The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	36626	48690	2170276		Microbacterium_phage(14.29%)	8	NA	NA
WP_001042246.1|36626_40352_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.0	4.3e-38
WP_086874260.1|40585_42040_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	8.3e-54
WP_001291333.1|42067_43090_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.7	2.0e-62
WP_000685108.1|43256_43805_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	4.0e-25
WP_000780023.1|43827_44580_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000166553.1|44599_46147_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
WP_001045908.1|46339_47239_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783413.1|47385_48690_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	102647	171892	2170276	tail,head,protease,transposase,terminase,integrase,portal,holin,tRNA,capsid	Streptococcus_phage(82.26%)	91	97687:97707	164564:164584
97687:97707	attL	TGGCGGAATTGGCAGACGCGC	NA	NA	NA	NA
WP_000570848.1|102647_103745_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	97.8	2.1e-203
WP_000742866.1|103917_104532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095652.1|104663_105443_-	helix-turn-helix transcriptional regulator	NA	M1NS52	Streptococcus_phage	78.9	3.1e-108
WP_000703681.1|105941_106154_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	100.0	2.3e-29
WP_001104143.1|106212_106371_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	98.1	5.3e-23
WP_001008979.1|106468_107110_-	hypothetical protein	NA	J7KJ31	Streptococcus_phage	100.0	1.5e-116
WP_000360289.1|107326_107662_-	hypothetical protein	NA	J7KDN7	Streptococcus_phage	69.1	1.7e-15
WP_000164462.1|107737_107944_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFQ0	Streptococcus_phage	72.1	8.4e-21
WP_001156317.1|107997_108957_+	hypothetical protein	NA	A0A286QS27	Streptococcus_phage	55.2	1.4e-89
WP_000032137.1|108949_109471_+	hypothetical protein	NA	J7KJY1	Streptococcus_phage	86.0	2.8e-68
WP_001003168.1|109489_109681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017645150.1|109708_109885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000728090.1|109999_110176_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001191791.1|110254_110512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000075411.1|110809_110980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370473.1|111160_111433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025196029.1|111422_111803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025196030.1|111858_112302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025196031.1|112417_113320_+	conserved phage C-terminal domain-containing protein	NA	J7KBV5	Streptococcus_phage	51.9	5.9e-50
WP_000863936.1|113329_114172_+	ATP-binding protein	NA	E8ZDI3	Streptococcus_phage	39.6	1.0e-48
WP_172838657.1|114171_114318_+	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	89.4	2.2e-15
WP_000431575.1|114307_114583_+	hypothetical protein	NA	J7KJY6	Streptococcus_phage	84.6	3.1e-34
WP_000229416.1|114569_114824_+	hypothetical protein	NA	J7KK18	Streptococcus_phage	83.3	2.5e-35
WP_001288192.1|114826_114988_+	hypothetical protein	NA	J7KDI4	Streptococcus_phage	90.6	4.7e-19
WP_086874261.1|114989_115319_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	85.3	3.2e-46
WP_086874262.1|115321_116284_+	recombinase RecT	NA	J7KDK3	Streptococcus_phage	90.9	6.1e-162
WP_057485461.1|116280_117078_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	86.0	4.9e-133
WP_000239531.1|117239_117437_+	hypothetical protein	NA	J7KIX6	Streptococcus_phage	98.5	8.9e-28
WP_050151484.1|117426_117903_+	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	98.2	9.6e-60
WP_000763908.1|118252_118549_+	DUF1599 domain-containing protein	NA	J7KBY0	Streptococcus_phage	87.8	1.2e-41
WP_000150115.1|118532_118772_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	55.6	7.5e-05
WP_000159368.1|118802_118967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000139628.1|118963_119233_+	hypothetical protein	NA	A7J287	Streptococcus_phage	69.7	1.8e-23
WP_000564605.1|119236_119380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019149.1|119376_119889_+	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	46.0	2.7e-28
WP_001105090.1|119909_120209_+	hypothetical protein	NA	M1PFH6	Streptococcus_phage	45.4	1.3e-17
WP_000221698.1|120396_120591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000660738.1|120587_120854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142566.1|121242_121677_+	ArpU family phage encoded transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	93.7	1.1e-70
WP_000964195.1|122414_122792_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	41.3	1.5e-15
WP_001132272.1|122844_123030_-	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	61.3	3.5e-10
WP_001247766.1|123130_123466_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	94.6	5.3e-57
WP_000532794.1|123638_124106_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	87.1	7.7e-70
WP_041981227.1|124120_125875_+	amino acid transporter	NA	J7KKD1	Streptococcus_phage	94.7	0.0e+00
WP_165736994.1|125871_126042_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	56.9	1.5e-07
