The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	720890	773583	4848621	lysis,integrase,tail,capsid,transposase,terminase,portal,head,holin	Enterobacteria_phage(48.39%)	74	720803:720817	771763:771777
720803:720817	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533654.1|720890_721961_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|721938_722157_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545741.1|722196_722364_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_000002111.1|722436_722721_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	96.8	1.0e-48
WP_000208133.1|722713_723346_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	90.5	2.0e-81
WP_000360279.1|723356_723554_-	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_001339358.1|723555_723951_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	96.9	3.3e-66
WP_001014291.1|723953_724145_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_000034177.1|724146_724785_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.3	1.0e-93
WP_000004315.1|724771_725041_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	55.2	1.1e-17
WP_001214458.1|725037_725205_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.2e-22
WP_001111304.1|725215_725512_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000098523.1|725525_726032_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_000018648.1|726028_726496_-	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	61.3	1.0e-45
WP_000365292.1|726496_727204_-	recombinase	NA	Q716E7	Shigella_phage	99.6	3.8e-137
WP_001183771.1|727458_727629_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000065351.1|727704_728073_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000387878.1|728252_728576_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	98.1	2.5e-59
WP_001077327.1|728638_728863_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_000216182.1|728866_729175_-	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	69.6	3.0e-30
WP_000971597.1|729173_729386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633167.1|729617_730442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250470.1|730646_731354_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_001180318.1|731432_731660_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438488.1|731766_732066_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	97.0	1.4e-48
WP_000062366.1|732228_733005_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	98.4	2.1e-136
WP_012578852.1|733112_734993_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_000736893.1|735070_735511_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	1.6e-80
WP_001254251.1|735507_735690_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000567008.1|735686_735866_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	86.0	1.7e-14
WP_024201048.1|736225_736399_+	ninF	NA	NA	NA	NA	NA
WP_000237093.1|736388_736781_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	35.3	2.9e-14
WP_000002251.1|736773_737064_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_000994516.1|737419_737608_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|737819_738779_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|739117_739240_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097234.1|739254_739944_+	hypothetical protein	NA	I6PDF8	Cronobacter_phage	47.6	4.5e-58
WP_001302581.1|740128_740872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|740957_741116_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023276.1|741414_743265_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_024164617.1|743703_743919_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|743918_744416_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|744412_744850_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881326.1|744999_745617_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|745804_745999_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235436.1|746393_746903_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_012578855.1|746874_748803_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.2e-262
WP_000259002.1|748786_748993_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012578856.1|748989_750582_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_001254036.1|750571_752077_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256818.1|752113_752461_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|752518_753547_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|753598_753973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204536.1|753965_754319_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	6.7e-42
WP_000975033.1|754333_754867_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.9e-57
WP_000683066.1|754863_755259_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000106788.1|755266_756019_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.8	8.2e-130
WP_000479086.1|756032_756464_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|756490_756904_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082311.1|756884_759446_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	93.6	0.0e+00
WP_000847401.1|759442_759772_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001152649.1|759771_760470_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140734.1|760475_761219_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.0e-148
WP_000090850.1|761155_761758_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000515449.1|761818_765232_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.0	0.0e+00
WP_001233161.1|765301_765901_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_000279191.1|765965_767279_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	4.4e-78
WP_001101709.1|767280_767550_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	96.6	2.7e-43
WP_000950983.1|767655_768537_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.1	3.3e-146
WP_001002868.1|770012_770393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|770476_770698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|770710_771364_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767425.1|771867_772344_-	kinase inhibitor	NA	NA	NA	NA	NA
771763:771777	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000817269.1|772452_773583_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
>prophage 2
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	816285	925828	4848621	lysis,protease,integrase,tail,capsid,transposase,terminase,plate,tRNA,portal,head	Salmonella_phage(60.71%)	113	852346:852371	886489:886514
WP_000526113.1|816285_816744_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_001054650.1|816856_818440_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001001761.1|818711_818840_-	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_000091016.1|819025_819493_+	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_000056448.1|819489_820608_+	anion transporter	NA	NA	NA	NA	NA
WP_001056384.1|820665_821586_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000961458.1|821804_823397_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000114251.1|823596_824412_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209390.1|824556_826989_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	1.4e-08
WP_001340108.1|826994_827894_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424899.1|828024_828687_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	6.3e-25
WP_000829253.1|828762_829512_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397327.1|829511_830747_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513804.1|830950_831916_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001409358.1|831902_833774_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
WP_000090150.1|833793_835332_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936024.1|835349_836270_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|836272_837184_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_000950329.1|837360_839709_+	CHASE9 sensor domain-containing protein	NA	NA	NA	NA	NA
WP_000086882.1|839716_841045_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|841091_842417_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497141.1|842629_843013_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555018.1|843123_844239_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001340105.1|844235_844862_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|845108_846311_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450116.1|846357_847116_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|847173_847770_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180089.1|848054_849287_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000605482.1|849327_849612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578860.1|849697_850513_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217870.1|850512_851721_-	MFS transporter	NA	NA	NA	NA	NA
WP_001295903.1|851804_852341_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
852346:852371	attL	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290941.1|852445_853498_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.1e-105
