The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT605585	Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 1	2145953	1083888	1152754	2145953	tail,transposase,plate,integrase,tRNA	Rhizobium_phage(54.84%)	61	1109023:1109049	1156341:1156367
WP_070997179.1|1083888_1084764_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_070997933.1|1084839_1085484_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_008507202.1|1085757_1086330_+	HNH endonuclease	NA	A0A223W0A5	Agrobacterium_phage	40.9	8.6e-31
WP_070997180.1|1086346_1086865_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_002964736.1|1086977_1087568_-	DedA family protein	NA	NA	NA	NA	NA
WP_070997181.1|1087684_1089136_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_070997182.1|1089253_1090075_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070997092.1|1092831_1093089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070997184.1|1097700_1098018_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_070997934.1|1098313_1099792_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	7.0e-08
WP_002964728.1|1099887_1100892_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_059243373.1|1101067_1102057_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008507129.1|1102145_1102919_+	D-threitol dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.8	4.3e-09
WP_070997185.1|1102951_1103944_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_006013445.1|1103955_1104597_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_083331453.1|1104755_1106840_+	bifunctional sugar-binding transcriptional regulator/dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_070997936.1|1106905_1107553_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_070997937.1|1107829_1108111_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
1109023:1109049	attL	TAGAGCGCGTTTCGATCTGATTGAATC	NA	NA	NA	NA
WP_025199787.1|1109161_1109947_-	porin family protein	NA	O11861	Bartonella_henselae_phage	33.2	3.4e-22
WP_008507113.1|1110238_1110853_-	MarC family protein	NA	NA	NA	NA	NA
WP_070997186.1|1110868_1112629_-	alginate export family protein	NA	NA	NA	NA	NA
WP_070997187.1|1112635_1113430_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_145925613.1|1113496_1114411_-	7-alpha-hydroxysteroid dehydrogenase	NA	A0A0M4JSW6	Mollivirus	27.2	4.2e-11
WP_002964713.1|1115207_1115444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004689882.1|1115478_1116768_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_070997188.1|1117016_1118429_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070997939.1|1118723_1119827_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009365120.1|1120068_1121214_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	3.0e-27
WP_070997189.1|1121229_1122141_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_008507091.1|1122142_1122964_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_070997190.1|1122971_1124909_-	AsmA family protein	NA	NA	NA	NA	NA
WP_070997191.1|1125649_1128760_-	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.8	7.3e-23
WP_070997192.1|1129574_1130378_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	93.6	3.6e-144
WP_070997193.1|1130523_1130793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070997194.1|1130789_1131005_+	hypothetical protein	NA	R9U2V1	Rhizobium_phage	43.7	1.1e-07
WP_070997195.1|1131001_1131262_+	DUF2312 domain-containing protein	NA	A0A240F4X4	Ochrobactrum_phage	95.3	1.1e-36
WP_070997196.1|1131397_1132189_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	86.7	2.7e-131
WP_158513626.1|1132686_1133379_-	helix-turn-helix domain-containing protein	NA	G8GWB1	Rhodobacter_phage	38.7	6.1e-31
WP_083331455.1|1133416_1133833_+	helix-turn-helix domain-containing protein	NA	R9U1A5	Rhizobium_phage	73.7	1.1e-35
WP_158513627.1|1133832_1133985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070997199.1|1133981_1134965_+	ParB N-terminal domain-containing protein	NA	R9U496	Rhizobium_phage	56.4	5.2e-84
WP_070997200.1|1134967_1135435_+	hypothetical protein	NA	R9U2Q7	Rhizobium_phage	80.0	1.1e-63
WP_070997201.1|1135431_1137693_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	R9U1A8	Rhizobium_phage	74.2	0.0e+00
WP_070997202.1|1138252_1138600_+	hypothetical protein	NA	R9U460	Rhizobium_phage	67.0	2.0e-35
WP_070997204.1|1138838_1141316_+	hypothetical protein	NA	R9U4C6	Rhizobium_phage	59.8	2.0e-148
WP_070997205.1|1141312_1141789_+|tail	phage tail protein	tail	R9U2U2	Rhizobium_phage	73.4	5.3e-58