WP_001042281.1|126034_126238_+	hypothetical protein	NA	A7J295	Streptococcus_phage	60.3	1.3e-10
WP_086874263.1|126268_127489_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	82.2	3.7e-188
WP_001124818.1|127466_128132_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.6	7.0e-93
WP_086874264.1|128155_129340_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.6	8.8e-163
WP_017285214.1|129353_129515_+	hypothetical protein	NA	J7KH04	Streptococcus_phage	100.0	8.6e-21
WP_000218656.1|129517_129820_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	100.0	2.0e-50
WP_086874265.1|129816_130164_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	89.1	1.0e-50
WP_000160228.1|130160_130538_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	83.2	6.6e-56
WP_000559944.1|130534_130960_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	93.6	1.5e-75
WP_000521116.1|130975_131599_+	hypothetical protein	NA	J7KKC8	Streptococcus_phage	87.4	8.9e-90
WP_000273027.1|131652_131973_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	82.1	8.4e-44
WP_000928086.1|131996_132170_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	92.7	1.2e-20
WP_041981230.1|132182_136124_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	92.8	0.0e+00
WP_000668940.1|136120_137632_+|tail	phage tail family protein	tail	J7KH53	Streptococcus_phage	96.6	2.3e-288
WP_172838658.1|137622_141750_+|tail	phage tail protein	tail	J7KBT9	Streptococcus_phage	86.5	0.0e+00
WP_086874266.1|141762_143754_+	hypothetical protein	NA	J7KC14	Streptococcus_phage	93.2	0.0e+00
WP_025196065.1|143767_144094_+	DUF1366 domain-containing protein	NA	J7KDI9	Streptococcus_phage	100.0	3.5e-53
WP_025196064.1|144068_144281_+	hypothetical protein	NA	J7KDP6	Streptococcus_phage	100.0	1.7e-32
WP_025196063.1|144299_144587_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	100.0	6.8e-45
WP_025196062.1|144588_144843_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	100.0	6.5e-39
WP_025197090.1|144968_146312_+	lysin	NA	Q5MY96	Streptococcus_phage	93.7	1.3e-250
WP_029732022.1|146649_146856_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	85.9	1.4e-20
WP_000965649.1|146967_147150_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	83.1	1.7e-17
WP_000049277.1|147362_148055_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000739666.1|148051_148804_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_001231504.1|148800_149376_+	N-acetylmuramoyl-L-alanine amidase	NA	H7BV84	unidentified_phage	31.4	4.2e-09
WP_000335318.1|149470_150553_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_001869793.1|150555_151128_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034648.1|151308_153138_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.7	1.5e-132
WP_001066280.1|153426_154542_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.2	3.5e-20
WP_000256869.1|154659_155907_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	49.5	7.0e-102
WP_000199170.1|155977_156754_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_000857672.1|156716_157475_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001224405.1|157484_157949_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000599671.1|157945_158515_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000631143.1|158551_159394_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000107752.1|159550_160834_+	trigger factor	NA	NA	NA	NA	NA
WP_000418430.1|161022_161598_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_000170433.1|161870_163475_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	45.1	2.1e-135
WP_000723857.1|163583_164510_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000049182.1|164704_165151_+	dUTP diphosphatase	NA	A0A1P8BMQ4	Lactococcus_phage	46.5	4.3e-30
164564:164584	attR	TGGCGGAATTGGCAGACGCGC	NA	NA	NA	NA
WP_001085195.1|165312_166677_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000214741.1|166812_167310_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000759712.1|167463_168783_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	44.0	1.6e-101
WP_000160598.1|168985_170152_-|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
WP_001284498.1|170437_171892_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	279350	296876	2170276	integrase	Streptococcus_phage(94.44%)	20	279326:279339	297115:297128
279326:279339	attL	ATAAGTAGTAAATT	NA	NA	NA	NA
WP_001291561.1|279350_280568_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|280649_280853_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_000857133.1|281313_281544_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|281540_281963_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001227347.1|282467_282821_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000336323.1|282880_283048_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_000691753.1|283166_285086_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	99.7	0.0e+00
WP_001814923.1|285101_285218_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224320.1|285462_286398_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
