The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	62718	193129	2607423	transposase,holin	Streptococcus_phage(18.52%)	108	NA	NA
WP_004271276.1|62718_63642_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.9	6.2e-31
WP_010495536.1|63775_64831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154021994.1|64925_65576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079578337.1|65669_66392_-	hypothetical protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	42.4	2.4e-06
WP_172823811.1|67980_70056_-	DEAD/DEAH box helicase family protein	NA	A0A1V0SLK0	Klosneuvirus	30.9	4.0e-17
WP_079578340.1|70337_71402_+	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_010495527.1|71645_72542_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010495525.1|72886_74266_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_079578342.1|74562_75960_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	5.9e-57
WP_010495522.1|76239_77661_+	anion permease	NA	NA	NA	NA	NA
WP_010495519.1|78067_78934_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010495517.1|79033_80527_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_010495514.1|80545_81280_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_056971218.1|81294_82743_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.8	4.7e-25
WP_010495509.1|84545_85397_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_079578345.1|85688_86708_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010495505.1|87236_88343_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010495502.1|88436_89870_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010495501.1|89979_90918_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_079578347.1|91151_91505_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_172823812.1|91480_92014_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_010495498.1|92033_92237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495497.1|92303_92528_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	46.4	3.2e-05
WP_010495495.1|92706_93564_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_079578349.1|93692_94226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495493.1|94800_95505_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_079578350.1|95509_96277_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.3e-29
WP_010495491.1|96310_97123_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079578352.1|97438_99376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495489.1|99368_100193_+	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_010495488.1|100176_101067_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010495486.1|101047_101962_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_010495484.1|101951_102593_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	32.6	2.5e-10
WP_079578354.1|102666_103902_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_079578356.1|104203_105238_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079579634.1|105466_106816_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_079578358.1|106984_107539_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_079578360.1|107741_108950_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_079579635.1|110522_111908_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
WP_010495474.1|112552_113452_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010495471.1|113743_114925_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_079578362.1|114970_116128_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_010495467.1|116117_116969_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_029605048.1|116999_117785_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_056988147.1|117987_119319_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_079578364.1|120243_121176_+	AEC family transporter	NA	NA	NA	NA	NA
WP_056972542.1|121269_121566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495451.1|121773_123069_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	34.3	2.3e-63
WP_079579636.1|123711_125097_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.4e-29
WP_056988178.1|125165_126473_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.2	1.8e-47
WP_010495442.1|127497_129750_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	2.3e-172
WP_010495440.1|129794_130658_+	pyruvate formate lyase-activating protein	NA	M4MAG2	Vibrio_phage	43.5	6.9e-08
WP_079578367.1|130909_132151_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	2.7e-13
WP_079578369.1|132289_133573_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	2.1e-48
WP_079578371.1|133765_134830_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_056988164.1|136530_138273_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.7	3.1e-55
WP_010495426.1|138272_139022_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035630965.1|139181_139640_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_010495424.1|139636_140362_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_010495423.1|140549_141518_+	2-hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	29.2	7.0e-25
WP_010495422.1|141582_141846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003561820.1|141937_142816_-|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
WP_050955714.1|142947_143739_+	adenine deaminase	NA	NA	NA	NA	NA
WP_079578375.1|143699_143960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035630963.1|144161_145088_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056972047.1|145140_145410_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_010495410.1|146011_146920_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	42.1	2.8e-60
WP_010495408.1|146965_148144_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_010495407.1|148115_148679_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_079578379.1|148864_149377_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_079578381.1|149485_149935_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_010495400.1|149950_150694_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_079578384.1|150985_152221_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_079578386.1|152227_153505_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	27.4	6.4e-34
WP_158308956.1|153673_154090_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_079578391.1|154086_154332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172823813.1|154514_155891_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_050955713.1|156293_157073_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.1	2.7e-11
WP_079579637.1|157220_158432_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_154021995.1|158516_159635_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154021996.1|159625_159895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029605027.1|160555_162199_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010495370.1|162272_163010_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_154021997.1|163206_163371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495368.1|163491_163890_+	VOC family protein	NA	V5UQY3	Oenococcus_phage	60.6	2.1e-39
WP_029605025.1|164197_165178_+	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_148266326.1|165234_166080_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.0	1.3e-51
WP_079578395.1|166529_167981_-	APC family permease	NA	NA	NA	NA	NA
WP_010495360.1|168349_170473_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_154021998.1|170731_170872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172823814.1|170849_171110_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079578399.1|171363_171612_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079578402.1|172083_172512_-	YjdF family protein	NA	NA	NA	NA	NA
WP_079578404.1|173618_174929_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_079578407.1|175873_176611_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.1	1.1e-51
WP_079578409.1|178351_178993_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079578411.1|179014_180178_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_079578413.1|180155_180896_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	7.5e-27
WP_010495344.1|181599_182595_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_056988049.1|182686_183274_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_010495341.1|183270_183639_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_079578415.1|184165_185668_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_056971608.1|185812_187648_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_029605023.1|187918_188629_+	MIP family channel protein	NA	M1I3H2	Acanthocystis_turfacea_Chlorella_virus	34.2	5.3e-22
WP_010495333.1|188846_189551_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010495332.1|189675_191031_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056988050.1|191205_191640_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_010499958.1|191749_193129_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	206777	278619	2607423	transposase,integrase	Mycobacterium_phage(20.0%)	55	198707:198727	253560:253580
198707:198727	attL	AAAAGTATGAATAATTCAGGA	NA	NA	NA	NA
WP_079578423.1|206777_208019_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
WP_079578425.1|209199_210024_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079578427.1|210141_210828_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_079578429.1|210981_212151_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010495284.1|212165_213173_+	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	34.9	1.6e-40
WP_010495282.1|213371_214187_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010495275.1|214588_215209_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010495273.1|215327_215816_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010495271.1|215877_216714_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_010495269.1|217274_217403_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010495267.1|217399_218065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154022049.1|218099_218666_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_010495264.1|218655_219519_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_010495262.1|219781_220495_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	7.9e-42
WP_079578431.1|220622_222500_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.5	1.5e-34
WP_079578433.1|222483_223806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495257.1|223824_224619_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_056972566.1|225010_225391_-	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_079578435.1|225387_226236_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_079578437.1|226450_227266_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	37.0	5.0e-32
WP_079578439.1|227403_228723_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	3.2e-20
WP_010500073.1|228924_229884_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079578441.1|230435_230915_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_079578444.1|231016_232549_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.2	5.0e-49
WP_079578446.1|232538_233105_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_079579638.1|233101_233683_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_079578448.1|233813_234788_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.7	2.4e-33
WP_079578450.1|234794_235847_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	34.2	4.2e-15
WP_079578369.1|238451_239735_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	2.1e-48
WP_079578452.1|239892_240525_+	DUF3387 domain-containing protein	NA	NA	NA	NA	NA
WP_010495219.1|240606_240954_+	DUF1516 family protein	NA	NA	NA	NA	NA
WP_010495216.1|241009_241804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495213.1|241981_242518_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010495212.1|242790_244146_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_079578454.1|244409_245969_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_079578456.1|246056_247241_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_079578458.1|247380_249570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578460.1|249587_250322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495204.1|250460_250739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578462.1|251027_251576_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010495192.1|251731_252322_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_079578464.1|252562_253507_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_154022050.1|255530_256895_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
253560:253580	attR	TCCTGAATTATTCATACTTTT	NA	NA	NA	NA
WP_079578470.1|257287_259126_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	26.1	4.1e-26
WP_079578472.1|261564_263007_+	amino acid permease	NA	NA	NA	NA	NA
WP_079578474.1|263019_264387_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.2	3.6e-19
WP_056972612.1|264567_264783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578476.1|264972_265917_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_079578478.1|266606_267800_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	3.1e-30
WP_079578480.1|267799_268642_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_148266381.1|268651_269563_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_079578482.1|269927_271169_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	23.2	1.3e-12
WP_079578484.1|271543_272707_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_079578423.1|275936_277178_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
WP_079578486.1|277440_278619_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	283817	352452	2607423	transposase,protease	Lactobacillus_phage(30.77%)	57	NA	NA
WP_172823854.1|283817_284333_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
WP_029604989.1|284541_284916_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010495137.1|284917_285268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495135.1|285905_286508_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_010495133.1|287074_287374_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_079578498.1|287395_288355_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079578500.1|288575_289751_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079578502.1|290819_290972_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079578504.1|290973_291933_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079578506.1|292143_292782_+	SdpI family protein	NA	NA	NA	NA	NA
WP_079578508.1|293036_295832_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_079578510.1|296208_297120_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_079578512.1|297235_298090_-	patatin family protein	NA	NA	NA	NA	NA