WP_070997206.1|1141785_1142055_+|tail	tail protein X	tail	R9U1D8	Rhizobium_phage	75.0	2.3e-34
WP_134789780.1|1142058_1142250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070997207.1|1142249_1143251_+	late control protein D	NA	R9U464	Rhizobium_phage	70.1	7.8e-128
WP_070997208.1|1143234_1143636_+	hypothetical protein	NA	R9U0U6	Rhizobium_phage	51.1	3.8e-33
WP_070997209.1|1143635_1143899_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	85.1	1.7e-21
WP_070997210.1|1144006_1144414_+|plate	baseplate	plate	R9U2U6	Rhizobium_phage	68.9	1.7e-52
WP_070997211.1|1144406_1145540_+|plate	baseplate J/gp47 family protein	plate	R9U1E3	Rhizobium_phage	65.2	3.3e-127
WP_070997212.1|1145532_1146204_+|tail	phage tail protein I	tail	R9U468	Rhizobium_phage	69.8	6.7e-75
WP_070997213.1|1146206_1148159_+|tail	phage tail protein	tail	R9U0V1	Rhizobium_phage	50.4	4.4e-111
WP_145925615.1|1148155_1148707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070997215.1|1148703_1148919_+	hypothetical protein	NA	R9U2V1	Rhizobium_phage	39.4	3.2e-07
WP_070997216.1|1148915_1149176_+	DUF2312 domain-containing protein	NA	A0A240F4X4	Ochrobactrum_phage	96.5	8.1e-37
WP_083331456.1|1149311_1150115_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	86.8	1.1e-132
WP_070997217.1|1150527_1151484_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_009362888.1|1151629_1152754_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L0G1	Tupanvirus	31.1	1.4e-29
1156341:1156367	attR	GATTCAATCAGATCGAAACGCGCTCTA	NA	NA	NA	NA
>prophage 2
NZ_LT605585	Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 1	2145953	1842726	1855794	2145953	transposase,tRNA	uncultured_Mediterranean_phage(81.82%)	13	NA	NA
WP_083331476.1|1842726_1845054_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1845171_1845513_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_070997651.1|1845672_1846539_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_145925633.1|1846552_1847461_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.3	1.7e-28
WP_070997657.1|1847745_1849044_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_004683704.1|1849420_1850089_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_070997659.1|1850085_1850853_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	39.6	8.0e-40
WP_069715247.1|1851001_1852285_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	2.0e-104
WP_002964014.1|1852361_1853186_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_070997979.1|1853182_1853749_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1853860_1854079_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_070997661.1|1854224_1854950_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	8.6e-44
WP_070997663.1|1854942_1855794_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.9	6.8e-32
>prophage 3
NZ_LT605585	Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 1	2145953	1994522	2001878	2145953	integrase,tail	Brucella_phage(66.67%)	6	1993270:1993285	2004397:2004412
1993270:1993285	attL	GGGCAAGATGATCGAC	NA	NA	NA	NA
WP_070997786.1|1994522_1996079_-	hypothetical protein	NA	F8TUS8	EBPR_podovirus	28.2	3.1e-14
WP_158513633.1|1996087_1998190_-	hypothetical protein	NA	X2CYK8	Brucella_phage	43.3	2.1e-82
WP_070997789.1|1998317_1999325_-|tail	tail fiber domain-containing protein	tail	X2CY28	Brucella_phage	56.1	6.9e-92
WP_083331486.1|1999330_1999795_-	hypothetical protein	NA	X2CY06	Brucella_phage	54.2	1.0e-34
WP_158513634.1|1999791_2000886_-	hypothetical protein	NA	A0A0H4IXX4	Brucella_phage	49.2	7.3e-95
WP_070997791.1|2001242_2001878_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	40.2	1.7e-27
2004397:2004412	attR	GGGCAAGATGATCGAC	NA	NA	NA	NA
>prophage 4
NZ_LT605585	Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 1	2145953	2077317	2124049	2145953	integrase,protease,head,tail	Mesorhizobium_phage(14.29%)	40	2074694:2074708	2084892:2084906
2074694:2074708	attL	AACTCCATGACGGTG	NA	NA	NA	NA
WP_070997827.1|2077317_2078244_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	36.4	1.7e-28
WP_070997828.1|2078769_2079903_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_070997995.1|2079920_2080295_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_070997829.1|2080339_2080990_-	antifreeze protein	NA	NA	NA	NA	NA
WP_070997996.1|2081761_2082415_+	YitT family protein	NA	NA	NA	NA	NA