WP_000649630.1|853584_855102_-	NTPase	NA	R9TRQ8	Vibrio_phage	34.4	4.8e-44
WP_000107166.1|855127_856051_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.8	2.1e-34
WP_000051080.1|856101_856671_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	2.7e-37
WP_000804007.1|856796_857018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460902.1|857050_857560_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	5.1e-83
WP_000956184.1|857567_857768_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
WP_000963473.1|857731_858073_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244228.1|858140_858374_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|858373_858601_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104133.1|858597_859455_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	2.1e-158
WP_000017609.1|859451_861866_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.1	0.0e+00
WP_001154431.1|862020_862209_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|862219_862453_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|862645_862981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324531.1|864074_865049_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000520398.1|865073_866099_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.0e-171
WP_001098422.1|866098_867865_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216246.1|868007_868841_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	1.4e-122
WP_000742523.1|868857_869916_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_000059192.1|869919_870570_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_000673512.1|870665_871130_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	6.0e-75
WP_000868175.1|871129_871333_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|871336_871552_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069909.1|871532_872045_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727846.1|872046_872424_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001080937.1|872420_872849_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	1.1e-46
WP_001039945.1|872944_873376_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000104819.1|873730_874792_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.0	2.0e-150
WP_001086818.1|874788_875394_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_000268309.1|875386_876295_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_000177580.1|876281_876641_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000993763.1|876637_877216_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000575294.1|877307_878453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905023.1|878570_879137_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_000249532.1|879279_880452_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.5	6.6e-203
WP_001207667.1|880461_880977_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|881031_881334_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|881348_881468_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282790.1|881460_884538_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.5	0.0e+00
WP_000980387.1|884534_885020_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_001011806.1|885016_886117_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	1.0e-176
WP_000972391.1|886204_886423_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|886658_888344_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
886489:886514	attR	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|888613_888991_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|889020_889278_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201578.1|889437_889725_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189166.1|889708_890431_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|890491_891394_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|891481_891958_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|892307_893420_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|893514_894648_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105422.1|894657_895611_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|895607_896453_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|896512_897001_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149710.1|897041_898169_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_001295905.1|898197_898929_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|899154_899823_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|899822_900539_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|900545_901277_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|901294_902023_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|902240_902756_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|902881_903205_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255161.1|903201_904032_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	29.4	7.4e-07
WP_001305933.1|904028_905042_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136526.1|905140_906571_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566381.1|906581_907583_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815374.1|907619_909338_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000178693.1|909470_910439_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|910450_912103_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491136.1|912246_913146_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|913629_914325_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599803.1|914750_916409_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|916405_917362_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746481.1|917512_918628_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188123.1|918624_920571_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	8.5e-38
WP_000410785.1|920643_920868_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520792.1|921190_921511_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|921541_923818_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|924620_924839_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241681.1|925123_925828_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	1038705	1148661	4848621	lysis,protease,integrase,tail,transposase,terminase,portal,holin	Enterobacteria_phage(50.0%)	106	1085463:1085486	1139595:1139618
WP_000066490.1|1038705_1038918_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1038928_1039117_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1039091_1039322_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1039311_1039485_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818463.1|1039533_1040607_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054742.1|1040689_1043422_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	33.3	3.7e-39
WP_000533666.1|1043516_1044590_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	1.5e-198
WP_001303849.1|1044567_1044786_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545733.1|1044825_1044993_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|1045081_1045363_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_012578863.1|1045565_1046234_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	2.7e-68
WP_000827661.1|1046230_1046794_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	60.8	6.0e-45
WP_001214459.1|1046790_1046955_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111334.1|1046965_1047259_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	1.2e-49
WP_000168274.1|1047272_1047779_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_000365290.1|1047779_1048487_-	recombinase	NA	Q716E7	Shigella_phage	99.6	1.3e-137
WP_001243355.1|1048741_1048894_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1048878_1049013_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000065364.1|1049088_1049457_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_000167595.1|1049607_1050078_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000088206.1|1050136_1050409_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	1.7e-40
WP_000032717.1|1050847_1051690_-	hypothetical protein	NA	F5A3D6	Riemerella_phage	42.5	1.2e-52
WP_096246228.1|1051770_1052466_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000067727.1|1052540_1052756_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438530.1|1052897_1053194_+	hypothetical protein	NA	G9L678	Escherichia_phage	95.9	2.2e-46
WP_000185505.1|1053226_1054126_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788881.1|1054122_1054824_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|1054820_1055111_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000796283.1|1055183_1055510_+	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_000810177.1|1055532_1055979_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	91.2	2.9e-74
WP_000153283.1|1055975_1056503_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
WP_001254226.1|1056499_1056682_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	98.3	4.3e-29
WP_000566998.1|1056678_1056849_+	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_001003979.1|1056841_1057564_+	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	95.0	4.2e-123
