The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	647495	704162	4985374	integrase,capsid,terminase,portal,head,plate,tail,tRNA,holin	Cronobacter_phage(63.41%)	61	662783:662798	695633:695648
WP_000785626.1|647495_647894_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_033567197.1|647896_648202_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|648243_648612_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|648756_649140_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422143.1|649143_649806_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|650255_651500_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|651754_652723_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000617687.1|652995_653994_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951049.1|654082_654775_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|654926_655424_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019989.1|655509_656646_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000121523.1|656726_658745_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|658915_660295_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_099267052.1|660724_662245_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	3.2e-32
WP_000478472.1|662632_664198_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
662783:662798	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|664194_664842_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|665073_665841_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|666098_667880_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|667869_668907_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|668910_669477_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|669493_670075_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|670218_670440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|670470_670974_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|670983_671211_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|671200_671626_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|671625_672027_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|672094_672328_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|672318_673179_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|673175_675197_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|675316_675523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|675496_675820_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|675816_676878_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|676874_678650_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|678810_679614_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|679675_680698_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|680701_681403_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|681499_681952_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084218.1|681948_682455_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|682451_683159_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|683155_684283_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|684279_684735_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|684744_685038_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|685034_685376_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|685375_685708_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|685679_685868_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|685854_686112_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|686299_688270_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|688266_688596_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|688592_689777_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|689769_690357_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|690366_692601_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|692613_693168_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|693157_693883_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|693854_694400_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977530.1|694399_696103_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
695633:695648	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000340945.1|697471_697774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|698097_698604_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|698727_700575_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|700724_702470_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|702705_702921_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|703148_704162_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 2
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	1160154	1189021	4985374	integrase,transposase	Escherichia_phage(37.5%)	23	1147578:1147591	1189651:1189664
1147578:1147591	attL	GCATAATTCATTGA	NA	NA	NA	NA
WP_001067855.1|1160154_1160859_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_099267054.1|1161835_1162351_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_005046389.1|1162356_1163280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|1163335_1164115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429174.1|1164462_1164762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|1165752_1166961_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|1167326_1168532_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|1168975_1169296_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|1169288_1169675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447544.1|1169682_1170369_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|1170346_1170970_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|1171051_1172257_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001067855.1|1172659_1173364_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000190912.1|1173773_1174346_+	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_000079794.1|1174709_1176230_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000388997.1|1176297_1176837_+	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_085983317.1|1177616_1178779_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1179057_1181040_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1181036_1181675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1183388_1183985_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1184562_1185846_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1186105_1187980_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1188145_1189021_-|integrase	integrase	integrase	NA	NA	NA	NA
1189651:1189664	attR	GCATAATTCATTGA	NA	NA	NA	NA
>prophage 3
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	1267235	1343963	4985374	integrase,terminase,portal,head,capsid,lysis,tail,transposase,tRNA,protease,holin	Salmonella_phage(42.37%)	88	1259316:1259332	1349810:1349826
1259316:1259332	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1267235_1268273_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1268388_1269078_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1269396_1269780_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1269841_1270429_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1270531_1271431_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1271448_1272783_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1272913_1273651_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1273635_1275258_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1275521_1275686_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1275682_1276258_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1276289_1276940_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1276939_1277896_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1277892_1278372_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1278869_1280099_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1280076_1280361_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1280401_1280641_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1280683_1281841_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1281803_1284731_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1284857_1285208_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1285229_1285388_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1285786_1286191_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1286320_1286557_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1286522_1286897_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1286981_1287965_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1287967_1288717_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1288727_1289075_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1289071_1289596_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1289595_1290069_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_152919722.1|1290236_1291465_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	1.2e-170
WP_001217666.1|1292269_1292509_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001804676.1|1292564_1292804_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929803.1|1292843_1293446_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1293654_1294266_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1294262_1294403_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1294399_1295077_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1295349_1295913_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1296419_1296608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1296822_1297509_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1297784_1298114_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1298097_1298550_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1298567_1299020_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1299255_1299657_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1299943_1300489_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1300460_1302392_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1302375_1302579_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1302575_1304156_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1304145_1305642_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1305654_1306002_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1306056_1307085_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1307142_1307502_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1307512_1307896_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1307923_1308502_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1308550_1309681_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1309789_1310191_