WP_070997830.1|2082474_2082732_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_070997831.1|2083001_2083241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|2083237_2083585_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_070997832.1|2083643_2084354_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_070997833.1|2084712_2084880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006011906.1|2084920_2086423_+	AMP nucleosidase	NA	NA	NA	NA	NA
2084892:2084906	attR	CACCGTCATGGAGTT	NA	NA	NA	NA
WP_070997834.1|2086589_2087558_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_070997835.1|2087831_2089523_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_070997836.1|2089912_2090785_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_008508589.1|2090946_2092203_+	MFS transporter	NA	NA	NA	NA	NA
WP_070997837.1|2093390_2096042_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_070997838.1|2096432_2098784_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_070997839.1|2099055_2101167_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_070997840.1|2101211_2104163_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_083331489.1|2104285_2105692_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002963761.1|2105688_2106396_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_070997841.1|2106489_2108031_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_009364533.1|2108172_2108649_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|2108645_2110637_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|2110656_2111154_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_070997842.1|2111150_2112290_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_009363050.1|2112390_2112843_-	membrane protein	NA	NA	NA	NA	NA
WP_070997843.1|2112936_2114247_-	histidine kinase	NA	NA	NA	NA	NA
WP_004689554.1|2114321_2115011_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|2115089_2115386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008508561.1|2115547_2115754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070997844.1|2115878_2119682_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0K1LL82	Rhodobacter_phage	38.7	5.4e-214
WP_008935507.1|2119685_2120120_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_070997846.1|2120987_2121620_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.1	1.9e-47
WP_002970984.1|2121622_2122168_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_070997847.1|2122387_2122729_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_008935501.1|2122725_2123139_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_070997848.1|2123179_2123587_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004688128.1|2123546_2123714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004688127.1|2123710_2124049_-|head	phage head closure protein	head	NA	NA	NA	NA
>prophage 1
NZ_LT605586	Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 2	1296428	439269	452462	1296428		Bacillus_phage(22.22%)	13	NA	NA
WP_083331526.1|439269_440556_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.2	4.8e-106
WP_083331527.1|441101_441809_-	3'-5' exoribonuclease	NA	J9Q6J8	Salmonella_phage	28.8	2.6e-05
WP_008510705.1|442212_442401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002971236.1|442546_442852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070998261.1|442992_443370_+	pyrimidine dimer DNA glycosylase/endonuclease V	NA	F4YXR7	Roseobacter_phage	64.2	1.2e-36
WP_070998263.1|444273_444993_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.1	3.6e-10
WP_008510700.1|445557_445854_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	40.0	2.5e-10
WP_069714895.1|445866_446148_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	44.6	4.5e-09
WP_070998266.1|446905_449095_-	esterase-like activity of phytase family protein	NA	M4SLV1	Cyanophage	47.1	4.0e-92
WP_070998268.1|449266_450607_-	DNA polymerase IV	NA	O64031	Bacillus_phage	25.4	1.1e-23
WP_070998270.1|451057_451567_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002966021.1|451622_451910_-	DUF3572 domain-containing protein	NA	NA	NA	NA	NA
WP_002966022.1|452090_452462_+	response regulator	NA	B5LWN0	Feldmannia_species_virus	30.5	3.1e-05
>prophage 2
NZ_LT605586	Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 2	1296428	652312	709288	1296428	tRNA,head,plate,tail,transposase	Rhizobium_phage(66.67%)	51	NA	NA
WP_070998464.1|652312_653968_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070998466.1|654055_655015_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_002967251.1|655015_655672_-	helix-turn-helix transcriptional regulator	NA	B5WZX5	Pseudomonas_phage	29.2	1.8e-11