WP_000002243.1|1057563_1057854_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008186.1|1057850_1058213_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	6.0e-62
WP_001235460.1|1058355_1058979_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|1059231_1059975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499456.1|1060060_1060219_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1060299_1060698_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1060840_1061056_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075164.1|1061055_1061553_+	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
WP_000092249.1|1061549_1062017_+|lysis	lysis protein	lysis	H6WZK2	Escherichia_phage	97.4	4.6e-75
WP_001059339.1|1062215_1062740_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_000373425.1|1063347_1063842_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934130.1|1063841_1065944_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_001072975.1|1065940_1066153_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|1066080_1067661_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_086214752.1|1067605_1069633_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_001097046.1|1069719_1070043_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283145.1|1070035_1070311_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	96.7	1.6e-43
WP_000677106.1|1070322_1070901_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079423.1|1070897_1071299_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	100.0	8.3e-73
WP_000211121.1|1071309_1072053_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001372042.1|1072113_1072500_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_001161009.1|1072508_1072838_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447253.1|1075864_1076194_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|1076203_1076902_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_012578866.1|1076906_1077650_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_012578867.1|1077547_1078195_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	1.6e-113
WP_109840064.1|1078255_1080223_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	99.7	0.0e+00
WP_001233161.1|1082039_1082639_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_012578868.1|1082703_1084017_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	6.3e-77
WP_001024006.1|1084018_1084288_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_012578869.1|1084402_1084981_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	58.5	3.6e-53
WP_000950813.1|1085342_1086323_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
1085463:1085486	attL	CCTATTCTTTTTCAGTGGTTTGAA	NA	NA	NA	NA
WP_001592261.1|1086356_1087376_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_001247931.1|1087844_1088543_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_001265017.1|1089017_1090046_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1090018_1090711_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|1090840_1092013_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063129.1|1092012_1094559_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.3e-70
WP_000209902.1|1094555_1095155_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024568.1|1095510_1095816_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|1095815_1096736_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_001044299.1|1097270_1098512_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000244367.1|1098700_1100074_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_001143120.1|1100108_1100336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151437.1|1100356_1100953_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001273658.1|1101325_1101499_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001298362.1|1101581_1102910_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.4e-233
WP_001028090.1|1102930_1103425_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	95.8	2.5e-50
WP_001001173.1|1103435_1104026_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001340068.1|1104035_1104836_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126780.1|1104843_1105230_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001340067.1|1105241_1105934_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001340066.1|1105933_1107025_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191701.1|1107312_1107951_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_012578870.1|1107990_1111953_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979523.1|1112007_1112217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018494.1|1112375_1113884_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497957.1|1114103_1114934_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154378.1|1114991_1116119_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199145.1|1116124_1117396_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000533536.1|1118022_1118811_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
WP_000009232.1|1119373_1120060_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279877.1|1120325_1121543_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.8	1.1e-43
WP_012578871.1|1121712_1123242_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070929.1|1123213_1123501_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001258871.1|1123601_1125437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282108.1|1126811_1127375_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001260398.1|1128542_1128782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609738.1|1138202_1138709_-	NleE/OspZ family T3SS effector cysteine methyltransferase	NA	NA	NA	NA	NA
WP_000022709.1|1142233_1142455_+	hypothetical protein	NA	NA	NA	NA	NA
1139595:1139618	attR	TTCAAACCACTGAAAAAGAATAGG	NA	NA	NA	NA
WP_170315999.1|1144891_1146104_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	3.3e-165
WP_000255946.1|1147638_1148661_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
>prophage 4
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	1386687	1473293	4848621	protease,integrase,tail,capsid,transposase,terminase,portal,head,holin	Stx2-converting_phage(26.79%)	95	1386524:1386549	1439765:1439790
1386524:1386549	attL	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000113687.1|1386687_1387818_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	5.7e-103
WP_000113189.1|1387795_1388044_-	excisionase	NA	NA	NA	NA	NA
WP_000048378.1|1388108_1390580_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1390672_1390864_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1390860_1391049_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000358771.1|1391607_1391886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339605.1|1391845_1392247_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_000367380.1|1392258_1392411_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	4.3e-06
WP_000362153.1|1392676_1393096_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1393196_1393478_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693943.1|1393461_1393887_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095665.1|1393909_1394872_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	50.9	1.0e-68
WP_001151205.1|1394912_1395335_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.9e-65
WP_001002673.1|1395578_1395890_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	3.1e-59
WP_001339608.1|1396151_1396544_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	58.3	3.7e-33
WP_001380433.1|1396540_1397134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000748514.1|1397174_1397603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893384.1|1397599_1398691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967405.1|1398980_1399193_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.8e-26
WP_001410105.1|1399359_1399638_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265094.1|1399639_1400689_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	5.9e-110
WP_000904174.1|1400701_1401061_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	3.9e-37
WP_001064912.1|1401057_1401747_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.1e-60
WP_000244363.1|1402323_1403697_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000874861.1|1404231_1406085_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	94.2	0.0e+00
WP_000372595.1|1406235_1406451_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193280.1|1406455_1406806_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000992071.1|1406869_1407403_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1407957_1408044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1408265_1408451_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736383.1|1408536_1408761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1408959_1409160_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1409201_1409567_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958372.1|1409857_1410421_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001339613.1|1410417_1412079_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000173031.1|1412142_1414080_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1414124_1414346_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_012578896.1|1414291_1416877_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.7	0.0e+00