WP_079578514.1|298304_298613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578517.1|298618_298804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578519.1|299187_299862_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NNK8	Lactobacillus_phage	61.5	2.4e-08
WP_010495094.1|300039_301410_+	aspartate kinase	NA	NA	NA	NA	NA
WP_010495092.1|301771_302272_+	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	53.4	3.3e-42
WP_079578521.1|302446_303361_-	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	35.5	2.6e-13
WP_010495089.1|303410_304349_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_079578523.1|304401_305424_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_056971420.1|306225_306795_+	recombinase family protein	NA	NA	NA	NA	NA
WP_079578525.1|309230_310898_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_010495073.1|311459_312509_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_079578527.1|312535_313141_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_079578529.1|313260_313749_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079579635.1|314225_315611_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
WP_010495059.1|315687_315963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495057.1|316163_316484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495055.1|316529_318239_+	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_010495053.1|318260_318881_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_010499958.1|319178_320558_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079578531.1|320719_321127_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_079578533.1|321433_322450_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	7.4e-17
WP_079578535.1|322446_323418_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	2.7e-16
WP_056971277.1|323417_324374_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079578537.1|324389_325331_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079578540.1|325472_327284_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079578542.1|328820_330572_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.6	8.4e-53
WP_079578544.1|330571_332359_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	1.3e-48
WP_056971282.1|332519_332783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079578546.1|333257_334196_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	44.0	1.0e-68
WP_079578548.1|334524_336438_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	65.3	1.0e-229
WP_079578550.1|336603_337677_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_056971287.1|337795_338569_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_079578423.1|338843_340085_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
WP_010494999.1|340297_342070_-	oleate hydratase	NA	NA	NA	NA	NA
WP_056988160.1|342387_343266_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_079578552.1|343364_344948_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.5	5.7e-08
WP_010494990.1|345434_345641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010494981.1|345886_346348_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_010494979.1|346398_347604_+	MFS transporter	NA	NA	NA	NA	NA
WP_010494977.1|347788_348418_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010494976.1|348651_349998_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_079578554.1|350069_350717_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079578556.1|350709_351345_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_079578558.1|351423_352452_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	8.5e-37
>prophage 4
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	364754	416140	2607423	transposase,integrase,protease	Streptococcus_phage(22.22%)	47	365902:365920	421299:421317
WP_056988198.1|364754_365105_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	50.0	1.8e-15
WP_010494923.1|365104_365533_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	41.2	5.3e-25
365902:365920	attL	GCATTTTTTGCAAAGAAAA	NA	NA	NA	NA
WP_079578568.1|366009_366612_+	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	59.5	3.1e-39
WP_079578572.1|366981_368010_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	2.9e-37
WP_056988153.1|368103_368904_+	SHOCT domain-containing protein	NA	B8R671	Lactobacillus_phage	60.0	2.1e-06
WP_056988154.1|369182_370139_+|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	47.7	8.3e-79
WP_079578574.1|370259_371375_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010494872.1|371775_372342_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010494869.1|372409_374146_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	2.8e-48
WP_079578576.1|374145_375981_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.9	6.3e-59
WP_079578578.1|376000_376960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010499943.1|377287_378598_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
WP_079578580.1|378756_380181_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_079578582.1|380170_380617_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079578584.1|380935_382246_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	2.9e-90
WP_056972565.1|382731_382995_+	CsbD family protein	NA	NA	NA	NA	NA
WP_079578586.1|384320_384752_+	OsmC family protein	NA	NA	NA	NA	NA
WP_191980739.1|385118_385538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191980740.1|385708_386440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079578588.1|386628_387939_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.6	1.1e-89
WP_010494843.1|388275_388950_-	membrane protein	NA	NA	NA	NA	NA
WP_079578590.1|389530_390391_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_079578592.1|390653_391874_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_079578594.1|391960_392605_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010494834.1|392684_393386_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_079578596.1|393378_394722_-	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_079578598.1|394976_395738_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.4	3.5e-19
WP_079578604.1|395767_396337_+	SOS response-associated peptidase family protein	NA	A0A1P8CX02	Bacillus_phage	29.5	1.6e-05
WP_154022001.1|397609_398384_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	7.1e-28
WP_010494826.1|398589_399030_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_056971324.1|399499_399904_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079578606.1|399866_400601_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.2e-14
WP_079578608.1|400593_401355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578610.1|401700_402726_+	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	38.3	6.2e-56
WP_079578612.1|403137_404676_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	2.0e-18
WP_079579640.1|404750_405761_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010494806.1|405760_406720_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079578614.1|406924_408310_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_056988172.1|408508_409129_+	LemA family protein	NA	NA	NA	NA	NA
WP_172823816.1|409203_409974_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_010494796.1|410040_410754_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_010494795.1|410896_411178_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_010494794.1|411332_411827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578616.1|411854_412607_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_079578618.1|412707_414168_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_010494791.1|414168_414678_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_079578423.1|414898_416140_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
421299:421317	attR	GCATTTTTTGCAAAGAAAA	NA	NA	NA	NA
>prophage 5
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	426064	487028	2607423	transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_010500073.1|426064_427024_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079578622.1|427123_429463_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.1	4.5e-33
WP_079578624.1|429551_430907_+	APC family permease	NA	NA	NA	NA	NA
WP_010499933.1|431095_432406_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	8.4e-90
WP_079578626.1|432594_434112_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	28.7	6.6e-38
WP_079578588.1|434435_435746_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.6	1.1e-89
WP_154022051.1|435914_436262_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079578630.1|436254_436437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498722.1|436878_438012_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_079579641.1|438597_439425_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_172823818.1|439571_442295_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010498738.1|442707_443454_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_010498740.1|443621_444704_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_050955747.1|444997_445507_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_079578634.1|445494_447366_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_172823819.1|447407_447593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010498742.1|447734_448166_+	PTS fructose IIA component	NA	NA	NA	NA	NA
WP_010498744.1|448199_448685_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010498745.1|448819_449662_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_079578638.1|450579_452265_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_079579635.1|452741_454127_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
WP_079578404.1|455173_456484_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_010498765.1|457417_458569_+	hypothetical protein	NA	A0A218MNE0	uncultured_virus	37.5	2.6e-58
WP_035631387.1|458736_459078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010498777.1|459339_459681_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_050955751.1|459690_460560_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_056988048.1|460605_461178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010498788.1|461234_461630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498790.1|461642_464273_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.7	7.4e-77
WP_010498793.1|465280_466648_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	5.8e-09
WP_010498795.1|467181_467736_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010498797.1|468136_468418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010498798.1|468833_470234_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_079578642.1|470515_472780_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_079578644.1|472782_473454_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_010498807.1|473649_474597_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_079578646.1|474775_476017_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	2.1e-13
WP_079578648.1|476306_477986_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_079578650.1|478667_480443_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_079578652.1|480547_481840_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079578654.1|481932_482793_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_079578656.1|482792_483605_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_079578658.1|483624_484281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578660.1|484340_485447_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	2.2e-22
WP_010499943.1|485717_487028_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
>prophage 6
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	575424	707800	2607423	tRNA,transposase,protease	Streptococcus_phage(24.0%)	104	NA	NA
WP_079578646.1|575424_576666_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	2.1e-13
WP_010499933.1|577145_578456_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	8.4e-90
WP_079578732.1|578887_579904_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_079578734.1|579984_581142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079578736.1|581792_584447_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.7	8.2e-84
WP_010497167.1|584831_584972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578738.1|585344_586889_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.0	1.6e-34
WP_154022005.1|587222_587375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578740.1|588936_590355_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_010497177.1|590931_591792_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010497179.1|591863_592334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010497182.1|592353_593202_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010497183.1|593391_594294_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_079578742.1|594312_596295_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_010497187.1|596791_597835_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.6e-30
WP_079578744.1|597827_598514_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_056988026.1|598564_599392_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_154022006.1|599481_599643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010497190.1|599822_601199_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_079579643.1|601306_602089_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_010497192.1|602103_602613_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_172823855.1|602664_603564_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_010497194.1|603791_605072_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	54.5	3.3e-115
WP_010497197.1|606119_608333_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_010497198.1|608610_608868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010497200.1|608913_609567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010497202.1|610253_611027_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_010497205.1|611027_611489_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_010497206.1|613336_614833_+|tRNA	glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
WP_010497207.1|615059_615524_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_079578748.1|615637_616531_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010497210.1|616801_617221_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_079578750.1|617213_620096_+	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	26.9	1.4e-23
WP_010497215.1|620354_621842_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.4	7.3e-98