WP_000769868.1|286394_287396_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_000804748.1|287392_289570_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000331160.1|289572_292020_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000506270.1|292003_292510_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|292484_292982_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|293098_293320_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|293362_294568_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000879507.1|294590_294743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813488.1|294745_296131_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|296159_296546_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|296561_296876_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
297115:297128	attR	ATAAGTAGTAAATT	NA	NA	NA	NA
>prophage 4
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	553906	640352	2170276	tail,head,protease,transposase,terminase,integrase,portal,holin,tRNA	Streptococcus_phage(57.38%)	95	574127:574186	613304:613384
WP_000768156.1|553906_556699_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	2.4e-86
WP_001237037.1|556768_557071_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_000184290.1|557134_557590_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000882544.1|557775_560037_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	5.7e-126
WP_000443582.1|560334_560565_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_001011647.1|560705_561398_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000230129.1|561390_562125_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.1e-35
WP_001106849.1|562411_564106_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	43.3	7.7e-128
WP_000137498.1|564244_565099_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
WP_000634982.1|565095_565932_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_001286946.1|566057_567398_+	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.0	2.0e-38
WP_001280898.1|567375_567591_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000256277.1|567590_568463_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_001041038.1|568455_569283_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_000747940.1|569269_569743_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000923611.1|569754_571413_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_000034835.1|571525_572362_+	DegV family protein	NA	NA	NA	NA	NA
WP_001035227.1|572354_573194_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000806954.1|573168_573771_+	YpmS family protein	NA	NA	NA	NA	NA
WP_001284634.1|573873_574149_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
574127:574186	attL	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTG	NA	NA	NA	NA
WP_000269472.1|574236_575379_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	81.6	1.1e-181
WP_000353930.1|575493_576045_-	hypothetical protein	NA	A7J267	Streptococcus_phage	64.3	1.7e-60
WP_000151182.1|576062_576449_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	57.6	2.3e-35
WP_000484457.1|576452_576800_-	helix-turn-helix transcriptional regulator	NA	A0A126GGQ7	Streptococcus_phage	76.1	1.3e-42
WP_000739596.1|577095_577341_+	hypothetical protein	NA	X2L066	Streptococcus_phage	55.8	7.4e-08
WP_000092750.1|577291_578080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001112862.1|578130_578322_+	hypothetical protein	NA	A0A141DZR9	Streptococcus_phage	69.8	4.7e-18
WP_001123482.1|578401_578713_+	hypothetical protein	NA	M1Q0Y6	Streptococcus_phage	87.3	2.9e-49
WP_000732608.1|578717_578867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000910901.1|578860_579088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000573547.1|579080_579311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156426.1|579294_580614_+	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	57.1	3.1e-132
WP_001167564.1|580628_581702_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	54.2	9.6e-100
WP_000141564.1|581797_582403_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	48.5	1.5e-36
WP_001870729.1|582402_583011_+	hypothetical protein	NA	D2XPY9	Bacillus_virus	45.5	7.2e-44
WP_032456395.1|583016_584600_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	77.8	1.7e-233
WP_000427885.1|584608_584806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114109.1|584798_585050_-	hypothetical protein	NA	A0A097BY83	Enterococcus_phage	52.8	1.3e-20
WP_000829573.1|585120_587400_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	62.7	4.6e-277
WP_000666342.1|587769_587967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151204.1|587993_588392_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	61.2	1.7e-41
WP_000687319.1|588388_588604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145465.1|588600_588837_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	93.6	2.3e-38
WP_001005355.1|588833_589064_+	hypothetical protein	NA	J7KK64	Streptococcus_phage	100.0	3.1e-32
WP_000052302.1|589066_589399_+	hypothetical protein	NA	J7KDM7	Streptococcus_phage	55.8	2.6e-27
WP_000041038.1|589476_589890_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	60.6	1.2e-42