WP_000125990.1|1416873_1417200_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007915.1|1417209_1417560_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.0e-58
WP_000573362.1|1417556_1418003_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|1417999_1418344_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1418408_1419125_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1419139_1419514_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1419609_1419819_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212986.1|1419866_1423109_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.1	0.0e+00
WP_000807924.1|1423101_1423443_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_001420466.1|1423442_1424141_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	9.9e-130
WP_000194793.1|1424146_1424890_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_122999376.1|1424835_1425468_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	3.9e-101
WP_000514675.1|1425708_1429182_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001233154.1|1429249_1429849_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
WP_000216481.1|1430000_1431278_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	88.9	2.4e-73
WP_001023459.1|1431279_1431549_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000767050.1|1431769_1432312_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106409363.1|1432256_1432451_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_001025663.1|1432793_1434116_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	83.9	2.1e-221
WP_106409364.1|1435707_1435830_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1435936_1436848_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1436913_1437483_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000350514.1|1439775_1439898_+	membrane protein	NA	NA	NA	NA	NA
1439765:1439790	attR	CGGTCTGGTACATGGATATCGATACC	NA	NA	NA	NA
WP_000526113.1|1440019_1440478_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_000244358.1|1440769_1442143_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000443085.1|1442218_1443025_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1443024_1444218_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195274.1|1444229_1445588_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763545.1|1445591_1447187_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	1.1e-51
WP_001194637.1|1447186_1448743_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1448834_1448879_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1449016_1449898_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1449894_1450515_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001339671.1|1450542_1452432_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1452644_1453520_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278899.1|1453559_1454150_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1454146_1454905_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422059.1|1455124_1456174_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1456209_1456461_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|1456840_1459438_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_000776253.1|1459647_1460622_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_000908596.1|1460916_1461081_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_001308616.1|1461083_1461251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310756.1|1461364_1461460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099527.1|1461622_1464298_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001176295.1|1464361_1464952_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_001256548.1|1465121_1465886_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_000876274.1|1466034_1466343_+	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_000891353.1|1466349_1467519_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_001339668.1|1467710_1468448_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_001339667.1|1468447_1468774_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000480199.1|1468899_1469118_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001088619.1|1469386_1470136_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001288368.1|1470225_1470399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024201056.1|1470546_1472532_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000221852.1|1472585_1472690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526113.1|1472834_1473293_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
>prophage 5
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	1823447	1869667	4848621	integrase,tail,capsid,plate,terminase,tRNA,portal,head,holin	Enterobacteria_phage(72.34%)	58	1825849:1825873	1862308:1862332
WP_000029464.1|1823447_1824197_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|1824196_1824748_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956501.1|1824809_1825790_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1825849:1825873	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416304.1|1825979_1826375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247208.1|1826385_1827321_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000904672.1|1827409_1827718_-	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001151410.1|1827814_1828093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|1828107_1828446_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158964.1|1828456_1828744_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000514277.1|1828755_1828998_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|1828994_1829108_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|1829194_1829398_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153684.1|1829394_1829640_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000599411.1|1829781_1830147_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	3.9e-61
WP_000123423.1|1830153_1832976_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.4	0.0e+00
WP_000686479.1|1833052_1834012_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
WP_000211288.1|1834016_1834328_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	7.2e-48
WP_000248600.1|1834706_1835789_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_000970615.1|1835785_1837990_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000087812.1|1838494_1839541_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613749.1|1839540_1841292_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262654.1|1841446_1842283_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_001055100.1|1842306_1843359_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_000632335.1|1843404_1844205_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_000063103.1|1844306_1844801_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|1844800_1845001_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1845003_1845327_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1845323_1845716_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_001437610.1|1845712_1846120_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000920596.1|1846257_1846725_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
WP_000356305.1|1846717_1847353_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_012578915.1|1847364_1847931_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	1.2e-98
WP_001067548.1|1847948_1848278_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111951.1|1848281_1849178_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_000071724.1|1849170_1849779_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_000217022.1|1849775_1851341_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.7	1.4e-139
WP_012578916.1|1851351_1851828_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.6	1.2e-46
WP_001057723.1|1851834_1852446_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.0	2.5e-84
WP_012578917.1|1852445_1852904_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.5	3.4e-38
WP_001165545.1|1852975_1853575_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	81.7	2.6e-86
WP_000979945.1|1853601_1854090_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853385.1|1854102_1856910_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.9	0.0e+00
WP_000333505.1|1856896_1857052_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	2.8e-21
WP_000789085.1|1857060_1857435_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	7.6e-36
WP_000290450.1|1857490_1858003_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005409.1|1858002_1859187_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	3.6e-225
WP_000132806.1|1859344_1860445_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.2	1.1e-204