WP_010497217.1|622697_623141_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_079578752.1|623360_624389_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	6.5e-37
WP_010497219.1|624566_625076_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_010497221.1|625658_626261_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	46.0	6.3e-16
WP_010497223.1|626396_627272_-	VOC family protein	NA	NA	NA	NA	NA
WP_010497225.1|627436_628075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010497227.1|628343_629342_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	5.9e-51
WP_010497229.1|629588_629855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010497231.1|630119_630422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010497233.1|630754_631792_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_079578754.1|632094_632733_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_079578756.1|632890_633952_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_079578758.1|633944_635135_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_056972449.1|635222_635909_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_079578423.1|636110_637352_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
WP_079578369.1|637605_638889_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	2.1e-48
WP_172823822.1|639068_639446_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079579644.1|641590_642073_+	DNA starvation/stationary phase protection protein	NA	A0A2K9VCK5	Lactobacillus_phage	31.1	8.9e-13
WP_079578764.1|644008_644674_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_172823856.1|644874_645096_+	cation transporter	NA	NA	NA	NA	NA
WP_010497316.1|645108_645663_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_010497317.1|645791_645965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578768.1|646064_646334_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_003643543.1|646357_646678_-	thioredoxin family protein	NA	A0A2K9L3H4	Tupanvirus	39.1	5.2e-09
WP_079578770.1|647062_647821_+	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	31.3	9.4e-25
WP_079578772.1|647997_649239_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
WP_079578774.1|649517_651422_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.8e-94
WP_079578778.1|652384_652804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578780.1|652783_654094_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	8.4e-90
WP_079578782.1|654984_655344_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056972533.1|655751_656069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988129.1|659355_659778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578786.1|659809_660769_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_154022007.1|660780_662997_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_056971496.1|663416_664481_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_079578790.1|664856_665159_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079578792.1|665169_666318_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_010497373.1|666472_667150_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_079578794.1|667184_667946_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_010497377.1|668119_668776_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_010497379.1|668951_669425_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_056971501.1|669414_670872_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_079578798.1|670908_671775_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_079578800.1|672314_673559_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_010497396.1|673708_674017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010497399.1|674371_674779_+	OsmC family protein	NA	NA	NA	NA	NA
WP_162829030.1|674820_675645_-	YitT family protein	NA	NA	NA	NA	NA
WP_079578802.1|675978_678375_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_010497405.1|678515_678779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578804.1|678893_679898_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_056972372.1|680150_681887_-	N-6 DNA methylase	NA	A0A1V0SLK8	Klosneuvirus	24.4	4.1e-07
WP_079578806.1|682164_683673_+	YfcC family protein	NA	NA	NA	NA	NA
WP_010497414.1|683685_684843_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_010497418.1|685413_685971_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	29.6	4.8e-10
WP_010497420.1|685986_687012_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_154022052.1|688628_689813_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079578588.1|690152_691463_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.6	1.1e-89
WP_056972017.1|691684_692740_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_010499128.1|693058_695290_+	AAA family ATPase	NA	A0A249XZV4	Enterococcus_phage	34.3	8.1e-08
WP_079578752.1|695966_696995_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	6.5e-37
WP_079578808.1|697348_697861_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079578810.1|699043_699937_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	9.1e-19
WP_079578812.1|699937_701380_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_154022008.1|701451_701607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010499133.1|701974_702838_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_010499134.1|702979_703783_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_010499958.1|703972_705352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079578814.1|705534_705822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578816.1|705895_706774_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_079578818.1|706903_707800_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	720176	794109	2607423	tRNA,transposase,holin	Bacillus_phage(17.65%)	57	NA	NA
WP_172823857.1|720176_721322_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_056972074.1|721341_721719_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_079579647.1|721850_722564_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	56.3	3.9e-73
WP_010499188.1|722679_723174_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_079579648.1|723305_724625_+	MFS transporter	NA	NA	NA	NA	NA
WP_079578828.1|724935_725916_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_010499191.1|726195_726969_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	9.0e-15
WP_079578830.1|727139_728477_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_086989537.1|729553_730329_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_079578834.1|730327_731209_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	26.5	1.3e-09
WP_079578836.1|732436_733864_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010499196.1|733863_734889_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_079578838.1|734930_736643_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.1	2.3e-26
WP_079578840.1|736643_738419_+	thiol reductant ABC exporter subunit CydC	NA	A0A1V0SE00	Indivirus	32.7	1.9e-23
WP_056971585.1|738467_739448_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_086989537.1|739572_740348_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_079578842.1|740654_741563_+	prenyltransferase	NA	NA	NA	NA	NA
WP_010499207.1|741575_742787_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010499209.1|742923_743877_+	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_010499211.1|744013_744691_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_079578844.1|745080_746295_+	MFS transporter	NA	NA	NA	NA	NA
WP_010499215.1|746504_747179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010499216.1|747426_748383_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	30.8	1.7e-18
WP_010499218.1|748466_748826_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_079578846.1|749076_750264_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_079578848.1|750832_752218_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	7.9e-30
WP_191976425.1|752570_753776_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.5	9.7e-24
WP_056972284.1|753781_754408_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079578850.1|754419_755367_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010499227.1|755366_756023_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010499229.1|756082_756967_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_010499231.1|756966_757698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057785074.1|758076_759255_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_010499541.1|759459_760149_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	3.9e-38
WP_010499543.1|760173_761343_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.6	2.0e-26
WP_079578852.1|761609_762944_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.3	1.8e-26
WP_010499547.1|763151_763919_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010499549.1|763922_764267_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_010499556.1|764399_765215_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035631516.1|765455_766025_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_079578854.1|766275_767166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010499569.1|767283_768192_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010499570.1|768240_768888_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_010499572.1|769047_769248_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.2	1.1e-20
WP_079578369.1|769316_770600_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	2.1e-48
WP_079578856.1|770892_771966_-	LCP family protein	NA	NA	NA	NA	NA
WP_079578857.1|774013_774799_+	zinc-ribbon domain-containing protein	NA	D6PSS5	Lactobacillus_phage	34.3	5.3e-15
WP_079578860.1|774868_775402_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010499587.1|775406_775901_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010499588.1|775951_777646_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_079578862.1|777698_778418_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_079579649.1|778853_780368_+	amino acid permease	NA	NA	NA	NA	NA
WP_010499601.1|780692_781964_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.1	6.9e-97
WP_010496666.1|787800_788400_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_079578614.1|788817_790203_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_079578864.1|790348_792619_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010496669.1|793092_794109_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	823137	959780	2607423	tRNA,transposase,holin,protease	Streptococcus_phage(26.83%)	112	NA	NA
WP_079578614.1|823137_824523_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_035631537.1|824722_824932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578888.1|825121_826408_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010499680.1|826421_827714_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_010499682.1|827867_828116_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_010499684.1|828291_828975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010499686.1|829049_831416_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_010499688.1|831752_833063_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.5	7.5e-46
WP_056972050.1|833251_833782_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_010499691.1|833766_834588_+	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_010499695.1|835092_835527_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056988122.1|835926_837300_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_010499698.1|837465_838977_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	41.3	1.2e-74
WP_079578890.1|839189_840431_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	4.6e-13
WP_191980741.1|841102_841684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079578896.1|841734_842511_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	54.1	7.1e-28
WP_085898786.1|842537_842780_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_010499646.1|844409_844769_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_010499643.1|844787_845912_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.4	4.3e-34
WP_010499641.1|845996_846239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010499638.1|846277_846655_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	37.8	2.6e-12
WP_010499636.1|846771_846993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010499634.1|847385_848021_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_056972137.1|848244_849219_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_010499630.1|849502_850060_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010499628.1|850074_853605_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_079578898.1|853604_855179_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_010499623.1|855215_855485_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_010499622.1|855660_856065_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_056988161.1|856214_856718_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_056988162.1|856836_858195_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.7	3.9e-13
WP_010499613.1|858199_858742_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010499612.1|858832_860920_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	47.2	2.3e-105
WP_010499610.1|861119_862004_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_010499609.1|862153_863650_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	36.8	2.0e-87
WP_010497832.1|870738_872205_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.0	2.9e-75
WP_079578900.1|872676_873474_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.7	3.4e-33
WP_056988088.1|873568_874705_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_010497835.1|874751_875453_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010497836.1|875627_876590_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	68.6	4.8e-127
WP_079578902.1|876692_878864_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.7	8.9e-254
WP_010497849.1|878853_879225_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	40.3	2.1e-17
WP_010497851.1|879221_879452_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	40.3	8.0e-12
WP_010497853.1|879726_880332_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162829031.1|880369_880816_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010497856.1|881159_882950_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.3	2.3e-53
WP_172823858.1|882967_883279_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_056971745.1|883303_883903_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_010497863.1|883920_884160_+	YaaL family protein	NA	NA	NA	NA	NA
WP_079578906.1|884252_884882_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.2	2.7e-49
