The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT671418	Herminiimonas arsenitoxidans strain AS8 chromosome I	3784322	85420	96732	3784322		Bacillus_phage(37.5%)	10	NA	NA
WP_076590879.1|85420_86206_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	33.2	3.7e-16
WP_076590880.1|86290_87001_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_076590881.1|87006_87696_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	34.5	8.8e-30
WP_076590882.1|87713_89030_+	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	27.6	4.7e-16
WP_076590883.1|89182_90616_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	7.6e-52
WP_076593869.1|90636_91722_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	69.6	1.4e-138
WP_076590884.1|91734_92691_+	GDP-L-fucose synthase	NA	M1I463	Paramecium_bursaria_Chlorella_virus	55.3	1.1e-99
WP_076590885.1|92698_93505_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_076590886.1|93761_95516_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.0e-26
WP_076590887.1|95559_96732_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.7	1.2e-15
>prophage 2
NZ_LT671418	Herminiimonas arsenitoxidans strain AS8 chromosome I	3784322	128339	140344	3784322		Megavirus(25.0%)	12	NA	NA
WP_076590914.1|128339_129350_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	37.9	5.4e-44
WP_076590915.1|129342_130467_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	46.5	4.8e-102
WP_076593873.1|130521_131460_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076590916.1|131468_132029_+	sugar transferase	NA	NA	NA	NA	NA
WP_076590917.1|132035_134009_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	28.3	1.3e-17
WP_076590918.1|134071_135169_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.9	6.6e-88
WP_076590919.1|135165_136068_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	63.6	6.6e-102
WP_076590920.1|136070_136616_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	1.4e-54
WP_076590921.1|136612_137509_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	31.6	1.2e-23
WP_076590922.1|137628_138672_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_076590923.1|138842_139757_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_076590924.1|139798_140344_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	41.0	2.9e-20
>prophage 3
NZ_LT671418	Herminiimonas arsenitoxidans strain AS8 chromosome I	3784322	209753	218417	3784322		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_076590983.1|209753_211763_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.4	1.4e-88
WP_076590984.1|211886_212624_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	55.4	3.5e-69
WP_076590985.1|212620_213508_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	1.4e-35
WP_076590986.1|213554_214475_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_076590987.1|214474_215509_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	6.8e-34
WP_076590988.1|215651_217025_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	24.3	2.3e-21
WP_076590989.1|217093_217783_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_076590990.1|217991_218417_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.1	1.0e-20
>prophage 4
NZ_LT671418	Herminiimonas arsenitoxidans strain AS8 chromosome I	3784322	1442060	1482785	3784322	tail,integrase,plate,transposase,capsid	uncultured_Caudovirales_phage(23.33%)	58	1452455:1452475	1475033:1475053
WP_076591963.1|1442060_1443281_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.4	4.4e-08
WP_076591964.1|1443366_1443831_+	universal stress protein	NA	NA	NA	NA	NA
WP_083664406.1|1443905_1445012_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	31.5	1.2e-25
WP_076591965.1|1444913_1446041_-	ABC transporter ATP-binding protein	NA	A4JWM1	Burkholderia_virus	68.1	7.4e-151
WP_173830587.1|1446037_1446190_-	hypothetical protein	NA	A4JWM0	Burkholderia_virus	58.0	2.4e-09
WP_076591966.1|1446161_1446347_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	59.6	1.4e-11
WP_076591967.1|1446653_1446953_-	hypothetical protein	NA	B2ZY96	Ralstonia_phage	51.2	2.8e-17
WP_076591968.1|1447014_1447404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591970.1|1449238_1450429_-	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	38.0	2.1e-31
WP_076591971.1|1450432_1451008_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_157889139.1|1451007_1451832_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	33.3	4.6e-25
WP_076591973.1|1452071_1452422_-	phage GP46 family protein	NA	F6MIL5	Haemophilus_phage	44.3	8.7e-18
1452455:1452475	attL	TAACTAAAACGTTTTAGTTAT	NA	NA	NA	NA
WP_076591974.1|1452474_1453095_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_076591975.1|1453094_1454207_-	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	37.0	5.9e-68
WP_076591976.1|1454203_1455448_-	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	29.3	2.6e-40