WP_024188892.1|1860801_1861305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488101.1|1861454_1861715_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1861905_1862046_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1862349_1862649_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1862308:1862332	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672423.1|1862653_1865041_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|1865055_1866039_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1866322_1866367_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1866489_1866846_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_012578919.1|1866898_1867096_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1867192_1867735_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|1867738_1869667_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 6
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	2177611	2192586	4848621		Bacillus_phage(20.0%)	14	NA	NA
WP_000043439.1|2177611_2179018_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000271561.1|2179138_2180035_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	32.3	1.5e-29
WP_000626462.1|2180045_2180783_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	28.2	1.5e-11
WP_000983273.1|2180783_2181950_-	O90/O127 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_012578939.1|2181957_2182611_-	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	39.0	4.2e-13
WP_001403120.1|2182607_2183879_-	O90/O127 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000736844.1|2183891_2185265_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	1.1e-31
WP_001286272.1|2185268_2186717_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	3.2e-58
WP_012578940.1|2186709_2187210_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000089908.1|2187212_2188178_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_001140914.1|2188180_2189302_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
WP_000799972.1|2189328_2190345_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000234389.1|2190363_2191383_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.0	3.2e-84
WP_000183075.1|2191692_2192586_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 7
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	2297992	2307437	4848621		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292780.1|2297992_2299129_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.7e-163
WP_012578945.1|2299125_2301129_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001340078.1|2301253_2301715_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001302807.1|2301755_2302226_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.3e-81
WP_000598641.1|2302272_2302992_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001340080.1|2302988_2304674_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	4.3e-304
WP_001240407.1|2304895_2305627_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2305686_2305794_+	protein YohO	NA	NA	NA	NA	NA
WP_000783128.1|2305774_2306506_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569341.1|2306510_2307437_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 8
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	2515657	2593364	4848621	protease,integrase,tail,capsid,plate,terminase,tRNA,holin	Enterobacteria_phage(33.33%)	106	2510040:2510056	2563274:2563290
2510040:2510056	attL	TACGGTTTGCCCAGAAT	NA	NA	NA	NA
WP_001283598.1|2515657_2516470_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2516469_2517483_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699119.1|2517548_2518685_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615815.1|2518783_2519779_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127788.1|2519775_2520954_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2521218_2522439_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683533.1|2522597_2524604_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2524724_2525003_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2525036_2525585_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447360.1|2525584_2526394_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2526393_2527218_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2527221_2528307_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_012578955.1|2528341_2529274_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2529439_2529991_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001408062.1|2530060_2530924_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001037538.1|2530925_2531471_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826833.1|2531467_2531947_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000826023.1|2531943_2532435_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000170520.1|2532450_2533200_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001114065.1|2533219_2535859_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033310.1|2535942_2536509_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195816.1|2537171_2537657_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425006.1|2537859_2540004_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531916.1|2540003_2541314_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2541539_2541824_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001339815.1|2542195_2543536_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2543597_2544353_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2544646_2545579_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958685.1|2545890_2547048_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	3.7e-222
WP_096959196.1|2547278_2547494_-	Hin recombinase	NA	K7PJT4	Enterobacteria_phage	66.7	2.0e-17
WP_024201066.1|2547469_2547826_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	68.6	2.2e-40
WP_001096966.1|2547834_2548863_-|tail	tail fiber protein	tail	A0A0M3ULD8	Salmonella_phage	46.3	3.5e-30
WP_000049950.1|2548862_2549543_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001197072.1|2549539_2550739_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	2.9e-185
WP_001270636.1|2550738_2551092_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_000301071.1|2551091_2551844_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	4.5e-88
WP_001123212.1|2551908_2552304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113597.1|2552290_2553061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077826329.1|2553181_2553490_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	98.7	2.5e-37
WP_000081741.1|2553525_2554587_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	83.4	4.1e-159
WP_000155121.1|2554589_2554892_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	9.1e-48
WP_001349561.1|2554891_2555479_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_000990882.1|2555478_2557467_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	1.6e-270
WP_000393944.1|2557644_2558097_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.0	2.2e-58
WP_000257260.1|2558100_2558541_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_000046921.1|2558552_2559698_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	7.5e-159
WP_032211368.1|2559701_2560265_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.6e-80
WP_001142483.1|2560239_2560629_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	1.1e-66
WP_000008742.1|2560615_2561170_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.9	4.7e-82
WP_001125668.1|2561166_2561574_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	7.4e-69
WP_162010769.1|2561572_2561806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627485.1|2561802_2562744_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	1.7e-156
WP_001066736.1|2562755_2563262_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	78.7	3.2e-69
WP_000873163.1|2563265_2564486_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.8	1.4e-203
2563274:2563290	attR	TACGGTTTGCCCAGAAT	NA	NA	NA	NA
WP_000246484.1|2564500_2565238_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_000113480.1|2565146_2566592_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.6	3.7e-264
WP_001130793.1|2566591_2568214_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_001218996.1|2568216_2568768_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_001472362.1|2568721_2569336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113285.1|2569468_2569654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311799.1|2569797_2570190_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.9	2.5e-50
WP_000229385.1|2570173_2570650_-	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	94.3	7.3e-84
WP_000783734.1|2570633_2570957_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000658764.1|2571409_2571922_-	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	1.4e-96
WP_000027553.1|2572116_2572635_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.3	2.9e-94
WP_000994516.1|2572631_2572820_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2572816_2573179_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002231.1|2573175_2573466_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	96.9	9.3e-50
WP_001279421.1|2573465_2573735_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950970.1|2573727_2573904_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	7.4e-26