WP_010497867.1|884930_885260_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_010497869.1|885272_886259_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.9	1.1e-36
WP_029605439.1|886275_886620_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	37.6	3.7e-13
WP_079578908.1|886619_887498_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	50.3	1.5e-71
WP_010497874.1|887607_888348_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_079578910.1|888483_889443_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_056988218.1|889531_890506_-	asparaginase	NA	NA	NA	NA	NA
WP_057785074.1|890653_891832_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_010497893.1|892061_892790_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_050955736.1|892764_893331_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_056988204.1|893345_894377_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_056988200.1|894482_896435_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.2	3.5e-55
WP_010497907.1|896611_897253_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_010499958.1|897408_898788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010499958.1|898990_900370_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010497916.1|900493_901120_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010497918.1|901302_901587_+	co-chaperone GroES	NA	A0A219PVY9	uncultured_virus	38.0	1.2e-09
WP_010497920.1|901635_903264_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	55.9	7.6e-157
WP_010497924.1|903555_905388_+	APC family permease	NA	NA	NA	NA	NA
WP_010497925.1|905447_906104_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	44.2	1.7e-43
WP_010497926.1|906162_907497_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	41.5	1.7e-82
WP_010497927.1|907489_908182_+	ComF family protein	NA	NA	NA	NA	NA
WP_079578780.1|908381_909692_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	8.4e-90
WP_010497928.1|910076_910631_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010497931.1|910873_913237_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_191976421.1|913367_914486_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010497933.1|914617_915301_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	29.7	7.9e-23
WP_079578914.1|915293_916187_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079578916.1|916437_917583_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_079578918.1|917597_918320_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	9.2e-38
WP_079578920.1|918297_919689_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.3	2.5e-31
WP_010497943.1|919850_920186_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_010497945.1|920182_920530_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_079578922.1|920639_921575_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_079578924.1|921673_922522_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_079578926.1|922600_923545_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	50.5	1.6e-82
WP_079578928.1|924467_925646_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_010497966.1|925791_927519_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	56.5	2.1e-189
WP_172823859.1|927881_929876_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_079578932.1|929928_932763_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.3	3.3e-301
WP_010497972.1|932854_933328_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_079578934.1|933527_934187_+	serine dehydratase	NA	NA	NA	NA	NA
WP_079578936.1|934201_935083_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_079578938.1|935213_936098_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.2	1.7e-09
WP_079578940.1|936094_937114_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	55.1	5.2e-95
WP_079578942.1|937164_938109_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.6	9.5e-51
WP_010497992.1|938262_938856_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.8	5.9e-51
WP_079578944.1|939318_940644_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_079578946.1|940936_941965_+	SorC family transcriptional regulator	NA	NA	NA	NA	NA
WP_079578948.1|942026_943040_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_056988119.1|943202_944396_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010498002.1|944476_945232_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_079579652.1|945862_947248_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
WP_010498005.1|948950_949187_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_010498006.1|949272_951675_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.9	2.2e-83
WP_010498008.1|951773_952238_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.6	1.1e-44
WP_079578950.1|953769_955155_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.4e-29
WP_010498013.1|955817_956351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056971806.1|956397_957270_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_010498017.1|957468_958164_+	uracil-DNA glycosylase	NA	V5NWU7	Chelonid_alphaherpesvirus	43.7	2.0e-45
WP_010498019.1|958299_959289_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010498021.1|959315_959780_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 9
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	966541	1041160	2607423	tRNA,transposase,integrase	Staphylococcus_phage(29.41%)	60	1030240:1030261	1036127:1036148
WP_079578752.1|966541_967570_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	6.5e-37
WP_010499933.1|967822_969133_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	8.4e-90
WP_029605467.1|969532_969841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010498053.1|970163_971027_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010498055.1|971073_971991_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_010498056.1|971990_972881_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010498057.1|972978_973788_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.6e-12
WP_010498059.1|973808_974564_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	6.5e-18
WP_010498061.1|974578_975244_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_010498063.1|975411_976275_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_010499958.1|978263_979643_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148266359.1|979710_980160_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_056972500.1|980366_980996_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_010498076.1|981104_981443_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035631266.1|981563_982268_+	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	35.6	1.6e-31
WP_010498093.1|982282_982981_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010498094.1|982977_983157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056972573.1|983870_986078_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	49.6	2.0e-176
WP_010498101.1|986203_987553_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_079578956.1|987777_989019_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	4.6e-13
WP_010498102.1|989252_989747_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_056988080.1|989924_990632_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_079578958.1|990736_991873_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_079578960.1|992010_992907_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010498107.1|993249_993687_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_010498108.1|993689_994085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010498109.1|994193_995297_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_010498110.1|995506_996517_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_079578962.1|996675_997395_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_079578964.1|997595_998576_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_079578966.1|998568_999588_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_010498114.1|999587_999893_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_010498116.1|999885_1000338_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_010498119.1|1000315_1000582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050955738.1|1000544_1001009_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_035631275.1|1001079_1001319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029605481.1|1001422_1002445_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_056971485.1|1002598_1003207_+	metallophosphoesterase	NA	A0A076G7D9	Bacillus_phage	39.4	1.1e-28
WP_010498132.1|1003218_1004604_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010498134.1|1004642_1005263_+	YutD family protein	NA	NA	NA	NA	NA
WP_010498136.1|1005301_1006084_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_079578968.1|1006073_1006709_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_056971481.1|1006773_1007433_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_010498148.1|1007520_1008525_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	47.5	6.8e-23
WP_079578970.1|1008744_1009326_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.9	7.7e-27
WP_010498153.1|1009361_1009754_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_079578956.1|1017085_1018327_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	4.6e-13
WP_079578972.1|1018656_1019847_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.8	1.2e-143
WP_079578974.1|1020044_1022261_+	LysM peptidoglycan-binding domain-containing protein	NA	U5PW24	Bacillus_virus	35.0	6.6e-10
WP_079578976.1|1022588_1025003_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	71.3	0.0e+00
WP_010499774.1|1025230_1026892_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_010499776.1|1027010_1027412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579654.1|1027602_1030182_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	44.1	1.1e-106
WP_056971822.1|1030181_1031471_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	21.5	3.8e-10
1030240:1030261	attL	ACGCTTGGGAACAGCGAAAGTT	NA	NA	NA	NA
WP_079578978.1|1031517_1034604_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_079578980.1|1034755_1035688_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	47.7	1.1e-78
WP_079578982.1|1035684_1036116_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_079578984.1|1036206_1037127_+	restriction endonuclease	NA	NA	NA	NA	NA
1036127:1036148	attR	AACTTTCGCTGTTCCCAAGCGT	NA	NA	NA	NA
WP_057785074.1|1037231_1038410_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079578986.1|1039969_1041160_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	1199289	1303158	2607423	capsid,portal,terminase,integrase,tail,tRNA,transposase,holin	Lactobacillus_phage(35.42%)	102	1207637:1207656	1301357:1301376
WP_079578356.1|1199289_1200324_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_010496130.1|1200733_1201339_+	Fic family protein	NA	NA	NA	NA	NA
WP_154022015.1|1201392_1201545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010496125.1|1202203_1203322_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.7	2.1e-36
WP_154022016.1|1203582_1204494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579635.1|1205069_1206455_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
1207637:1207656	attL	CAACGGTTTTAAAACCGTTG	NA	NA	NA	NA
WP_010496112.1|1207980_1208433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172823862.1|1211629_1212934_+	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	41.1	1.0e-87
WP_010496098.1|1213462_1214113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010496097.1|1214140_1214911_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_010496096.1|1215035_1215545_+	hydrolase	NA	NA	NA	NA	NA
WP_056971955.1|1215648_1215999_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_056971954.1|1216456_1217503_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.6	3.5e-30
WP_079579022.1|1217512_1219927_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_079579024.1|1220205_1221306_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_010496075.1|1221325_1221973_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.1	8.0e-33
WP_010496074.1|1222219_1222693_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_079579659.1|1223189_1224584_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	8.0e-30
WP_079579026.1|1224679_1225438_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010496068.1|1225546_1225903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010496066.1|1225922_1226882_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_056988036.1|1227121_1228006_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_010496058.1|1228022_1228796_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_172823825.1|1228867_1230019_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	1.3e-62
WP_079579030.1|1230161_1230701_-	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	64.7	6.2e-15
WP_079579032.1|1230873_1231578_-	LexA family transcriptional regulator	NA	E9LUS8	Lactobacillus_phage	48.1	3.3e-48
WP_079579034.1|1231753_1231984_+	helix-turn-helix transcriptional regulator	NA	E9LUS9	Lactobacillus_phage	65.8	2.0e-23
WP_079579036.1|1231998_1232736_+	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	46.5	6.5e-55
WP_169790223.1|1232738_1232891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056971148.1|1232887_1233115_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	68.5	1.4e-21
WP_079579038.1|1233206_1233506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154022017.1|1233591_1233762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579040.1|1233883_1234072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579042.1|1234061_1234262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579044.1|1234254_1234536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172823826.1|1234528_1235050_+	host-nuclease inhibitor Gam family protein	NA	A0A0A7S0G6	Clostridium_phage	35.8	9.0e-19
WP_079579048.1|1235061_1235772_+	ERF family protein	NA	A0A1S5SAA3	Streptococcus_phage	53.0	9.7e-40
WP_079579050.1|1235785_1236448_+	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	49.5	2.1e-57
WP_079579052.1|1236440_1236860_+	single-stranded DNA-binding protein	NA	B8R683	Lactobacillus_phage	46.0	8.0e-26
WP_079579054.1|1236870_1237155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579056.1|1237168_1237909_+	conserved phage C-terminal domain-containing protein	NA	A0A1P8BK94	Lactococcus_phage	55.7	1.1e-65
WP_079579057.1|1237921_1238677_+	ATP-binding protein	NA	D2KRE5	Lactobacillus_phage	33.1	1.2e-11
WP_079579061.1|1238881_1239286_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	43.7	1.2e-26
WP_079579063.1|1239275_1239923_+	HNH endonuclease	NA	A0A220GJG3	Streptococcus_phage	46.6	2.8e-30