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1310198_1310945_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1310995_1311391_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1311387_1311726_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1311697_1314793_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1314795_1315125_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1315134_1315833_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1315839_1316577_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1316474_1317122_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1317183_1320546_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1320584_1320827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1320880_1323253_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1323249_1324074_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1324063_1324642_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1324738_1324966_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1325072_1325285_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1326037_1326157_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1326869_1327007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1327485_1328979_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1329383_1331183_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1331199_1332174_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1332447_1333128_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1333124_1334030_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1334041_1334770_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1334781_1335513_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1335512_1335893_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1336004_1336265_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1336302_1337229_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1337344_1338541_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1338562_1339480_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1339518_1340367_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1340482_1341376_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1341386_1342748_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1342751_1343387_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1343411_1343963_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1349810:1349826	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	1698114	1727707	4985374	holin,tail,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1698114_1698609_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1699022_1699514_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1699503_1699767_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1699763_1702250_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1702256_1702952_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1702938_1703808_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1703923_1704373_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1704382_1704985_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1705005_1705623_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1705619_1706279_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1706330_1707068_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1707064_1707277_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1707273_1707753_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1707749_1709681_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1709677_1710235_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1710231_1711275_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1711318_1711966_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1712695_1713259_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1713450_1713654_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1713956_1714748_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1715044_1715248_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1715416_1717783_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1718111_1719101_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1719115_1719484_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1719512_1720844_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1721140_1721470_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1722062_1723304_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1723306_1723834_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1724211_1724655_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1724708_1726538_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1726885_1727176_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1727203_1727707_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 5
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	1799759	1808930	4985374	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1799759_1800707_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1800690_1801422_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1801402_1801510_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1801569_1802301_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1802523_1804209_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1804205_1804925_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1804971_1805439_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1805495_1806026_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1806197_1806656_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1806896_1808930_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	1877237	1887743	4985374		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1877237_1878641_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1878818_1879712_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1880088_1881174_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1881173_1882073_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1882120_1882999_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1882999_1883551_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1883556_1884549_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1884545_1885319_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1885323_1886403_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1886429_1887743_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	1973739	2024426	4985374	integrase,terminase,portal,head,capsid,plate,tail,protease,holin	Salmonella_phage(81.54%)	70	1968317:1968331	1984447:1984461
1968317:1968331	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1973739_1974213_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_000598920.1|1975522_1976320_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1976611_1977601_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1977602_1977830_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|1977869_1978439_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1978442_1979024_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1979034_1979292_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1979293_1979827_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1979897_1980437_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1980573_1981401_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1981458_1981830_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1982369_1982594_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1982556_1982895_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1983100_1983796_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1983893_1984118_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1984146_1984701_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1984447:1984461	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1984697_1985840_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1985836_1986061_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1986057_1987032_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1987028_1987502_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1987498_1988374_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1988382_1988772_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1988788_1989649_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|1989656_1990646_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|1990659_1991412_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1991562_1991820_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1991965_1992352_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1992338_1992620_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1992619_1993234_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|1993230_1993623_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|1994085_1994418_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1994468_1994819_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|1994944_1995439_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|1995435_1997169_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|1997180_1997363_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|1997362_1998604_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|1998581_1999232_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|1999246_2000452_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|2000501_2000702_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|2000704_2001028_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|2001024_2001429_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|2001400_2001913_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|2001909_2002467_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|2002488_2002653_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|2002642_2004139_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|2004138_2004495_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|2004491_2004818_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|2004902_2006828_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|2006844_2007294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|2007353_2008694_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|2008690_2009749_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|2009748_2010282_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|2010286_2010700_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|2010692_2011772_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|2011774_2012362_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|2012348_2013911_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|2013880_2014486_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2014599_2014833_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2014907_2015021_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2015068_2015482_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2015478_2015691_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2016884_2017046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2017172_2017592_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2017594_2018863_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2019317_2019530_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2019540_2019729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2019989_2021186_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2021835_2022135_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2022226_2022922_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2022995_2024426_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	2128470	2135279	4985374	integrase,tail	Salmonella_phage(33.33%)	11	2130680:2130702	2140395:2140417