WP_000041103.1|590010_590442_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	93.7	3.9e-68
WP_000208745.1|590431_591712_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	94.1	1.3e-233
WP_000462948.1|591726_593256_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	83.8	6.7e-248
WP_032459253.1|593215_594664_+|head	phage head morphogenesis protein	head	A7J293	Streptococcus_phage	77.3	4.4e-225
WP_025194292.1|594691_594880_+	hypothetical protein	NA	A7J294	Streptococcus_phage	77.4	3.7e-15
WP_001042286.1|594884_595088_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	53.4	1.3e-13
WP_000797011.1|595230_595800_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	89.9	1.5e-72
WP_000818573.1|595818_596715_+	hypothetical protein	NA	A7J297	Streptococcus_phage	94.6	2.4e-152
WP_000356705.1|596720_597077_+|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	62.7	6.7e-34
WP_000639437.1|597087_597366_+	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_000060408.1|597362_597707_+	hypothetical protein	NA	A7J2A0	Streptococcus_phage	93.0	6.9e-52
WP_000640604.1|597710_598070_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	74.6	5.6e-44
WP_000450517.1|598081_598714_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	68.6	2.6e-60
WP_000424190.1|598764_599220_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	70.9	3.1e-55
WP_000398752.1|599294_599525_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	59.2	2.2e-14
WP_000929196.1|599553_603780_+	tape measure protein	NA	A7J2A5	Streptococcus_phage	46.6	1.1e-21
WP_000365119.1|603792_604635_+|tail	phage tail family protein	tail	A7J2A6	Streptococcus_phage	48.6	3.4e-76
WP_000206522.1|604647_608475_+|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	49.2	2.9e-162
WP_000391486.1|608483_608636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001873936.1|608646_609063_+	DUF1366 domain-containing protein	NA	NA	NA	NA	NA
WP_000222556.1|609125_609287_+	hypothetical protein	NA	A0A1X9I5T1	Streptococcus_phage	56.8	1.9e-07
WP_000564987.1|609296_609593_+	hypothetical protein	NA	Q938J6	Temperate_phage	84.7	1.2e-39
WP_001001962.1|609594_609933_+|holin	phage holin	holin	A0A1P8VVK6	Streptococcus_phage	71.4	6.8e-36
WP_000236382.1|609934_610654_+	CHAP domain-containing protein	NA	A0A1U9WRD0	Streptococcus_virus	70.3	7.2e-59
WP_000829578.1|610992_611952_+	Abi family protein	NA	A0A059NT88	Lactococcus_phage	38.7	1.3e-58
WP_000076696.1|612106_612307_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	87.9	7.4e-22
WP_000356856.1|612347_612518_-	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
WP_000965651.1|612937_613117_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	86.4	2.1e-20
WP_001290370.1|613522_613720_+	hypothetical protein	NA	NA	NA	NA	NA
613304:613384	attR	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTGATAGCGACAAGGTTCTTTTTT	NA	NA	NA	NA
WP_000254067.1|613763_614696_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.4	8.7e-65
WP_001185383.1|614883_616119_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_086874270.1|616137_617349_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000527081.1|617361_618597_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000200660.1|618581_619394_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001003542.1|619465_620782_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
WP_001209457.1|620845_621244_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_000910750.1|621587_624272_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
WP_000064641.1|625328_627260_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_000351633.1|627349_628474_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011324939.1|628542_629640_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_001173889.1|629659_630352_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
WP_000236202.1|630335_631265_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088186184.1|631338_632683_+|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_001022577.1|632753_633464_-	thioesterase	NA	NA	NA	NA	NA
WP_001115859.1|633460_634159_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
WP_000048142.1|634326_635091_+	(S)-acetoin forming diacetyl reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
WP_000458617.1|635198_637706_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.5	1.4e-218
WP_000221828.1|637791_638985_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000038473.1|639005_640352_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	3.7e-56
>prophage 5
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	652136	659694	2170276	integrase,transposase	Streptococcus_phage(50.0%)	11	645481:645496	662974:662989
645481:645496	attL	GAAAATAAATAAAATT	NA	NA	NA	NA
WP_000595706.1|652136_653333_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	3.6e-103
WP_001068667.1|653916_654264_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071659971.1|654408_655023_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_001872365.1|655025_655292_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|655291_655696_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|655857_656058_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|656079_656340_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|656465_656675_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_000508795.1|656847_657009_-	NINE protein	NA	NA	NA	NA	NA