WP_079579065.1|1239943_1240147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579067.1|1240159_1240987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579069.1|1240973_1241375_+	hypothetical protein	NA	A0A140HLR7	Bacillus_phage	49.0	2.5e-24
WP_079579071.1|1241633_1242416_+	site-specific DNA-methyltransferase	NA	B4XYT3	Lactobacillus_phage	77.5	2.2e-114
WP_154022018.1|1242429_1243146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172823827.1|1243243_1243705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579077.1|1244275_1244788_+|terminase	terminase small subunit	terminase	A0A097BYC9	Leuconostoc_phage	52.3	6.3e-33
WP_079579079.1|1244771_1246082_+|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	51.6	8.6e-127
WP_079579081.1|1246208_1247861_+|portal	phage portal protein	portal	U3PCP8	Lactobacillus_phage	51.3	7.2e-147
WP_079579083.1|1247805_1248948_+|capsid	minor capsid protein	capsid	U3PFU0	Lactobacillus_phage	50.8	2.1e-97
WP_172823829.1|1249041_1249626_+	phage scaffolding protein	NA	A8ASJ5	Listeria_phage	47.8	1.2e-16
WP_079579085.1|1249643_1250522_+|capsid	capsid protein	capsid	U3PDP8	Lactobacillus_phage	62.0	4.0e-96
WP_079579087.1|1250608_1250803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579089.1|1250911_1251229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579091.1|1251293_1251644_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	56.9	4.9e-29
WP_079579093.1|1251644_1252001_+|capsid	capsid protein	capsid	U3PIU9	Lactobacillus_phage	41.3	4.5e-14
WP_079579095.1|1251997_1252429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579097.1|1252432_1252924_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_079579099.1|1253031_1253496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579101.1|1253501_1254128_+	hypothetical protein	NA	O03936	Lactobacillus_phage	35.9	3.1e-26
WP_079579103.1|1254130_1258561_+	tape measure protein	NA	Q9AZL4	Lactococcus_phage	54.3	2.6e-82
WP_079579105.1|1258547_1259270_+	hypothetical protein	NA	C5IUK4	Streptococcus_phage	29.6	4.1e-22
WP_079579107.1|1259269_1261174_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	37.3	1.7e-59
WP_079579109.1|1261185_1263108_+	hypothetical protein	NA	A0A0S2MYI4	Enterococcus_phage	32.0	8.7e-51
WP_079579111.1|1263120_1263699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579113.1|1263965_1264961_+	collagen-like protein	NA	A0A2P0ZL67	Lactobacillus_phage	78.9	2.7e-120
WP_079579115.1|1264965_1265502_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	62.4	5.4e-51
WP_154022020.1|1265529_1265949_+|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	43.7	3.6e-18
WP_172823830.1|1265949_1266993_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KQK4	Lactobacillus_phage	44.2	5.9e-62
WP_079579117.1|1267151_1267412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579119.1|1267371_1267827_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_010496057.1|1269515_1269842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010496056.1|1270018_1272253_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1V0SJX2	Klosneuvirus	34.1	1.2e-08
WP_029605165.1|1272278_1272725_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_056971077.1|1272793_1273744_+	alpha/beta hydrolase fold domain-containing protein	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	33.3	1.7e-36
WP_079579121.1|1273767_1274409_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_029605157.1|1274465_1275323_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	37.0	1.7e-06
WP_079579123.1|1275882_1277181_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_079579125.1|1277187_1278978_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_056971968.1|1279135_1280008_+	YitT family protein	NA	NA	NA	NA	NA
WP_079579127.1|1280030_1281209_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_010496033.1|1281260_1282163_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.5	1.0e-22
WP_010496032.1|1282245_1283073_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003690207.1|1283366_1283552_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010496031.1|1283573_1284020_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	37.2	3.7e-13
WP_056972469.1|1284160_1285138_+	PhoH family protein	NA	W8D063	Erwinia_phage	49.1	3.2e-49
WP_056972468.1|1285170_1285650_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010496027.1|1285627_1286038_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_010496024.1|1286083_1286986_+	GTPase Era	NA	NA	NA	NA	NA
WP_029605150.1|1287072_1287849_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_010496020.1|1288438_1289356_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_079579129.1|1289357_1291436_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_079579131.1|1291887_1293759_+	DNA primase	NA	A0A1S5REW9	Helicobacter_phage	30.0	4.5e-44
WP_010496014.1|1293772_1294894_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.4	1.1e-37
WP_010496005.1|1295047_1295758_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_010496004.1|1295741_1296857_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010496003.1|1296890_1298132_+	peptidase T	NA	NA	NA	NA	NA
WP_010499943.1|1301847_1303158_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
1301357:1301376	attR	CAACGGTTTTAAAACCGTTG	NA	NA	NA	NA
>prophage 11
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	1393837	1640346	2607423	integrase,protease,tRNA,transposase,holin	Streptococcus_phage(13.64%)	231	1558364:1558383	1565532:1565551
WP_079579186.1|1393837_1395139_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.1	2.1e-56
WP_079579188.1|1395150_1396335_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_079579190.1|1396352_1396847_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_056971161.1|1396935_1399731_-	hypothetical protein	NA	A0A1X9I5C8	Streptococcus_phage	33.3	4.9e-55
WP_079579192.1|1400018_1400975_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_079579194.1|1400974_1401949_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_010494292.1|1401979_1403053_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_010494294.1|1403071_1404094_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_079579196.1|1404176_1405556_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_079579198.1|1405552_1406524_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010494311.1|1406545_1406872_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_010494313.1|1406887_1407640_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010494315.1|1407950_1408757_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_079579200.1|1408839_1410132_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_056988157.1|1410349_1411780_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_010494322.1|1411804_1412803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579310.1|1412882_1414268_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.8e-29
WP_056971172.1|1414737_1415613_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_010494327.1|1415712_1416510_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_010494329.1|1416733_1417729_-	D-2-hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	35.0	2.0e-43
WP_010494331.1|1417838_1418126_-	GIY-YIG nuclease family protein	NA	A0A1V0SLS6	Klosneuvirus	43.1	5.3e-05
WP_056988017.1|1418112_1418871_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010494337.1|1418965_1419598_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_079579664.1|1419649_1419877_-	YneF family protein	NA	NA	NA	NA	NA
WP_010494340.1|1419991_1420240_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_010494342.1|1420404_1421031_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.1	1.6e-14
WP_079578646.1|1421259_1422501_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	2.1e-13
WP_079579203.1|1422761_1424441_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_010494352.1|1424522_1424981_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010494355.1|1425042_1425864_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_010494356.1|1425873_1426761_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.6	4.9e-09
WP_010494359.1|1426753_1426996_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_010494361.1|1426988_1428335_-	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.3	3.2e-28
WP_079579205.1|1428331_1429183_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	3.1e-32
WP_079579207.1|1429312_1429714_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_079579209.1|1429713_1430145_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_010494369.1|1430164_1430722_-	elongation factor P	NA	NA	NA	NA	NA
WP_154022022.1|1430840_1431902_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_010494371.1|1432069_1432351_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_010494373.1|1432373_1432700_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_029604862.1|1432725_1433034_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_010494474.1|1434149_1434707_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_079578404.1|1435347_1436658_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_057785074.1|1437088_1438267_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079579213.1|1438362_1438695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154022023.1|1438711_1438873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010494484.1|1439293_1439758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010494487.1|1439772_1440768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579215.1|1440760_1441651_-	exonuclease SbcC	NA	NA	NA	NA	NA
WP_056988203.1|1441937_1442954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056971404.1|1443063_1444236_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_079578356.1|1444533_1445568_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_010494497.1|1445755_1446028_+	acylphosphatase	NA	NA	NA	NA	NA
WP_056988211.1|1446188_1447112_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_079579217.1|1447178_1448729_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_056971407.1|1448728_1449415_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	3.3e-29
WP_079578646.1|1449745_1450987_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	2.1e-13
WP_010494511.1|1451161_1452583_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.8	1.8e-37
WP_056988034.1|1452750_1453998_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	6.9e-134
WP_056988033.1|1454154_1455483_-	trigger factor	NA	NA	NA	NA	NA
WP_010494526.1|1455651_1456845_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.7	2.1e-31
WP_056988032.1|1457060_1457975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579219.1|1458000_1459701_-	ribonuclease J	NA	NA	NA	NA	NA
WP_056971414.1|1459718_1460597_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_079579221.1|1460609_1461662_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010494555.1|1464183_1464453_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_010494557.1|1464788_1465043_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_056971773.1|1465101_1466133_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_172823837.1|1466122_1468279_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	38.3	8.9e-28
WP_010494573.1|1468416_1468911_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	55.8	4.2e-34
WP_010494574.1|1469025_1469763_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_056971771.1|1469838_1470855_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_056971770.1|1470847_1471330_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.1	3.7e-27
WP_056971769.1|1471326_1471896_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_010494588.1|1471912_1472197_-	YlbG family protein	NA	NA	NA	NA	NA
WP_056988029.1|1472229_1475688_-	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_029604896.1|1475749_1476943_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_010494601.1|1476953_1477235_-	DUF1507 family protein	NA	NA	NA	NA	NA
WP_079579223.1|1477400_1478294_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_056988028.1|1478501_1480343_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_079579224.1|1480478_1481258_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_010494612.1|1481263_1481554_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_079579225.1|1481558_1482476_-	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_079579226.1|1482595_1483627_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.4	8.0e-35
WP_056972721.1|1483871_1484432_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.2	1.5e-11
WP_010494630.1|1484493_1484979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079578748.1|1485199_1486093_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010494636.1|1486291_1486510_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_010494638.1|1486506_1488183_+	ribonuclease J	NA	NA	NA	NA	NA
WP_079579227.1|1488273_1489248_+	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	21.9	6.6e-07
WP_079578367.1|1489485_1490727_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	2.7e-13
WP_079579228.1|1490857_1493380_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	25.2	3.5e-52
WP_010494650.1|1493382_1494057_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010494651.1|1494101_1494758_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010494653.1|1494900_1496028_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_010494655.1|1496367_1496709_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_079579229.1|1496733_1497876_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_010494656.1|1497913_1498597_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_010494657.1|1498659_1498971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010494658.1|1498977_1499520_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_056971343.1|1499567_1500554_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_010494660.1|1500776_1503575_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.3	1.3e-87
WP_010494661.1|1503905_1504634_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_172823863.1|1504665_1505448_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_010494662.1|1505456_1505723_-	YggT family protein	NA	NA	NA	NA	NA
WP_079579231.1|1505735_1506155_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_010494664.1|1506188_1507448_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_010494665.1|1507475_1508828_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_056988053.1|1508943_1509801_-	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
