e-21
WP_088236223.1|5789250_5789730_-|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	43.7	1.4e-18
WP_088236224.1|5789726_5790254_-	lysozyme	NA	NA	NA	NA	NA
WP_004415377.1|5790250_5790457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004407224.1|5790456_5790666_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003342306.1|5790665_5791118_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	72.8	7.2e-57
WP_088236225.1|5791121_5792234_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	67.1	1.3e-136
WP_088236226.1|5792248_5792917_-	virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	55.7	4.5e-55
WP_003420277.1|5792906_5793350_-|tail	tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	65.1	8.4e-50
WP_088236227.1|5793346_5793808_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	58.8	1.8e-42
WP_003342323.1|5793843_5794140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236228.1|5794281_5795004_-|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	70.3	4.7e-82
WP_024662766.1|5795000_5796023_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	65.9	8.5e-122
WP_003413628.1|5796024_5796957_-	hypothetical protein	NA	A0A0U4JVV6	Pseudomonas_phage	47.3	6.9e-62
WP_088236229.1|5797118_5799173_+|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	71.1	4.2e-269
WP_088236479.1|5799069_5799951_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	78.3	6.5e-102
WP_005737198.1|5800026_5800287_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	41.0	1.5e-14
WP_162839122.1|5800353_5800530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044422709.1|5800627_5800975_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	43.8	2.1e-16
WP_032633662.1|5801067_5801268_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	54.0	2.9e-10
WP_088236230.1|5801267_5801777_+	hypothetical protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	58.3	4.2e-45
WP_003420293.1|5801773_5802136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236231.1|5802206_5802446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236232.1|5802442_5805136_+	bifunctional DNA primase/helicase	NA	A0A2H4J936	uncultured_Caudovirales_phage	56.2	2.7e-300
WP_088236233.1|5805158_5805554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236234.1|5805626_5805860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236235.1|5805936_5806149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236236.1|5806145_5807294_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.5	7.4e-74
WP_088236237.1|5807480_5808929_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_088236239.1|5810398_5810869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236240.1|5811726_5813502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236480.1|5814040_5814397_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.2	8.3e-16
WP_088236241.1|5814415_5815927_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	37.1	1.2e-84
5822956:5822984	attR	GGACTGTGGGAGGCGGCTTGCCGGCGATG	NA	NA	NA	NA
>prophage 4
NZ_LT855380	Pseudomonas viridiflava strain CFBP 1590 isolate E12-5 chromosome I	6093513	5863819	5916760	6093513	transposase,plate	Leptospira_phage(33.33%)	36	NA	NA
WP_088236272.1|5863819_5865373_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.8	3.6e-79
WP_088236273.1|5865403_5866231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236274.1|5867227_5867968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145958198.1|5870104_5870608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167383131.1|5870617_5873236_-	chitinase	NA	A0A0X8WP64	Ralstonia_phage	33.8	1.1e-16
WP_088236277.1|5873718_5874714_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004882988.1|5874743_5876780_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.1	1.7e-36
WP_029244040.1|5876801_5877809_-	serine/threonine protein kinase	NA	A0A2R8FEI0	Brazilian_cedratvirus	33.9	1.6e-11
WP_004882986.1|5877805_5878534_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_058431375.1|5878533_5882061_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004882984.1|5882074_5882950_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004882983.1|5882955_5884287_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004882982.1|5884289_5884790_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004882981.1|5884795_5885992_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004882980.1|5886009_5886150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004882979.1|5886237_5887755_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_088236278.1|5887765_5890414_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.5	6.3e-92
WP_004882977.1|5890427_5891435_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025993982.1|5891398_5893186_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029244037.1|5893258_5893636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236483.1|5893874_5894285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236279.1|5894884_5895856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088236280.1|5895866_5896391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413694.1|5896401_5896809_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004882972.1|5896822_5898301_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004882971.1|5898329_5898836_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004882970.1|5898868_5900425_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004882969.1|5901214_5901733_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_088236281.1|5901866_5903909_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.3	8.9e-38
WP_029242937.1|5903898_5904642_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_088236282.1|5904638_5909606_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	60.3	1.5e-33
WP_127051615.1|5909602_5910082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236283.1|5912399_5912756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236285.1|5913862_5914333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088236484.1|5914873_5915230_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.2	2.8e-16
WP_088236286.1|5915248_5916760_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.9	2.5e-85