WP_000386655.1|2573903_2574263_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	1.0e-61
WP_001254259.1|2574265_2574442_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	3.0e-27
WP_012578958.1|2574438_2574966_-	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	2.1e-100
WP_000736903.1|2574962_2575403_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001248389.1|2575476_2576853_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	1.6e-253
WP_000431319.1|2576849_2577737_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	3.1e-144
WP_001244622.1|2577799_2578072_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	1.4e-42
WP_012578960.1|2578094_2578391_-	hypothetical protein	NA	A0A2D1GLZ9	Escherichia_phage	99.0	1.2e-47
WP_000437875.1|2578529_2578730_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274760.1|2578830_2579544_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000588958.1|2579551_2579989_+	hypothetical protein	NA	C6ZR46	Salmonella_phage	73.8	1.0e-55
WP_000050903.1|2579975_2580347_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	58.3	3.6e-06
WP_000198444.1|2580848_2581232_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167602.1|2581290_2581761_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	4.1e-87
WP_000505906.1|2581807_2582104_+	hypothetical protein	NA	A0A2D1GLR6	Escherichia_phage	95.9	8.1e-49
WP_000865171.1|2582103_2582292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005784.1|2582426_2583395_+	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	2.2e-55
WP_000638547.1|2583418_2583550_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2583534_2583687_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000365292.1|2583941_2584649_+	recombinase	NA	Q716E7	Shigella_phage	99.6	3.8e-137
WP_000018648.1|2584649_2585117_+	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	61.3	1.0e-45
WP_000098523.1|2585113_2585620_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_001111303.1|2585633_2585927_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_001214458.1|2585937_2586105_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.2e-22
WP_000004315.1|2586101_2586371_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	55.2	1.1e-17
WP_000034177.1|2586357_2586996_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.3	1.0e-93
WP_001014291.1|2586997_2587189_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_012578961.1|2587191_2587587_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	96.1	9.7e-66
WP_000360279.1|2587588_2587786_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_000208133.1|2587796_2588429_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	90.5	2.0e-81
WP_000545737.1|2588529_2588697_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2588754_2588955_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_032160942.1|2589250_2589403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197004.1|2589482_2590730_-	MFS transporter	NA	NA	NA	NA	NA
WP_001274892.1|2590791_2591715_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194529.1|2591930_2593364_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	9.1e-29
>prophage 9
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	2657014	2750122	4848621	protease,tail,capsid,transposase,terminase,plate,tRNA,head,holin	Pseudomonas_phage(11.63%)	101	NA	NA
WP_000244367.1|2657014_2658388_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000517443.1|2658427_2659219_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175631.1|2659498_2660395_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040491.1|2660398_2661823_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001339829.1|2662002_2662902_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838959.1|2662997_2663573_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|2663633_2664083_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2664069_2664495_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|2664708_2665578_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_001298446.1|2665581_2666481_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000858968.1|2666524_2667196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001007643.1|2667192_2670642_-	helicase SNF2	NA	G8DDA1	Micromonas_pusilla_virus	29.6	2.9e-36
WP_000003978.1|2670740_2672003_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_001285745.1|2672043_2672361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000753675.1|2672439_2673492_-	HTH-type transcriptional regulator EutR	NA	NA	NA	NA	NA
WP_001295463.1|2673537_2674038_-	ethanolamine utilization microcompartment protein EutK	NA	NA	NA	NA	NA
WP_001111043.1|2674050_2674710_-	ethanolamine utilization microcompartment protein EutL	NA	NA	NA	NA	NA
WP_000197710.1|2675459_2676107_-	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	39.0	1.2e-07
WP_000989761.1|2676289_2676526_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_000500007.1|2676525_2678568_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	49.3	3.5e-175
WP_000053170.1|2678586_2679480_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	56.6	1.2e-90
WP_000361028.1|2679494_2679719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206134.1|2679975_2680620_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	66.8	1.7e-75
WP_000553850.1|2680621_2680855_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012578964.1|2680835_2681027_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	54.4	5.2e-09
WP_000564495.1|2681167_2681386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000653700.1|2681474_2682185_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000687524.1|2682411_2682642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234091.1|2682631_2682946_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	62.8	2.1e-23
WP_000082800.1|2682917_2683082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292367.1|2683078_2683348_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	46.0	4.1e-15
WP_001289972.1|2683334_2683832_+	ead/Ea22-like family protein	NA	A0A076GCN9	Escherichia_phage	72.2	3.7e-14
WP_001261588.1|2683831_2684002_+	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	91.2	1.4e-18
WP_000687850.1|2684254_2684533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000914513.1|2684504_2684903_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.6	2.7e-39
WP_000976762.1|2684899_2685376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192999.1|2685476_2685944_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	2.3e-18
WP_000186337.1|2685970_2686249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|2686431_2686824_+|holin	phage holin family protein	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000445983.1|2686813_2687110_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.5	8.1e-17
WP_000836742.1|2687093_2687639_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.6	6.4e-92
WP_000198193.1|2687635_2687818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241905.1|2687892_2688045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312577.1|2688044_2688545_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	9.8e-39
WP_001171800.1|2688591_2689332_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.4	2.4e-65
WP_001129149.1|2689333_2690974_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.1	6.6e-193
WP_000068056.1|2690977_2692573_+	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.7	3.5e-122
WP_001143306.1|2692559_2693726_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	46.1	8.4e-57
WP_000094313.1|2693722_2694274_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_012578967.1|2694483_2695599_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	37.1	7.3e-50
WP_000375809.1|2695599_2695995_+	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	37.8	1.9e-16
WP_000960880.1|2696005_2696914_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	60.3	7.4e-101
WP_000416600.1|2696917_2697250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119401.1|2697253_2697685_+	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	27.4	9.1e-09
WP_071791946.1|2697681_2698320_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	39.4	9.9e-28
WP_000671672.1|2698333_2698534_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_001290034.1|2698526_2699948_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M3LQC3	Mannheimia_phage	45.7	3.2e-95
WP_000053463.1|2699960_2700335_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	61.2	1.7e-32
WP_000152396.1|2700331_2700715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178828.1|2700729_2700888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918298.1|2700877_2703151_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.5	5.6e-81
WP_000539587.1|2703150_2704500_+	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	26.6	1.1e-36
WP_001143147.1|2704483_2705695_+	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	37.5	1.3e-68
WP_000263495.1|2705694_2706345_+|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	48.2	6.1e-41
WP_000372929.1|2706398_2706749_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	8.1e-32