WP_056971350.1|1509884_1510979_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_010494675.1|1510982_1512356_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_010494677.1|1512487_1513450_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_079579233.1|1513478_1515635_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_010494687.1|1515631_1515997_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_010494689.1|1516026_1516977_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_010494692.1|1517029_1517461_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_148266320.1|1517684_1518047_-	DUF3397 family protein	NA	NA	NA	NA	NA
WP_010499933.1|1518455_1519766_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	8.4e-90
WP_079579234.1|1519999_1520119_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_079578367.1|1520331_1521573_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	2.7e-13
WP_010494705.1|1521712_1522651_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_056971396.1|1522749_1524213_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_010494714.1|1524379_1525189_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_056971394.1|1525190_1525868_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_056988168.1|1525882_1526395_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_010494722.1|1526407_1527259_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_148266321.1|1527432_1528428_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_010494725.1|1528559_1528769_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	55.4	4.7e-11
WP_029604921.1|1528971_1529646_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_154022025.1|1529696_1530347_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_010494734.1|1530364_1531672_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_010494736.1|1531824_1534485_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	6.6e-158
WP_079578404.1|1534684_1535995_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_010494738.1|1536660_1537878_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_079579235.1|1537890_1539042_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.1	1.4e-35
WP_010494742.1|1539174_1540890_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_056971385.1|1541058_1541523_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_010494744.1|1541808_1542417_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_079579236.1|1542615_1543890_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.4	7.7e-96
WP_056971381.1|1544734_1545232_+	universal stress protein	NA	NA	NA	NA	NA
WP_010494753.1|1545335_1545893_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010494755.1|1545991_1546840_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_010494757.1|1547143_1548763_+	amino acid permease	NA	NA	NA	NA	NA
WP_079579237.1|1548922_1549381_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079579238.1|1549392_1550169_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	27.6	2.5e-09
WP_079579652.1|1550352_1551738_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
WP_010494765.1|1552303_1552786_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_079579239.1|1553008_1554184_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079578752.1|1554439_1555468_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	6.5e-37
WP_002320682.1|1556463_1556664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579240.1|1556708_1557497_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	27.1	8.3e-08
WP_079579241.1|1557681_1558245_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	42.0	1.1e-30
1558364:1558383	attL	CCTGAATTATTCATACTTTT	NA	NA	NA	NA
WP_079578404.1|1558519_1559830_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_079578423.1|1560817_1562059_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
WP_010499826.1|1562521_1562785_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_079579243.1|1562883_1563471_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.1	2.2e-21
WP_010494774.1|1563498_1563699_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	46.2	5.0e-10
WP_079579244.1|1563711_1563945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010499943.1|1564087_1565398_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
WP_079578407.1|1565994_1566732_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.1	1.1e-51
1565532:1565551	attR	AAAAGTATGAATAATTCAGG	NA	NA	NA	NA
WP_010499979.1|1566752_1567973_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.5	2.2e-100
WP_079579245.1|1568069_1568537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056988216.1|1568558_1569119_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_146983699.1|1569542_1569665_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_079579246.1|1569995_1571402_-	LtrC	NA	NA	NA	NA	NA
WP_079579247.1|1571404_1571623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579248.1|1571739_1571973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579249.1|1571989_1574167_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	48.5	5.7e-115
WP_079579250.1|1574184_1574529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172823864.1|1574545_1575193_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_079579252.1|1575407_1575812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579253.1|1575824_1577354_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_079579254.1|1577350_1577809_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_079579255.1|1577809_1577995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579256.1|1578041_1579070_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	6.5e-37
WP_079579257.1|1579159_1579414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579258.1|1579391_1580009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579259.1|1580025_1580625_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_010499979.1|1581907_1583128_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.5	2.2e-100
WP_079578407.1|1583148_1583886_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.1	1.1e-51
WP_010499439.1|1584265_1585666_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_010499441.1|1585658_1586105_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0K1LSF9	Mycobacterium_phage	36.9	2.4e-12
WP_010499443.1|1586091_1587330_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	7.9e-106
WP_079579260.1|1587310_1588594_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_010499455.1|1588606_1589389_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.1	1.8e-07
WP_010499457.1|1589472_1589829_-	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_056971886.1|1590053_1591250_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_010499469.1|1591295_1591514_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_029605706.1|1591491_1591794_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	57.7	1.4e-16
WP_010499471.1|1591810_1592803_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_010499472.1|1593131_1594436_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010499473.1|1594487_1594724_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_079578646.1|1594973_1596215_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	2.1e-13
WP_056971821.1|1596437_1596857_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010499482.1|1596871_1598278_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_010499484.1|1598297_1599230_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_056988075.1|1599247_1600759_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_010499494.1|1600779_1601322_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010499496.1|1601308_1601833_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_010499498.1|1601878_1602109_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_010499500.1|1602138_1602849_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_010499502.1|1603182_1603812_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010499504.1|1603919_1604942_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.2	1.8e-50
WP_079579261.1|1604960_1605806_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_079579262.1|1605798_1606884_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	39.7	1.1e-05
WP_056988077.1|1606938_1607514_-	thymidine kinase	NA	V9VG58	Lactococcus_phage	52.9	7.8e-48
WP_010499511.1|1607742_1609092_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_079579263.1|1609091_1609793_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_079579635.1|1609869_1611255_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
WP_010499521.1|1611783_1612749_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_079579264.1|1613108_1614350_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	2.7e-13
WP_029605717.1|1614474_1615476_-	serine hydrolase	NA	NA	NA	NA	NA
WP_010499526.1|1615481_1616144_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010499528.1|1616171_1616438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579265.1|1616523_1617264_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.3e-34
WP_057785074.1|1617885_1619064_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079578588.1|1619314_1620625_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.6	1.1e-89
WP_079578748.1|1621076_1621970_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_079579665.1|1623526_1624966_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.4e-29
WP_079579310.1|1625471_1626857_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.8e-29
WP_010499866.1|1627725_1628034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010499867.1|1628380_1628977_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	29.1	1.0e-10
WP_010499869.1|1629146_1629635_+	YslB family protein	NA	NA	NA	NA	NA
WP_079579310.1|1631187_1632573_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.8e-29
WP_010499108.1|1633181_1635542_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	47.8	2.0e-20
WP_010499106.1|1635564_1636077_-	CvpA family protein	NA	NA	NA	NA	NA
WP_010499104.1|1636088_1636340_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_010499101.1|1636532_1636835_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_010499099.1|1636852_1637293_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_010499097.1|1637292_1637556_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_079579266.1|1637694_1640346_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.8	9.1e-67
>prophage 12
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	1680864	1757153	2607423	tRNA,transposase,protease	Streptococcus_phage(23.81%)	57	NA	NA
WP_010498999.1|1680864_1681377_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_079579291.1|1681706_1682567_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_056988047.1|1682588_1683104_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_079578404.1|1683362_1684673_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_010498973.1|1685029_1686007_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	72.8	1.0e-140
WP_010498971.1|1686089_1686449_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_010498969.1|1686640_1687672_+	lactonase family protein	NA	NA	NA	NA	NA
WP_172823865.1|1687687_1688335_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_010499943.1|1688475_1689786_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
WP_079579668.1|1690474_1691860_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	3.0e-29
WP_056971699.1|1691952_1693437_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_010498953.1|1693481_1694645_-	galactokinase	NA	NA	NA	NA	NA
WP_010498952.1|1694793_1695801_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	25.8	1.5e-09
WP_056971694.1|1695871_1697242_-	magnesium transporter	NA	NA	NA	NA	NA
WP_010498948.1|1697255_1698149_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_079579293.1|1698145_1698955_-	NAD kinase	NA	NA	NA	NA	NA
WP_079579294.1|1700378_1702184_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_079579295.1|1702325_1703345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498926.1|1703470_1704220_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_079578369.1|1704478_1705762_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	2.1e-48
WP_010498925.1|1705852_1706251_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_056988166.1|1706625_1707312_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	55.2	3.6e-52
WP_079579296.1|1707312_1709475_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.9	1.3e-249
WP_079579297.1|1709616_1709931_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	46.2	1.1e-19
WP_079579298.1|1709931_1710339_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	39.0	1.2e-21
WP_079579299.1|1710379_1710877_+	PH domain-containing protein	NA	Q9B015	Lactococcus_phage	41.7	4.2e-26
WP_079578423.1|1712298_1713540_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	1.6e-13
WP_010497049.1|1720575_1722657_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.8	7.5e-149
WP_010497047.1|1722759_1722993_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_079579301.1|1723216_1724230_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_010497042.1|1724229_1725255_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010497040.1|1725278_1726457_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_079579302.1|1726681_1728403_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_010497037.1|1728402_1728669_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_010497036.1|1729025_1729220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579303.1|1729401_1731624_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.9	1.2e-120
WP_010497034.1|1731852_1732134_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_079579304.1|1732342_1733470_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_010497032.1|1733677_1735255_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	25.3	2.9e-28
WP_079579305.1|1735369_1736734_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_056971524.1|1736805_1738257_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.6e-09
WP_010497029.1|1738442_1739489_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010497028.1|1739754_1740300_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_079579669.1|1740420_1741773_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	35.3	1.4e-79
WP_010497025.1|1741981_1742779_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_010497023.1|1743007_1743937_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_172823839.1|1743964_1744360_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010497012.1|1744719_1745592_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.1	2.5e-74
WP_010497010.1|1745758_1746544_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_010497008.1|1746779_1747247_+	flavodoxin	NA	NA	NA	NA	NA
WP_010497006.1|1747243_1747663_+	GtrA family protein	NA	NA	NA	NA	NA
WP_079579307.1|1748262_1751148_+	YfhO family protein	NA	NA	NA	NA	NA
WP_079579308.1|1751329_1752472_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	28.2	1.8e-24