WP_000594360.1|657750_659028_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000353149.1|659037_659694_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
662974:662989	attR	GAAAATAAATAAAATT	NA	NA	NA	NA
>prophage 6
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	1215859	1290333	2170276	protease,tRNA,transposase	Enterobacteria_phage(23.08%)	57	NA	NA
WP_001259482.1|1215859_1216570_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_000863793.1|1216659_1217448_-	esterase family protein	NA	NA	NA	NA	NA
WP_001280054.1|1217504_1219166_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000979970.1|1219462_1220224_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.3	3.1e-12
WP_000587301.1|1220223_1221087_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000790858.1|1221099_1222104_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000006716.1|1222462_1224118_+	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
WP_000005481.1|1224171_1224891_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000140341.1|1224904_1226587_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_000934868.1|1226696_1227923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075588.1|1227912_1229103_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000796047.1|1229194_1229656_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000163512.1|1229645_1230128_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000403410.1|1230344_1233563_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000134275.1|1233614_1234661_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	6.6e-69
WP_000139163.1|1234867_1235461_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_000676114.1|1235460_1236330_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
WP_000716829.1|1236388_1237492_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000647415.1|1237500_1238289_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_086874275.1|1238278_1238962_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000221656.1|1239065_1239746_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	31.8	1.9e-08
WP_000365343.1|1239863_1240382_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
WP_001247507.1|1240504_1243069_-	GBS Bsp-like repeat-containing protein	NA	NA	NA	NA	NA
WP_000622235.1|1243220_1245419_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.2e-72
WP_000124585.1|1245415_1246177_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000405388.1|1246178_1247108_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_000568320.1|1247149_1247797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000573351.1|1247789_1249028_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001226480.1|1249118_1250009_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000239229.1|1250119_1250296_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_000823033.1|1251390_1255149_-	pullulanase	NA	NA	NA	NA	NA
WP_001205490.1|1255317_1256052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130587.1|1256066_1256651_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_000150951.1|1256747_1258154_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_000670189.1|1258200_1258803_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_000942624.1|1258972_1260754_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	25.0	4.6e-06
WP_088186184.1|1260810_1262156_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	7.4e-65
WP_001003955.1|1262230_1264012_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000567585.1|1264170_1264938_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000285045.1|1264996_1266337_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000245056.1|1266436_1266853_-	VOC family protein	NA	NA	NA	NA	NA
WP_000582587.1|1266856_1267354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162275.1|1267575_1268172_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_088197863.1|1268360_1269465_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
WP_000754588.1|1271299_1273768_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_000755138.1|1273780_1274701_-	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
WP_001292562.1|1274934_1276212_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_001227843.1|1276793_1280234_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
WP_000453221.1|1280887_1282222_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_000584204.1|1282329_1282878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863581.1|1282974_1283205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102864.1|1283273_1283615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088197863.1|1284262_1285367_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
WP_000248015.1|1285492_1286728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001196973.1|1286862_1287228_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_001287287.1|1287291_1287792_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_000002813.1|1288224_1290333_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.6	4.8e-119