WP_070998468.1|655909_658126_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_004687161.1|658141_659350_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_070998470.1|659414_661208_-	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_070998472.1|661182_661386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070998474.1|661584_662517_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_008510829.1|663117_664050_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070999448.1|664269_665430_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_070998476.1|665563_666364_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.4	1.2e-14
WP_002965841.1|666360_667149_-	nickel import ATP-binding protein NikD	NA	G3M9Y6	Bacillus_virus	22.4	3.5e-06
WP_070998478.1|667145_668018_-	nickel ABC transporter permease subunit NikC	NA	NA	NA	NA	NA
WP_002965839.1|668014_668959_-	nickel ABC transporter permease subunit NikB	NA	NA	NA	NA	NA
WP_070998480.1|668960_670541_-	nickel ABC transporter, nickel/metallophore periplasmic binding protein	NA	NA	NA	NA	NA
WP_002965835.1|670807_671206_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_070998482.1|671287_674368_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.3e-59
WP_083331535.1|674390_675425_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_070998487.1|675833_676235_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_070999449.1|676231_676645_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_002965821.1|676660_677020_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_070998489.1|677073_677529_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070998491.1|677898_680748_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_004682180.1|681013_681934_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_069713893.1|681935_682760_+	TIGR02186 family protein	NA	NA	NA	NA	NA
WP_070998493.1|682805_683573_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_070998496.1|683569_686086_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_070998498.1|686339_687362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070998500.1|687676_687823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009364219.1|687969_688938_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_070998501.1|690251_690794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145925645.1|690786_691443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145925646.1|691530_692097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158513639.1|692424_693408_+	hypothetical protein	NA	A0A1B0T6E7	Thiobacimonas_phage	42.5	1.6e-32
WP_070998507.1|693404_694295_+|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	43.2	9.5e-69
WP_070998509.1|694303_694645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070998512.1|694648_694999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070998515.1|695397_697755_-|tail	phage tail protein	tail	R9U0V1	Rhizobium_phage	50.4	5.4e-111
WP_070997212.1|697757_698429_-|tail	phage tail protein I	tail	R9U468	Rhizobium_phage	69.8	6.7e-75
WP_083331536.1|698421_699264_-|plate	baseplate J/gp47 family protein	plate	R9U1E3	Rhizobium_phage	62.7	3.9e-80
WP_070998522.1|699497_699836_-	DUF2190 family protein	NA	R9U0T4	Rhizobium_phage	71.4	8.4e-34
WP_070999457.1|699851_700988_-	hypothetical protein	NA	R9U448	Rhizobium_phage	71.6	4.4e-143
WP_070998524.1|701263_701731_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	68.4	5.2e-50
WP_070998527.1|701834_703340_-|head	head morphogenesis protein	head	R9U2S4	Rhizobium_phage	65.7	3.1e-197
WP_070998529.1|703418_703895_-|tail	phage tail protein	tail	R9U2U2	Rhizobium_phage	72.8	9.0e-58
WP_083331570.1|703891_705172_-	ATP-binding protein	NA	R9U430	Rhizobium_phage	68.0	6.1e-93
WP_070998531.1|705200_707396_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	R9U1A8	Rhizobium_phage	45.2	9.9e-176
WP_083331537.1|707392_707857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070998533.1|707856_708843_-	ParB N-terminal domain-containing protein	NA	R9U496	Rhizobium_phage	58.3	1.3e-87
WP_154142507.1|708839_708992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069713905.1|708988_709288_-	helix-turn-helix domain-containing protein	NA	R9U1A5	Rhizobium_phage	60.0	3.9e-27
>prophage 3
NZ_LT605586	Brucella inopinata strain 141012304 isolate Brucella sp. chromosome 2	1296428	1138794	1174409	1296428	terminase,transposase,portal	Rhizobium_phage(38.71%)	48	NA	NA