WP_000856224.1|2128470_2128701_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2128838_2129213_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2129213_2130089_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2130105_2130459_+	YebY family protein	NA	NA	NA	NA	NA
2130680:2130702	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2130832_2131687_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2131746_2132241_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2132430_2132661_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2132714_2133248_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2133504_2133672_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2133736_2133925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2134397_2135279_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2140395:2140417	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 9
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	2922362	3013279	4985374	terminase,lysis,tail,tRNA,protease,holin	Salmonella_phage(58.7%)	91	NA	NA
WP_000938191.1|2922362_2923043_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2923663_2924323_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2924409_2924739_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2924735_2925017_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2925065_2925845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2925870_2926419_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2926633_2927845_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2927902_2928220_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2928264_2928678_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2928851_2929514_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_099267061.1|2929608_2930067_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2930102_2932157_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2932280_2932727_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2932745_2934899_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2934885_2935491_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2935707_2936217_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2936573_2937626_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2937697_2938150_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2938335_2940096_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2940164_2940683_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2940782_2940950_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2941205_2941769_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2941765_2943406_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2943410_2944664_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2944678_2946586_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2946598_2948707_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2948805_2949915_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2949911_2950454_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2950619_2951630_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2951837_2954450_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2954876_2955068_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2955338_2956025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2956009_2956309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2956377_2957004_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2957651_2958620_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2959095_2959677_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2959676_2962115_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2962168_2962411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2962449_2963325_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|2965871_2966576_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2966473_2967211_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2967220_2967916_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2968005_2968539_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2968655_2969153_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2969252_2969585_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2970705_2971251_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2971719_2972166_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2972183_2972636_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2972619_2972949_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2973224_2973911_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2974271_2974721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2974856_2974982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2975176_2975866_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2975862_2976003_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2975999_2976611_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2976819_2977422_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2977506_2977728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2977837_2978071_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2978662_2979259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2979270_2980248_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2980302_2980560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2980559_2981204_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2981207_2981516_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2981519_2981978_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2981974_2982322_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2982332_2983082_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2983084_2984068_-	replication protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2984152_2984473_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2984507_2984735_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2984840_2985275_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2985571_2985703_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2985751_2986102_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_020899444.1|2986228_2989429_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_014344386.1|2989391_2990549_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2990591_2990831_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2990871_2991120_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|2991164_2992457_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|2992651_2993854_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2993931_2995368_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2995612_2996827_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2997143_2997605_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2997805_2999206_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2999812_3000904_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3001088_3002279_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|3002340_3002988_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3003015_3003564_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3003823_3005665_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3006009_3010476_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|3010475_3011180_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3011160_3012483_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3012475_3013279_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 10
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	3063342	3072074	4985374	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3063342_3064597_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3065060_3065519_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3065710_3067987_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3068017_3068338_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3068661_3068883_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3069012_3070959_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3070955_3072074_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 11
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	3671259	3727594	4985374	terminase,portal,integrase,lysis,transposase,coat,protease	Salmonella_phage(55.38%)	73	3673425:3673441	3736808:3736824
WP_152919722.1|3671259_3672488_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	1.2e-170
WP_001675688.1|3672723_3672996_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
WP_000859023.1|3672940_3673906_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
3673425:3673441	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000105593.1|3673939_3674854_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000780210.1|3674853_3675732_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000379343.1|3675746_3676373_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_001274854.1|3676374_3677796_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_012543325.1|3677927_3679166_-	MFS transporter	NA	NA	NA	NA	NA
WP_001539227.1|3679506_3679830_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000915528.1|3682019_3682382_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3682378_3683311_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3683300_3684758_+	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129928.1|3684816_3686820_-	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_000532175.1|3686955_3687207_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_001085430.1|3687306_3687486_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757527.1|3687499_3687865_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_000889769.1|3687895_3688225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262317.1|3688242_3690156_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_033572424.1|3690155_3691439_-	DNA transfer protein	NA	E7C9U5	Salmonella_phage	94.7	4.5e-221