WP_001116499.1|2706748_2707828_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.4	1.2e-73
WP_001098747.1|2707831_2708404_+	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	39.8	2.3e-31
WP_032211389.1|2708661_2709153_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	81.4	1.1e-69
WP_000805554.1|2709152_2709746_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.3	1.1e-52
WP_001032314.1|2709717_2710134_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
WP_001115593.1|2710136_2710643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000769961.1|2711367_2712729_-	ethanolamine ammonia-lyase subunit alpha	NA	NA	NA	NA	NA
WP_000244358.1|2713987_2715361_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_024201071.1|2715467_2715704_-	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
WP_000512386.1|2715700_2716927_-	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_012578971.1|2717143_2718331_-	ethanolamine utilization ethanol dehydrogenase EutG	NA	NA	NA	NA	NA
WP_000929720.1|2718320_2719157_-	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
WP_001075698.1|2719167_2720571_-	aldehyde dehydrogenase EutE	NA	NA	NA	NA	NA
WP_000762196.1|2720582_2720870_-	ethanolamine utilization microcompartment protein EutN	NA	NA	NA	NA	NA
WP_000387713.1|2720976_2721270_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_000582973.1|2721308_2722325_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_000651284.1|2722321_2723125_-	ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT	NA	NA	NA	NA	NA
WP_000733877.1|2723121_2723823_-	ethanolamine utilization acetate kinase EutQ	NA	NA	NA	NA	NA
WP_000820789.1|2723797_2724277_-	ethanolamine utilization acetate kinase EutP	NA	NA	NA	NA	NA
WP_000356956.1|2724289_2724625_-	ethanolamine utilization microcompartment protein EutS	NA	NA	NA	NA	NA
WP_000342632.1|2724916_2727196_-	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_001003720.1|2727484_2728435_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.8	9.7e-11
WP_000087317.1|2728454_2730458_+	transketolase	NA	NA	NA	NA	NA
WP_001270532.1|2730534_2731578_-	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_001296284.1|2731703_2732279_-	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_001078900.1|2732346_2734326_-	formate-dependent uric acid utilization protein AegA	NA	NA	NA	NA	NA
WP_000636131.1|2734531_2736250_+	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_001082402.1|2736336_2739510_-	autotransporter adhesin glycoprotein EhaJ	NA	A0A2L1IV18	Escherichia_phage	24.6	7.6e-44
WP_000069202.1|2739513_2740749_-	adhesin-glycosylating O-heptosyltransferase EhaJ	NA	NA	NA	NA	NA
WP_001273135.1|2741886_2745000_+	multidrug efflux RND transporter permease AcrD	NA	NA	NA	NA	NA
WP_001386977.1|2745098_2745158_-	protein YpfM	NA	NA	NA	NA	NA
WP_000258253.1|2745538_2745895_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_001277801.1|2745898_2747026_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_000383836.1|2747053_2747254_+	YpfN family protein	NA	NA	NA	NA	NA
WP_000679819.1|2747334_2748033_-	esterase	NA	NA	NA	NA	NA
WP_000829364.1|2748106_2750122_-|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	2769609	2814857	4848621	terminase,integrase,tail,holin	Salmonella_phage(59.62%)	55	2771447:2771462	2811744:2811759
WP_000017553.1|2769609_2769762_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000076001.1|2769779_2769971_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001311989.1|2770281_2770800_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|2770815_2771355_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2771447:2771462	attL	ATCATTCCCACTCAAT	NA	NA	NA	NA
WP_012578972.1|2771572_2772055_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	87.5	5.7e-68
WP_000354071.1|2772051_2772678_-	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	95.7	1.5e-113
WP_000207017.1|2772667_2772976_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	98.0	5.8e-50
WP_001275998.1|2772962_2773367_-	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_000751339.1|2773563_2774571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578973.1|2774664_2775738_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.2	3.9e-24
WP_000218894.1|2775767_2778455_-	hypothetical protein	NA	T1S9Y2	Salmonella_phage	73.2	5.6e-96
WP_001189556.1|2778653_2778914_+	hypothetical protein	NA	T1SA06	Salmonella_phage	98.8	2.9e-42
WP_001248449.1|2779114_2781589_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	98.4	0.0e+00
WP_000119842.1|2781593_2783396_-	hypothetical protein	NA	T1SAQ5	Salmonella_phage	96.2	1.6e-304
WP_001143616.1|2783392_2785903_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	82.8	0.0e+00
WP_000337194.1|2785915_2786458_-	hypothetical protein	NA	T1SA02	Salmonella_phage	98.9	2.8e-71
WP_000588339.1|2786457_2786922_-	hypothetical protein	NA	T1SA73	Salmonella_phage	98.7	2.0e-86
WP_000885914.1|2786921_2789399_-	hypothetical protein	NA	Q858G3	Salmonella_phage	98.5	0.0e+00
WP_000179046.1|2789398_2790004_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.6e-110
WP_000366671.1|2790003_2790327_-	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	71.8	1.5e-35
WP_000012264.1|2790378_2790759_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	52.8	2.1e-25
WP_000599566.1|2790769_2791210_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	7.0e-65
WP_000268705.1|2791261_2792248_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	86.6	1.7e-164
WP_001047889.1|2792262_2792973_-	peptidase	NA	T1SAP9	Salmonella_phage	81.9	1.6e-63
WP_000619835.1|2792987_2793533_-	hypothetical protein	NA	S4TSV9	Salmonella_phage	58.8	9.7e-40
WP_000968687.1|2793529_2793829_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	67.3	2.0e-31
WP_000852153.1|2793825_2795496_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	98.9	0.0e+00
WP_000334867.1|2795510_2795717_-	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_000031196.1|2796588_2797020_+	hypothetical protein	NA	A0A248SKX0	Klebsiella_phage	54.9	6.1e-37
WP_000123109.1|2797063_2798545_-	hypothetical protein	NA	M1F3C4	Salmonella_phage	98.6	1.3e-293
WP_172437434.1|2798541_2799216_-|terminase	terminase small subunit	terminase	M1F219	Salmonella_phage	98.2	8.7e-115
WP_001140120.1|2799238_2799577_-	hypothetical protein	NA	Q858C6	Salmonella_phage	86.6	2.3e-47
WP_012578976.1|2800110_2800407_-	hypothetical protein	NA	A0A2R2YB59	Pseudomonas_phage	65.1	8.2e-09
WP_000856943.1|2800417_2800624_-	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	88.1	2.9e-29
WP_029694141.1|2800626_2800842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000828691.1|2801238_2801580_-	hypothetical protein	NA	T1SA23	Salmonella_phage	76.3	2.6e-43
WP_001066738.1|2801697_2802483_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	89.7	2.2e-138
WP_000086426.1|2802479_2803286_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	78.5	1.2e-91
WP_000402891.1|2803301_2803502_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	75.8	2.5e-22
WP_001278768.1|2803649_2803883_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
WP_000836620.1|2804038_2804635_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	98.0	1.1e-105
WP_001198622.1|2804859_2805009_+	hypothetical protein	NA	T1SA20	Salmonella_phage	70.2	1.1e-14
WP_172437433.1|2805041_2805965_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	79.7	1.6e-50
WP_000548052.1|2805972_2806275_+	hypothetical protein	NA	T1SA88	Salmonella_phage	97.0	6.5e-46
WP_001091673.1|2806271_2807093_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	97.4	9.1e-159
WP_000063813.1|2807089_2807971_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	94.5	4.3e-154
WP_000816432.1|2808017_2808266_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_000041115.1|2808375_2808675_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	99.0	3.1e-48
WP_000184078.1|2808667_2808826_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	86.5	3.5e-19
WP_000664383.1|2808822_2809536_+	hypothetical protein	NA	R9VWB9	Serratia_phage	70.0	4.0e-94
WP_001013665.1|2809532_2810126_+	adenine methylase	NA	T1SA14	Salmonella_phage	98.5	1.2e-115
WP_000177704.1|2810122_2810302_+	hypothetical protein	NA	T1SA82	Salmonella_phage	100.0	2.4e-24
WP_000954549.1|2810298_2811552_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	96.4	1.9e-232
WP_000138264.1|2811744_2813322_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2811744:2811759	attR	ATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001296289.1|2813390_2814857_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 11
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	2886230	3005565	4848621	protease,integrase,tail,transposase,tRNA	Escherichia_phage(19.44%)	111	2876625:2876641	2981138:2981154
2876625:2876641	attL	GTCATCAGGCGTTTCAT	NA	NA	NA	NA