>prophage 7
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	1551608	1563105	2170276		Streptococcus_phage(90.91%)	12	NA	NA
WP_000767484.1|1551608_1552436_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
WP_000287943.1|1552475_1552832_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_000966772.1|1552833_1553310_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
WP_001167085.1|1554587_1555136_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000587955.1|1555203_1556295_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	77.1	1.3e-163
WP_000603277.1|1556427_1557063_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425856.1|1557332_1558202_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	4.9e-110
WP_000358198.1|1558201_1558528_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364562.1|1558557_1559421_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.0	3.1e-72
WP_000715592.1|1559440_1560076_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_001144245.1|1561716_1562376_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	8.0e-65
WP_000178147.1|1562394_1563105_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.2e-17
>prophage 8
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	1724628	1766766	2170276	tail,terminase,integrase,holin,capsid	Streptococcus_phage(80.77%)	62	1724452:1724481	1761720:1761749
1724452:1724481	attL	TATGATGAATATGCAAAATATGATGCGTCA	NA	NA	NA	NA
WP_041330050.1|1724628_1724784_-	hypothetical protein	NA	J7KIW4	Streptococcus_phage	86.3	3.8e-18
WP_000356856.1|1725201_1725372_+	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
WP_086874289.1|1725633_1726965_-	lysin	NA	Q8HA43	Streptococcus_phage	99.5	2.0e-264
WP_000609115.1|1727090_1727318_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	96.0	3.8e-30
WP_001017826.1|1727310_1727613_-	hypothetical protein	NA	J7KH30	Streptococcus_phage	63.4	5.2e-27
WP_000889195.1|1727772_1728165_-	DUF1366 domain-containing protein	NA	J7KKA3	Streptococcus_phage	39.6	1.8e-11
WP_000206875.1|1728176_1730180_-	hypothetical protein	NA	J7KC14	Streptococcus_phage	76.5	1.3e-294
WP_086874291.1|1730180_1734203_-|tail	phage tail protein	tail	J7KBT9	Streptococcus_phage	81.4	0.0e+00
WP_172838662.1|1734203_1735679_-|tail	phage tail family protein	tail	J7KH53	Streptococcus_phage	79.4	6.6e-200
WP_086874295.1|1735729_1737742_-	PblA	NA	Q9F4J3	Streptococcus_phage	63.3	7.3e-16
WP_000909906.1|1737741_1738116_-	DUF5361 domain-containing protein	NA	A0A0B5A083	Streptococcus_phage	54.7	3.6e-30
WP_000448691.1|1738130_1738376_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	57.9	4.4e-16
WP_017643418.1|1738375_1738933_-	hypothetical protein	NA	M1PKG8	Streptococcus_phage	67.4	1.0e-65
WP_017767442.1|1738942_1739278_-	hypothetical protein	NA	A0A0B5A5W0	Streptococcus_phage	64.0	2.9e-34
WP_086874297.1|1739277_1739514_-	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	71.4	6.7e-22
WP_017643415.1|1739506_1739845_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	62.5	1.6e-37
WP_017643414.1|1739795_1740227_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	70.0	3.2e-46
WP_017643413.1|1740237_1740453_-	hypothetical protein	NA	M1PRX2	Streptococcus_phage	49.3	2.1e-06
WP_086874299.1|1740449_1741358_-|capsid	phage major capsid protein	capsid	M1Q178	Streptococcus_phage	85.1	5.6e-141
WP_017643411.1|1741361_1741826_-	DUF4355 domain-containing protein	NA	A0A0B5A7G6	Streptococcus_phage	66.9	5.9e-54
WP_017644153.1|1741907_1743320_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.5	1.3e-213
WP_086874301.1|1743508_1744198_-	hypothetical protein	NA	A0A0B5A559	Streptococcus_phage	66.4	1.0e-86
WP_017643407.1|1744190_1745432_-	hypothetical protein	NA	M1NRH5	Streptococcus_phage	73.0	3.9e-177
WP_017643406.1|1745428_1745785_-	hypothetical protein	NA	A0A0B5A7G9	Streptococcus_phage	53.9	1.3e-21
WP_017643767.1|1745932_1746277_-	HNH endonuclease	NA	E8ZDL6	Streptococcus_phage	72.9	2.9e-42
WP_172838659.1|1746517_1746943_-	DUF1492 domain-containing protein	NA	A0A0B5A564	Streptococcus_phage	48.6	1.1e-30
WP_000660742.1|1747329_1747596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019144.1|1747592_1748102_-	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	45.1	4.2e-29
WP_000864960.1|1748116_1748281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017645326.1|1748270_1748435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052300.1|1748436_1748760_-	hypothetical protein	NA	J7KDM7	Streptococcus_phage	54.8	4.2e-27
WP_017648349.1|1748762_1749248_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	88.8	5.1e-85
WP_086874303.1|1749250_1749520_-	hypothetical protein	NA	A7J287	Streptococcus_phage	71.9	1.9e-25
WP_086874305.1|1749602_1749860_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	48.1	5.6e-14
WP_086874307.1|1749974_1750388_-	hypothetical protein	NA	Q938M1	Temperate_phage	77.2	2.0e-29
WP_047198905.1|1750512_1750824_-	DUF1599 domain-containing protein	NA	J7KBY0	Streptococcus_phage	93.4	2.6e-42
WP_017643764.1|1750835_1751180_-	hypothetical protein	NA	J7KK12	Streptococcus_phage	72.6	7.0e-44