WP_000964900.1|3691449_3692139_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000627695.1|3692141_3692597_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_022631116.1|3692596_3693298_-	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_033572423.1|3693301_3694720_-	packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.6	5.4e-276
WP_001166093.1|3694679_3695180_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_000538674.1|3695163_3695724_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_022630931.1|3695764_3697057_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.5	1.2e-242
WP_006831698.1|3697056_3697968_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
WP_000774652.1|3697981_3700159_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3700158_3701658_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3701635_3702124_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3702127_3702532_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3702531_3702921_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3702924_3703167_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3703389_3703920_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_001687043.1|3704132_3704600_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3704596_3705094_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3705071_3705275_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_033572422.1|3705811_3706585_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	96.5	1.2e-128
WP_023217800.1|3706742_3706985_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	92.5	1.3e-36
WP_033572421.1|3706981_3707164_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	3.6e-23
WP_023250726.1|3707602_3707839_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	97.4	3.9e-38
WP_033572420.1|3707831_3708008_-	protein ninF	NA	A0A192Y808	Salmonella_phage	91.4	6.9e-24
WP_033572419.1|3708000_3708402_-	hypothetical protein	NA	G9L690	Escherichia_phage	85.7	2.7e-63
WP_000113767.1|3708404_3708581_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_000679699.1|3708547_3708721_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_001573980.1|3708717_3709590_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
WP_000736920.1|3709586_3710027_-	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	2.9e-79
WP_001248409.1|3710100_3711477_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_000067076.1|3711473_3712307_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.6	2.4e-151
WP_001125981.1|3712299_3712446_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3712480_3712762_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3712872_3713088_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|3713206_3713869_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_033572418.1|3714220_3714523_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	6.3e-49
WP_033572417.1|3714535_3715123_-	super-infection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	99.0	6.2e-85
WP_033572416.1|3715315_3715816_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	1.2e-31
WP_033572415.1|3715849_3716137_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	97.9	1.1e-47
WP_000141641.1|3716471_3716630_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3716610_3716799_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902090.1|3716788_3716932_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	9.3e-19
WP_033572414.1|3716928_3717636_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	98.7	2.9e-137
WP_001253476.1|3717635_3717920_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111312.1|3717966_3718260_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|3718270_3718441_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_050517928.1|3718437_3718962_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	96.9	4.2e-48
WP_033572412.1|3719865_3720084_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	98.6	3.7e-35
WP_033572411.1|3720087_3720759_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.6	5.6e-90
WP_001277764.1|3721385_3721565_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_033572425.1|3721665_3722295_+	DUF5420 family protein	NA	A0A220NQT7	Salmonella_phage	96.7	7.3e-116
WP_033572410.1|3722524_3723688_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	99.5	5.3e-229
WP_000893231.1|3723893_3725144_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3725155_3726259_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3726541_3727594_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3736808:3736824	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 12
NZ_LT795114	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 chromosome 1	4985374	4565634	4612678	4985374	tRNA,plate,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4565634_4566633_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4566720_4568031_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4568277_4568793_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4568891_4569101_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4569122_4569236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4569232_4570558_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4570736_4571345_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4571453_4571822_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4571992_4574413_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4574511_4575384_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4575397_4575895_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4576075_4576993_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4577156_4578515_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4578603_4579713_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4580074_4581265_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4581396_4582941_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4582955_4583846_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4584011_4584422_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4584564_4586661_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4586660_4587398_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4587394_4588063_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4588096_4588339_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4588782_4590432_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4590776_4592126_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4592258_4592606_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4593181_4593469_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4593471_4594077_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4594089_4594404_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4594563_4595019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4595015_4595213_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4595202_4596630_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4596629_4597154_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4597205_4597523_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4597482_4597611_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4597707_4600062_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4600061_4601015_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4601014_4601224_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4601211_4602255_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4602264_4602987_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4603314_4603677_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4603673_4604603_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4604602_4606150_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4606313_4606673_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4606663_4607779_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4607771_4608404_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4608406_4610152_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4610156_4610762_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4610758_4611214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4611462_4611753_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4611949_4612678_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_LT795115	Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 plasmid p1	246444	41681	72075	246444	integrase,transposase	Escherichia_phage(33.33%)	28	47592:47609	71318:71335
WP_001067858.1|41681_42386_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_023317207.1|42468_42915_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|42984_46137_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|46160_47336_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
47592:47609	attL	TGGCACTGTTGCAAATAG	NA	NA	NA	NA
WP_001067858.1|47655_48360_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_057109146.1|48694_49087_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_063102497.1|49406_49793_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_072644484.1|52080_52245_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000259031.1|52425_53265_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|53392_53596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|53820_54525_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|54714_55530_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_000612791.1|56614_57478_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|57515_57761_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|58229_59021_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|59023_59299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|60200_60533_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|60702_61494_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|61586_62846_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|63107_63899_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|63956_64565_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|64660_65503_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|65669_66683_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|66885_67236_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|67361_67922_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|67924_70876_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|70884_71286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|71370_72075_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
71318:71335	attR	TGGCACTGTTGCAAATAG	NA	NA	NA	NA