WP_010496991.1|1752924_1753338_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_010496989.1|1753473_1754760_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	1.6e-37
WP_010496987.1|1754749_1755787_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010496978.1|1756478_1757153_-|protease	matrixin family metalloprotease	protease	W6JIV8	Anomala_cuprea_entomopoxvirus	35.6	5.6e-05
>prophage 13
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	1761185	1831059	2607423	capsid,head,terminase,integrase,protease,tail,tRNA,transposase,holin	Erysipelothrix_phage(50.0%)	57	1808038:1808097	1810013:1810366
WP_010500073.1|1761185_1762145_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079578848.1|1763612_1764998_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	7.9e-30
WP_079579310.1|1765503_1766889_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.8e-29
WP_079579311.1|1767554_1767929_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_079579312.1|1768897_1770169_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_079579313.1|1770300_1771488_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_079579314.1|1772777_1773293_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_010496960.1|1773411_1773603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579315.1|1773729_1774485_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_079579316.1|1774481_1774739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579317.1|1774755_1776306_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_079579318.1|1776327_1776645_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_079579319.1|1776657_1777125_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_079579320.1|1777465_1778242_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_079578626.1|1778479_1779997_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	28.7	6.6e-38
WP_148095623.1|1780131_1780503_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079578630.1|1780495_1780678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579321.1|1783141_1783738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579322.1|1783759_1784653_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_172823841.1|1784657_1785866_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_079579324.1|1785858_1787811_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_079579325.1|1787811_1790520_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	35.5	5.7e-141
WP_079579326.1|1790535_1790751_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	65.2	4.1e-18
WP_079579327.1|1790762_1793375_-	helicase	NA	NA	NA	NA	NA
WP_079579328.1|1793379_1794702_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_079579329.1|1795072_1795591_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_079579330.1|1795689_1795893_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	36.2	7.5e-06
WP_079579331.1|1795876_1796212_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	34.9	1.9e-06
WP_172823842.1|1797348_1797900_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.8	6.1e-74
WP_079579332.1|1799959_1800364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579333.1|1800366_1802622_+	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.2	4.4e-211
WP_079579334.1|1802835_1803117_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	52.2	7.5e-20
WP_079579335.1|1804436_1804904_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_079579336.1|1805050_1805428_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	54.7	6.7e-32
WP_079579337.1|1805547_1806090_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	57.1	1.4e-54
WP_063507627.1|1806095_1806374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154022029.1|1806564_1808037_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1808038:1808097	attL	CTCCTCTTTTCAGTTGGTGATTTGTGGTAATCTCATTTTAACTGACTTGTCTGGAGAGGC	NA	NA	NA	NA
WP_154022029.1|1808539_1810012_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079579339.1|1810511_1810718_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
1810013:1810366	attR	CTCCTCTTTTCAGTTGGTGATTTGTGGTAATCTCATTTTAACTGACTTGTCTGGAGAGGCAAGTGTTTTTTTGTGTCGCGAAGTCTGACCTGGATGCTTGCAGGAATTATTTCGCCTCCAGTAGTTGCATGTCAAGAGCCGCTACGCTCTTCCTCTTGACATTCAACTACTTCCGGCAAGACCTGGTTGACAAGCATGCAAGGCACAGACTGGCAACTCAGGTTCACAATTTTGACTAAACGAAAATAGTAACAGTGGTGCTTTAAGGGGGGATACTCAAAAAGCGGCTTAAAGCTTGTCACTGTTAGAATAACAAGGAAATAAAGAAATAAAATTTTGAATTACTGTCAGAAC	NA	NA	NA	NA
WP_079579671.1|1810818_1812381_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.2	1.4e-245
WP_079579340.1|1812451_1812679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579672.1|1812681_1812960_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_079579341.1|1814409_1815081_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	50.9	3.7e-57
WP_079579342.1|1815100_1816279_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.5	8.3e-129
WP_079579343.1|1816295_1816574_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1X9I695	Streptococcus_phage	38.9	1.4e-07
WP_079579344.1|1816574_1816952_+|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	34.5	4.2e-10
WP_079579345.1|1816948_1817359_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	63.1	2.9e-41
WP_079579346.1|1817355_1818234_+	1,4-beta-N-acetylmuramidase	NA	A0A1U9WQS3	Geobacillus_phage	27.4	3.1e-11
WP_079579347.1|1818325_1818562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579348.1|1820242_1821820_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	49.6	8.8e-134
WP_079579673.1|1821867_1823268_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_079579349.1|1823286_1824000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579350.1|1824497_1825874_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.8	4.7e-123
WP_056988074.1|1826794_1827823_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.7	5.0e-21
WP_010496864.1|1827856_1829290_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_010496862.1|1829289_1830753_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_079579351.1|1830756_1831059_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 14
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	1895189	1997521	2607423	tRNA,transposase,integrase,protease	Mycobacterium_phage(14.81%)	77	1953556:1953569	1989151:1989164
WP_079579370.1|1895189_1896500_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.4	3.2e-89
WP_079579371.1|1896863_1897430_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	35.5	1.6e-21
WP_010496686.1|1897503_1899597_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.9	6.1e-66
WP_010496685.1|1899748_1900219_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_010496682.1|1900284_1900698_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_010496681.1|1900948_1901641_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_079579372.1|1901720_1903106_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.8	2.3e-29
WP_010499362.1|1903702_1907368_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.0	1.1e-67
WP_148266373.1|1907407_1911001_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.7	1.0e-52
WP_010499359.1|1911308_1913780_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.8	2.1e-126
WP_010499357.1|1913884_1914352_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079579373.1|1915044_1916286_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.3	1.2e-13
WP_010498448.1|1923061_1924315_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	40.8	2.2e-87
WP_010498446.1|1924708_1925164_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_010498444.1|1925300_1925891_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_010498442.1|1925928_1929057_-	SMC family ATPase	NA	A0A1D8KRV2	Synechococcus_phage	26.6	2.1e-09
WP_010498440.1|1929043_1930180_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_010498439.1|1930276_1930684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498437.1|1931313_1932042_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079579375.1|1932271_1933513_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	23.7	1.2e-13
WP_010498428.1|1933699_1934890_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	38.7	9.8e-45
WP_079579376.1|1934943_1935627_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.7	1.7e-17
WP_079579377.1|1935900_1936998_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010498423.1|1937212_1938010_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_010498421.1|1938288_1938879_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010498419.1|1938958_1940020_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_079579378.1|1940195_1940726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498416.1|1941432_1942224_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004271276.1|1942363_1943287_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.9	6.2e-31
WP_010498407.1|1943338_1943782_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_079579379.1|1944009_1945251_-	peptidase T	NA	NA	NA	NA	NA
WP_010498403.1|1947265_1947955_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_010498401.1|1948185_1948635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498399.1|1949363_1950209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498396.1|1950333_1951014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498394.1|1951236_1952097_-	arginase family protein	NA	A0A1V0SJM8	Klosneuvirus	27.3	1.3e-09
WP_010498393.1|1952302_1952722_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010498391.1|1952755_1953508_-	hypothetical protein	NA	NA	NA	NA	NA
1953556:1953569	attL	TTTTGCAAATATGT	NA	NA	NA	NA
WP_056972717.1|1953573_1954401_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	65.9	8.5e-104
WP_079579310.1|1954571_1955957_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.8e-29
WP_010498381.1|1956395_1957946_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.3	3.2e-48
WP_154022033.1|1958010_1958388_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079579380.1|1958753_1959152_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010498364.1|1959779_1960028_+	DUF3173 family protein	NA	NA	NA	NA	NA
WP_010498362.1|1960031_1961225_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	32.2	4.7e-39
WP_172823867.1|1961289_1962828_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.4	2.5e-16
WP_056988104.1|1962949_1963873_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.8	1.3e-31
WP_010498357.1|1964054_1964615_+	lipase	NA	NA	NA	NA	NA
WP_010498355.1|1964992_1967296_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_079579381.1|1967495_1969367_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_056971998.1|1969452_1970121_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_079579382.1|1970148_1970817_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_056988103.1|1971031_1971214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579383.1|1971203_1971560_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079579384.1|1971706_1973275_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	28.0	9.0e-38
WP_010498341.1|1973790_1974774_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_079579385.1|1974989_1976231_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	23.7	1.2e-13
WP_010498333.1|1976414_1977395_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.3e-22
WP_056988173.1|1977419_1978460_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	5.8e-17
WP_010498331.1|1978469_1979504_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010498329.1|1979507_1980437_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_079579386.1|1980686_1982312_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079579387.1|1982711_1983974_+	GTPase HflX	NA	NA	NA	NA	NA
WP_079579388.1|1984027_1984438_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003561820.1|1984725_1985604_-|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
WP_056972535.1|1986240_1986894_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010498313.1|1986907_1987546_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_079579389.1|1987542_1988373_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172823868.1|1988385_1989120_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	42.3	1.3e-34
WP_079579391.1|1989518_1990529_-	hypothetical protein	NA	NA	NA	NA	NA
1989151:1989164	attR	TTTTGCAAATATGT	NA	NA	NA	NA
WP_079578748.1|1990722_1991616_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_079579392.1|1991605_1992040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056971938.1|1992710_1993139_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_056971937.1|1993270_1993852_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_079579393.1|1994131_1995529_+	amino acid permease	NA	NA	NA	NA	NA
WP_010498298.1|1995597_1995981_-	VOC family protein	NA	NA	NA	NA	NA
WP_079579394.1|1996279_1997521_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	2.1e-13
>prophage 15
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	2061643	2200956	2607423	transposase,protease	Streptococcus_phage(25.0%)	103	NA	NA
WP_079579420.1|2061643_2062822_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079579421.1|2063274_2064075_-	OmpA family protein	NA	NA	NA	NA	NA
WP_010498457.1|2064097_2064880_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010498459.1|2065013_2065403_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_010498460.1|2065464_2065794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579422.1|2065821_2067282_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_010498465.1|2067290_2067725_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_079578317.1|2068194_2069580_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	1.5e-28
WP_079579423.1|2070064_2070952_-	flagellin	NA	NA	NA	NA	NA
WP_079579424.1|2071141_2071963_-	flagellin	NA	NA	NA	NA	NA
WP_079579425.1|2072149_2072767_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	37.9	9.6e-20
WP_010499943.1|2073254_2074565_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
WP_079579426.1|2075241_2077380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010498484.1|2077612_2077870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579427.1|2078068_2079058_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_056972400.1|2079172_2079466_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	46.3	1.2e-07
WP_056972398.1|2079480_2079768_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_079579428.1|2084230_2086843_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_010498509.1|2088042_2088369_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_172823845.1|2088390_2088849_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_079579430.1|2089159_2090188_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	1.4e-36