WP_086874311.1|1751160_1751649_-	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	92.0	3.9e-56
WP_025196275.1|1751638_1751836_-	hypothetical protein	NA	J7KIX6	Streptococcus_phage	96.9	3.4e-27
WP_086874313.1|1752000_1752798_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	97.4	3.4e-150
WP_086874315.1|1752794_1753790_-	recombinase RecT	NA	A0A286QQK1	Streptococcus_phage	44.6	1.2e-59
WP_000229421.1|1753852_1754107_-	hypothetical protein	NA	J7KK18	Streptococcus_phage	38.1	1.4e-09
WP_000431579.1|1754093_1754369_-	hypothetical protein	NA	J7KJY6	Streptococcus_phage	68.1	3.2e-23
WP_172838660.1|1754358_1754505_-	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	93.6	1.2e-16
WP_050198765.1|1754495_1755278_-	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	90.8	9.7e-134
WP_172838663.1|1755264_1756068_-	replication initiator protein A	NA	A0A097PBE7	Streptococcus_pyogenes_phage	60.5	7.3e-68
WP_000732676.1|1756096_1756243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000454601.1|1756239_1756497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016480515.1|1756753_1756930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000724352.1|1756957_1757146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041330062.1|1757158_1757668_-	ORF6C domain-containing protein	NA	J7KJY1	Streptococcus_phage	99.4	1.0e-83
WP_086874319.1|1757660_1758572_-	DUF3102 domain-containing protein	NA	J7KDG2	Streptococcus_phage	99.7	1.4e-147
WP_000789121.1|1758600_1758813_-	helix-turn-helix transcriptional regulator	NA	J7KBP9	Streptococcus_phage	100.0	1.7e-32
WP_001002980.1|1759009_1759351_+	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	96.5	3.9e-55
WP_000700105.1|1759337_1759718_+	ImmA/IrrE family metallo-endopeptidase	NA	J7KBR5	Streptococcus_phage	96.8	1.3e-67
WP_000438040.1|1759769_1760396_+	TrbC/VirB2 family protein	NA	O21991	Streptococcus_virus	62.1	3.8e-32
WP_000264630.1|1760524_1761661_+|integrase	site-specific integrase	integrase	A0A1B1IMP1	Lactococcus_phage	35.6	3.7e-57
WP_000981535.1|1761720_1762020_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
1761720:1761749	attR	TATGATGAATATGCAAAATATGATGCGTCA	NA	NA	NA	NA
WP_000244923.1|1762179_1763370_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	34.8	5.7e-45
WP_000811662.1|1764291_1764879_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000215421.1|1764922_1765459_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_000683561.1|1765593_1766766_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	54.2	4.0e-14
>prophage 9
NZ_LT714196	Streptococcus agalactiae isolate BM110 chromosome I	2170276	2115039	2131390	2170276	integrase	Streptococcus_phage(73.33%)	26	2114393:2114416	2128699:2128722
2114393:2114416	attL	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
WP_025195363.1|2115039_2115417_-	DUF1492 domain-containing protein	NA	Q7Y4J3	Streptococcus_phage	36.6	7.2e-10
WP_000500998.1|2115391_2115754_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_000891800.1|2116152_2116641_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	7.3e-47
WP_017644960.1|2116714_2117272_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	59.8	1.4e-30
WP_001873750.1|2117273_2117447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694574.1|2117452_2117626_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	3.3e-10
WP_172838661.1|2117910_2119548_-	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.9	3.3e-261
WP_017644962.1|2119567_2120425_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.0e-121
WP_017647427.1|2120425_2120698_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	58.8	5.2e-18
WP_000174502.1|2120700_2121030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644963.1|2121041_2121239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644964.1|2121219_2121360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644965.1|2121356_2121689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000648623.1|2121943_2122186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644966.1|2122212_2122836_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	42.8	2.2e-40
WP_017644967.1|2122845_2123598_-	hypothetical protein	NA	A0A0A7RW33	Clostridium_phage	54.1	3.3e-22
WP_017644968.1|2123623_2124241_-	Rha family transcriptional regulator	NA	A0A249XSL1	Mycobacterium_phage	37.3	1.6e-11
WP_017644969.1|2124257_2124665_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	57.5	1.4e-35
WP_003066809.1|2124679_2124883_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_017644970.1|2125080_2125644_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	34.8	2.2e-18
WP_017644971.1|2125997_2126159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017646039.1|2126420_2127275_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.9	8.0e-57
WP_025195365.1|2127521_2128688_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	69.6	1.3e-153
WP_000092759.1|2128794_2129406_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2128699:2128722	attR	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
WP_001278152.1|2129735_2130023_-	Veg family protein	NA	NA	NA	NA	NA
WP_000230635.1|2130034_2131390_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