WP_070999097.1|1138794_1139433_+	hypothetical protein	NA	A0A076G7E6	Sinorhizobium_phage	39.0	6.9e-37
WP_145925657.1|1139456_1139843_+	hypothetical protein	NA	A0A076G7E6	Sinorhizobium_phage	50.0	2.2e-22
WP_070999106.1|1140284_1140545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070999108.1|1140640_1140919_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070999110.1|1140915_1141242_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.7	3.3e-11
WP_083331556.1|1141318_1141948_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	38.9	7.3e-23
WP_070999112.1|1141947_1142271_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	34.6	5.2e-09
WP_070999114.1|1142270_1143227_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	37.0	7.4e-51
WP_070999116.1|1143226_1143868_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	46.0	4.3e-31
WP_083331557.1|1143845_1144076_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	64.1	8.5e-06
WP_070999118.1|1144063_1144324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145925658.1|1144809_1145271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999122.1|1145273_1145651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158513623.1|1145873_1146284_+	thermonuclease family protein	NA	O64020	Bacillus_phage	36.5	2.4e-06
WP_070999523.1|1146488_1147322_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	75.8	1.7e-120
WP_070999125.1|1147603_1147795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999525.1|1148005_1148311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999129.1|1148824_1149370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070996938.1|1149609_1150812_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.4e-43
WP_069714048.1|1151093_1151360_-	hypothetical protein	NA	A0A141GEZ0	Brucella_phage	55.7	1.9e-12
WP_069714049.1|1151343_1151571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070999131.1|1151570_1152119_-	hypothetical protein	NA	R9TQF0	Rhizobium_phage	38.8	1.8e-17
WP_070999134.1|1152138_1152396_-	hypothetical protein	NA	A0A068CH50	Rhizobium_phage	33.0	3.0e-07
WP_070999526.1|1152392_1154006_-|portal	phage portal protein	portal	A0A068CC70	Rhizobium_phage	51.7	4.9e-156
WP_070999136.1|1154002_1156105_-|terminase	phage terminase large subunit family protein	terminase	G8DH41	Emiliania_huxleyi_virus	34.1	6.9e-102
WP_070999137.1|1156101_1156719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070999139.1|1156868_1157441_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	47.9	3.1e-36
WP_070999141.1|1157545_1158385_-	hypothetical protein	NA	R9TRT9	Rhizobium_phage	35.0	2.2e-35
WP_070999143.1|1158732_1160538_-	DNA primase family protein	NA	A0A0A8IN90	Aurantimonas_phage	29.9	2.5e-52
WP_070999146.1|1160534_1161749_-	hypothetical protein	NA	R9TNC4	Rhizobium_phage	46.2	5.4e-91
WP_070999148.1|1161745_1161934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070999150.1|1161930_1163862_-	DNA cytosine methyltransferase	NA	R9TP91	Rhizobium_phage	61.2	3.6e-246
WP_070999152.1|1163858_1164104_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070999154.1|1164100_1164343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070999156.1|1164339_1165566_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	38.4	1.8e-57
WP_070999158.1|1165690_1166194_-	hypothetical protein	NA	A0A068CCD6	Rhizobium_phage	47.2	1.5e-31
WP_070999161.1|1166297_1166855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083331559.1|1166851_1167079_-	helix-turn-helix domain-containing protein	NA	W6MWX8	Pseudomonas_phage	60.0	4.0e-08
WP_173652375.1|1167162_1167855_+	helix-turn-helix domain-containing protein	NA	R9TRS6	Rhizobium_phage	31.9	3.7e-12
WP_145925659.1|1168273_1168846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999167.1|1168922_1169543_+	hypothetical protein	NA	R9TQJ1	Rhizobium_phage	44.7	8.2e-35
WP_173652370.1|1169542_1170034_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	46.2	9.3e-34
WP_070999528.1|1170068_1170425_+	hypothetical protein	NA	A0A0A8ILD6	Aurantimonas_phage	52.7	5.9e-22
WP_070999171.1|1170449_1171406_+	DUF2303 family protein	NA	R9TSA8	Rhizobium_phage	46.3	2.1e-69
WP_070999173.1|1171372_1172527_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	42.6	5.3e-72
WP_070999175.1|1172706_1172913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999177.1|1172902_1173307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999179.1|1173299_1174409_+	phage Gp37/Gp68 family protein	NA	R9TNA8	Rhizobium_phage	60.0	4.7e-126