WP_079579431.1|2090201_2090441_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_050955744.1|2090465_2092025_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_010499943.1|2092283_2093594_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
WP_010498520.1|2093839_2094940_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_079579433.1|2095123_2097070_-	acyltransferase	NA	T1SAQ6	Salmonella_phage	24.7	2.3e-22
WP_010498525.1|2097032_2097428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010498527.1|2097605_2098715_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010498529.1|2099100_2099424_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	37.8	1.6e-18
WP_010498531.1|2099432_2100257_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_010498533.1|2100457_2101198_-	TerC family protein	NA	S5MAL1	Bacillus_phage	47.1	9.1e-41
WP_079579434.1|2101255_2102221_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_079579435.1|2102168_2102342_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_010498536.1|2102406_2102814_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	32.5	2.5e-08
WP_172823846.1|2103991_2105842_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_079579437.1|2105946_2106681_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_010498566.1|2106837_2107773_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_158308975.1|2107974_2108208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148266364.1|2108480_2108861_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	35.7	1.1e-05
WP_010498571.1|2109021_2109921_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_056988085.1|2110276_2110894_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_056972755.1|2111077_2111545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079578404.1|2113111_2114422_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_079579441.1|2117220_2118387_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_010498604.1|2118823_2119867_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P0ZLG0	Lactobacillus_phage	47.3	3.9e-13
WP_079578752.1|2121478_2122507_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	6.5e-37
WP_079579442.1|2125104_2125767_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_154022058.1|2125768_2127142_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_079579444.1|2127166_2127454_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_079579445.1|2127466_2127934_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_079579446.1|2128845_2130009_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	2.9e-49
WP_079579447.1|2130295_2130460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579448.1|2130764_2130983_+	helix-turn-helix transcriptional regulator	NA	A0A2R2ZGJ3	Clostridioides_phage	39.1	6.2e-06
WP_079578614.1|2131230_2132616_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_010498628.1|2134324_2135281_+	LCP family protein	NA	NA	NA	NA	NA
WP_079579450.1|2135526_2135748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579451.1|2135944_2137255_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	1.4e-89
WP_079579452.1|2137855_2138761_-	SH3 domain-containing protein	NA	U3PJ04	Lactobacillus_phage	39.7	4.4e-53
WP_079579453.1|2138842_2139070_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_010498667.1|2139097_2139304_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_079579454.1|2139738_2140440_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_079579455.1|2141138_2141369_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_079579456.1|2141425_2141623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579457.1|2141757_2142306_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010498674.1|2142573_2143347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056971530.1|2143456_2144206_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079579677.1|2144384_2145704_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_056971531.1|2145844_2147278_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_079579458.1|2147377_2148280_+	ROK family protein	NA	NA	NA	NA	NA
WP_079579459.1|2148398_2149493_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_010499979.1|2149847_2151068_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	49.5	2.2e-100
WP_079578407.1|2151088_2151826_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	45.1	1.1e-51
WP_079579460.1|2153736_2154702_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.5	2.1e-74
WP_079579461.1|2154923_2155790_+	DegV family protein	NA	NA	NA	NA	NA
WP_079579462.1|2156317_2158168_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.2	6.8e-69
WP_079578752.1|2158477_2159506_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	6.5e-37
WP_010500073.1|2159833_2160793_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079578848.1|2162261_2163647_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.3	7.9e-30
WP_079579635.1|2165652_2167038_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	2.3e-29
WP_172823869.1|2167620_2170710_-	glycosyl hydrolase family 70	NA	NA	NA	NA	NA
WP_079579464.1|2173514_2174516_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_079579465.1|2174646_2175849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579466.1|2175979_2177185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579467.1|2177207_2178623_-	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_079579468.1|2178629_2179745_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	75.4	3.2e-162
WP_172823848.1|2179771_2180806_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_079579470.1|2180963_2181746_-	hypothetical protein	NA	A0A2K9L639	Tupanvirus	25.8	2.4e-07
WP_079579471.1|2181758_2182760_-	sugar transferase	NA	Q5ULS2	Lactobacillus_virus	24.4	3.6e-16
WP_172823849.1|2182899_2184024_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_079579473.1|2184013_2184856_-	LicD family protein	NA	A0A1V0SD50	Indivirus	41.3	5.7e-07
WP_079579474.1|2184845_2185628_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_079579475.1|2185649_2186300_-	sugar transferase	NA	NA	NA	NA	NA
WP_079579476.1|2186728_2187730_-	sugar transferase	NA	NA	NA	NA	NA
WP_079579477.1|2187762_2188779_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_079579478.1|2188945_2190280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579479.1|2190401_2191334_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	51.5	1.0e-81
WP_154022035.1|2191361_2193038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579678.1|2193434_2193842_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.2	2.2e-20
WP_079579481.1|2195302_2195626_+	GtrA family protein	NA	NA	NA	NA	NA
WP_079578956.1|2195848_2197090_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.0	4.6e-13
WP_079579482.1|2197212_2198343_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_003561746.1|2198675_2199851_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079579483.1|2199996_2200956_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	2320414	2366311	2607423	transposase	Streptococcus_phage(16.67%)	36	NA	NA
WP_010499933.1|2320414_2321725_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.9	8.4e-90
WP_079579526.1|2322005_2322779_-	acetoin reductase	NA	A0A2P0VP75	Tetraselmis_virus	27.1	8.4e-05
WP_079579527.1|2323445_2325851_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	32.6	9.0e-122
WP_079579528.1|2326006_2326519_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172823851.1|2327634_2327943_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079578928.1|2328160_2329339_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079579530.1|2329600_2330101_-	kinase	NA	NA	NA	NA	NA
WP_010499943.1|2330572_2331883_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
WP_079579531.1|2332288_2334217_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	4.4e-95
WP_010497768.1|2334216_2334489_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_079579532.1|2334859_2335231_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_079579533.1|2335256_2335694_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_079579534.1|2335988_2336840_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	33.3	8.6e-35
WP_172823870.1|2336956_2339455_-	ERAP1-like C-terminal domain-containing protein	NA	A0A0P0IY26	Acinetobacter_phage	25.5	1.2e-68
WP_010497777.1|2339962_2340487_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_154022040.1|2340655_2342035_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010497779.1|2342569_2342869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056971708.1|2343154_2343916_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.4	4.4e-14
WP_010497783.1|2344045_2344693_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_079579537.1|2344845_2345943_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_010497787.1|2346209_2347028_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_079579538.1|2347240_2349679_+	glycyl radical protein	NA	A0A060AHY5	Cronobacter_phage	47.2	2.2e-06
WP_079579539.1|2349697_2350378_+	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.0	2.1e-20
WP_079579540.1|2351195_2353106_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.6	2.6e-63
WP_010497795.1|2353363_2354740_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_172823852.1|2355854_2356520_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010497799.1|2356526_2357300_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010497801.1|2357296_2358121_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_010497804.1|2358145_2359117_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_056988051.1|2359113_2359977_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010497813.1|2360119_2360560_-	universal stress protein	NA	NA	NA	NA	NA
WP_079579542.1|2360719_2361211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579543.1|2361412_2362798_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_079579544.1|2363115_2363616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154022041.1|2364673_2364919_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_079579394.1|2365069_2366311_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	2.1e-13
>prophage 17
NZ_LT630287	Lactobacillus acidipiscis strain ACA-DC 1533 chromosome I	2607423	2522641	2586678	2607423	transposase	Staphylococcus_phage(33.33%)	54	NA	NA
WP_079579612.1|2522641_2523820_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_056972039.1|2524074_2524440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079579613.1|2524593_2525967_-	MFS transporter	NA	NA	NA	NA	NA
WP_056972038.1|2526006_2527536_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_010495808.1|2527863_2528262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010495807.1|2528506_2529874_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_079579614.1|2530082_2530310_+	HIT family protein	NA	NA	NA	NA	NA
WP_079579615.1|2530605_2532126_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_010499943.1|2532666_2533977_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	41.2	2.3e-87
WP_056971984.1|2536038_2536647_-	DedA family protein	NA	NA	NA	NA	NA
WP_079579616.1|2537430_2537715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154022046.1|2537879_2539835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079579618.1|2540201_2541122_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_079579619.1|2541392_2542313_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	45.4	8.9e-62
WP_079579620.1|2542569_2543487_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_079579621.1|2543497_2543956_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	67.1	2.9e-53
WP_079579622.1|2544233_2545031_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_079579623.1|2545203_2545917_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010495771.1|2546545_2547898_+	amino acid permease	NA	NA	NA	NA	NA
WP_172823853.1|2548414_2549200_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.5e-14
WP_010495767.1|2549192_2549921_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_079579624.1|2549917_2550940_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.9	8.2e-16
WP_079578404.1|2552005_2553316_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	1.3e-90
WP_010495755.1|2553877_2555323_-	catalase	NA	A0A2K9L0T1	Tupanvirus	40.2	5.3e-101
WP_050955717.1|2555525_2556041_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_010495752.1|2556133_2556730_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_010495751.1|2556850_2557660_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_079579626.1|2558406_2559582_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	34.5	1.7e-57
WP_056972146.1|2559754_2560660_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_079579627.1|2560865_2561282_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010495744.1|2561500_2562883_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010495741.1|2562900_2564124_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_056971860.1|2564462_2565281_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_056971861.1|2565360_2565894_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079579628.1|2565961_2567545_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_010495726.1|2567611_2567809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495724.1|2567811_2568375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154022047.1|2568885_2569032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495721.1|2569021_2569297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495720.1|2569375_2569882_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	43.5	1.1e-29
WP_010495718.1|2570032_2570788_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_010495716.1|2570793_2571435_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	2.2e-22
WP_010495714.1|2571632_2572106_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_079579629.1|2572284_2573244_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_056988145.1|2573245_2573500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010495704.1|2574098_2575190_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_010495702.1|2575192_2576170_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_010495699.1|2576303_2577926_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_010495698.1|2577930_2579337_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	8.9e-45
WP_079578367.1|2579503_2580745_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.2	2.7e-13
WP_010495697.1|2581132_2582155_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_035630993.1|2582370_2583333_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_079579686.1|2583457_2585359_-	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_003561820.1|2585799_2586678_-|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