WP_001305240.1|2886230_2886767_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190646.1|2886791_2887427_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_012578985.1|2887635_2888484_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196297.1|2888539_2888800_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_000128777.1|2888993_2889074_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986038.1|2889494_2889875_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001309669.1|2889874_2890606_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399398.1|2890617_2891346_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|2891357_2892263_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|2892259_2892940_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2893210_2894185_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790169.1|2894200_2896000_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589053.1|2896197_2896677_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|2896673_2897630_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|2897629_2898280_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|2898312_2898888_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|2898884_2899040_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094401.1|2899295_2900918_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083664.1|2900902_2901640_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2901771_2903106_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001386374.1|2903138_2904020_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000627804.1|2904764_2905148_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2905452_2906142_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997418.1|2906189_2907227_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2907433_2907853_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001339408.1|2907921_2908620_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082956.1|2908651_2911312_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2911425_2912781_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001339409.1|2912826_2913150_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852123.1|2913146_2914445_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
WP_001235102.1|2921726_2924300_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040119.1|2924429_2925161_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079111.1|2925157_2926138_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2926272_2927010_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2928380_2928722_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2928825_2928873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200108.1|2928971_2930132_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2930174_2931296_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2931306_2932377_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001339413.1|2932587_2932953_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212401.1|2933100_2933619_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969004.1|2933608_2934835_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589817.1|2934850_2935333_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001408077.1|2935536_2936466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000503755.1|2936797_2937292_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	59.8	4.1e-45
WP_000548501.1|2937291_2937894_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	90.3	6.2e-96
WP_001106833.1|2937865_2938306_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	1.6e-53
WP_032160959.1|2938327_2938717_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	54.1	1.9e-13
WP_001195986.1|2938746_2939325_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.2	2.9e-79
WP_001286668.1|2939389_2940577_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.5	3.8e-190
WP_001207671.1|2940589_2941108_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	80.2	3.0e-75
WP_000361834.1|2941170_2941443_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	78.8	1.3e-29
WP_000763326.1|2941484_2941604_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_000069482.1|2941596_2944026_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	79.3	2.4e-279
WP_000978925.1|2944037_2944502_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	78.4	4.5e-62
WP_000884170.1|2944504_2945677_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.0	4.5e-167
WP_000972008.1|2945753_2945972_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	81.9	8.6e-32
WP_000948614.1|2946009_2946732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065253.1|2946937_2947285_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264790.1|2947326_2948094_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2948124_2948673_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2948691_2948940_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2949076_2950438_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2950604_2951396_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2951416_2952703_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2952757_2953351_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2953473_2954352_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880896.1|2954437_2956099_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2956247_2956589_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2956650_2956941_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2956930_2957407_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2957538_2958021_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001339422.1|2960782_2961100_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PGM3	Moraxella_phage	46.8	1.6e-10
WP_001816740.1|2961428_2961725_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.9	4.6e-20
WP_001339425.1|2961749_2961995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	50.7	1.1e-16
WP_071526065.1|2964405_2964507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001034000.1|2964706_2968624_-|protease	serine protease autotransporter toxin EspC	protease	Q9LA58	Enterobacterial_phage	38.2	3.0e-223
WP_000606941.1|2969193_2970366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578991.1|2973373_2973754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993124.1|2974061_2975039_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000271979.1|2975058_2976327_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772826.1|2976349_2977798_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000097680.1|2977811_2979092_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
WP_001298180.1|2979328_2980729_+	GABA permease	NA	NA	NA	NA	NA
WP_000156817.1|2980749_2981412_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
2981138:2981154	attR	GTCATCAGGCGTTTCAT	NA	NA	NA	NA
WP_000522415.1|2981412_2981862_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000508177.1|2981945_2982104_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137287.1|2982286_2982586_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229436.1|2982595_2983120_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115381.1|2983166_2983571_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492656.1|2984237_2984687_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000281320.1|2984723_2985068_-	YgaC family protein	NA	NA	NA	NA	NA
WP_001295174.1|2985219_2985549_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000209795.1|2987025_2987457_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001223227.1|2987665_2987911_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080940.1|2987907_2988318_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	3.0e-17
WP_000246589.1|2988290_2990435_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.1e-195
WP_000777941.1|2990444_2991404_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	9.1e-134
WP_000985495.1|2991760_2992963_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000774965.1|2992955_2994020_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001216533.1|2994077_2995070_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000165669.1|2995518_2996703_+	MFS transporter	NA	NA	NA	NA	NA
WP_000445658.1|2996826_2997564_+	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000119749.1|2997553_2997889_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000378442.1|2997979_2998510_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_001295175.1|2998636_2999809_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_001296316.1|2999825_3001364_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001097125.1|3001621_3002329_+	RNA ligase family protein	NA	NA	NA	NA	NA
WP_000638139.1|3002325_3003438_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000244358.1|3003625_3004999_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000526113.1|3005106_3005565_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
>prophage 12
NZ_LT827011	Escherichia coli O127:H6 isolate EPEC E2348/69 variety 2 chromosome 1	4848621	3048333	3055473	4848621		Escherichia_phage(83.33%)	6	NA	NA
WP_000103866.1|3048333_3050895_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.7e-31
WP_001141306.1|3051000_3051657_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001296319.1|3051707_3052475_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847970.1|3052670_3053579_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	4.3e-117
WP_000590412.1|3053575_3054838_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.8e-135
WP_001279001.1|3054834_3055473_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