WP_157889140.1|1455457_1457203_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_076591978.1|1457355_1457949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591979.1|1457951_1458338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591980.1|1458391_1459810_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	41.0	7.1e-50
WP_157889141.1|1459865_1460159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591982.1|1460167_1460779_-	DUF1834 family protein	NA	A0A2H4JEC0	uncultured_Caudovirales_phage	34.2	2.3e-05
WP_076591983.1|1460775_1461261_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_076591984.1|1461385_1461592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591985.1|1461681_1462605_-	hypothetical protein	NA	G8GWE7	Rhodobacter_phage	42.4	2.0e-69
WP_076591986.1|1462665_1463013_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_076591987.1|1463056_1464184_-	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	39.1	9.9e-55
WP_076591988.1|1464435_1464810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591989.1|1464802_1465246_-	regulatory protein GemA	NA	NA	NA	NA	NA
WP_076591990.1|1465242_1465482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591991.1|1465478_1466168_-	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	43.9	1.1e-35
WP_076591992.1|1466160_1466604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076593987.1|1466605_1467004_-	hypothetical protein	NA	B5TA86	Burkholderia_phage	48.8	4.3e-29
WP_076591993.1|1467003_1467264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591994.1|1467260_1467782_-	host-nuclease inhibitor Gam family protein	NA	A0A0C4UQY5	Shigella_phage	55.1	1.0e-46
WP_076591995.1|1467814_1468270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591996.1|1468279_1468606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591997.1|1468605_1468914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591998.1|1468894_1469107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076591999.1|1469204_1470389_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	47.4	2.0e-90
WP_076592000.1|1470424_1472182_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	41.8	1.9e-116
WP_076592001.1|1472188_1473094_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	41.2	1.9e-48
WP_076592002.1|1473108_1473420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076592003.1|1473416_1473638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076592004.1|1473733_1473922_-	hypothetical protein	NA	B5TA78	Burkholderia_phage	62.5	1.0e-12
WP_076592005.1|1474038_1474545_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076592006.1|1474568_1474973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076593988.1|1475151_1475679_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	42.3	1.1e-19
1475033:1475053	attR	TAACTAAAACGTTTTAGTTAT	NA	NA	NA	NA
WP_076592007.1|1475671_1475938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076592008.1|1475934_1476156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076592009.1|1476152_1476767_+	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	32.1	3.8e-08
WP_157889142.1|1476763_1477186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076592011.1|1477178_1477487_+	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	52.9	1.6e-23
WP_076592012.1|1477492_1477699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076592013.1|1477698_1478217_+	DUF3486 family protein	NA	A0A2H4JD50	uncultured_Caudovirales_phage	44.4	8.0e-36
WP_173830616.1|1478350_1479874_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.4	6.6e-171
WP_083664409.1|1479870_1481436_+	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	36.9	4.1e-67
WP_076592014.1|1481413_1482283_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	46.7	5.6e-66
WP_083664410.1|1482272_1482785_+	phage virion morphogenesis protein	NA	D4P800	Rhodococcus_phage	47.6	1.1e-08
>prophage 5
NZ_LT671418	Herminiimonas arsenitoxidans strain AS8 chromosome I	3784322	3274151	3284189	3784322		Hokovirus(16.67%)	11	NA	NA
WP_076593465.1|3274151_3276107_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.9	2.5e-146
WP_076593466.1|3276290_3277415_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	36.9	3.3e-26
WP_076593467.1|3277526_3278114_+	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_076593468.1|3278291_3278990_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_076593469.1|3279057_3279921_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	35.0	2.1e-33
WP_076593470.1|3279996_3280290_+	chorismate mutase	NA	NA	NA	NA	NA
WP_076593471.1|3280407_3281226_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_076593472.1|3281228_3281870_-	deoxynucleoside kinase	NA	A0A068EPC2	Bacillus_phage	26.7	9.7e-15
WP_076593473.1|3281927_3282275_-	DMT family protein	NA	NA	NA	NA	NA
WP_076593474.1|3282348_3282837_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	31.4	1.3e-08
WP_076593475.1|3282833_3284189_-	polynucleotide adenylyltransferase PcnB	NA	A0A172Q0J1	Acinetobacter_phage	39.6	1.4e-23
