The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	826164	883349	5144250	transposase	Stx2-converting_phage(25.0%)	58	NA	NA
WP_068879433.1|826164_827301_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001546883.1|829548_830535_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_068879435.1|830584_831763_+	O15 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_066009094.1|832841_833945_+	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000734414.1|833944_835075_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	47.8	6.3e-102
WP_000761611.1|835074_836286_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001236679.1|836272_836671_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_000043483.1|836788_838195_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000704860.1|838442_839609_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_001389124.1|839754_840732_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_066009098.1|840827_841439_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880192.1|841432_842209_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000586449.1|842190_842928_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_001103560.1|842927_843518_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_000080136.1|843517_844585_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_000108941.1|844584_845655_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_001743908.1|845657_846956_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_000131782.1|846961_847861_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_001364200.1|848006_848057_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_001259255.1|848339_848591_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_000767829.1|848587_848842_+	type II toxin-antitoxin system mRNA interferase toxin YoeB	NA	NA	NA	NA	NA
WP_000754762.1|848924_849749_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000803360.1|849794_850724_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010723108.1|850938_851001_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|850990_852349_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_000492305.1|852527_853586_+	transport protein YeeE	NA	NA	NA	NA	NA
WP_000985273.1|853599_853827_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000980601.1|853869_855297_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_000830155.1|855505_856672_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
WP_001105412.1|856790_857264_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200891.1|857462_858521_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|858692_859022_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001667686.1|859122_859305_-	ethanolamine utilization - propanediol utilization family protein	NA	NA	NA	NA	NA
WP_072170041.1|859578_860361_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_000255946.1|860357_861380_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_068879436.1|862924_864466_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.1	5.4e-128
WP_001161660.1|865490_865604_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000976829.1|865616_865823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854765.1|865819_866194_-	toxin	NA	NA	NA	NA	NA
WP_001360327.1|866283_866652_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_023356553.1|866814_867036_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
WP_001186774.1|867098_867575_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|867590_868064_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001339397.1|868447_869125_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|869124_869472_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|869491_871063_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_171844372.1|870983_871835_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.6	3.6e-41
WP_001323397.1|871989_872148_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_068879437.1|872218_875065_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_068879438.1|875436_876309_-	GTPase family protein	NA	NA	NA	NA	NA
WP_054623649.1|876393_877311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|878142_878340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813436.1|878510_879113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|879207_879486_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840364.1|879554_879821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344112.1|880121_880298_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_102384962.1|880849_882078_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_171844373.1|882153_883349_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.5	5.6e-165
>prophage 2
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	1614791	1686458	5144250	head,portal,transposase,protease,capsid,holin,tail,terminase	Escherichia_phage(32.84%)	93	NA	NA
WP_000422045.1|1614791_1615841_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|1616060_1616819_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_001278906.1|1616815_1617406_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|1617445_1618321_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_066009307.1|1618531_1620427_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|1620454_1621075_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1621071_1621953_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1622090_1622135_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194582.1|1622225_1623788_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1623787_1625383_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983871.1|1625383_1626745_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_066009309.1|1626756_1627950_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1627949_1628756_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1629136_1629316_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|1629401_1629902_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079505.1|1629947_1630454_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|1630942_1631113_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|1631227_1631497_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_134388450.1|1631553_1632222_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|1632420_1632603_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_068879450.1|1632830_1633616_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	77.4	2.8e-109
WP_066009305.1|1633617_1634145_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	3.4e-90
WP_066009303.1|1634173_1634707_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	86.4	6.9e-83
WP_077884781.1|1634709_1637514_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q858V4	Yersinia_virus	62.8	4.4e-03
WP_032230005.1|1637665_1638265_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_066009239.1|1638332_1641806_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_122999438.1|1642046_1642679_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.6	1.0e-101
WP_021565969.1|1642624_1643368_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	3.3e-147
WP_001375867.1|1643378_1644077_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	4.2e-128
WP_000807924.1|1644076_1644418_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_021520064.1|1644410_1647653_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001513217.1|1647700_1647910_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|1648005_1648380_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|1648394_1649111_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|1649175_1649520_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573362.1|1649516_1649963_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007905.1|1649959_1650310_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1650319_1650646_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_032167421.1|1650642_1653228_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_001063099.1|1653173_1653395_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|1653439_1655377_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001339613.1|1655439_1657101_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000958372.1|1657097_1657661_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000829185.1|1657950_1658316_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|1658357_1658558_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736383.1|1658756_1658981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1659066_1659252_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|1659473_1659560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992067.1|1660114_1660648_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.1e-99
WP_000369850.1|1660753_1661026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|1660991_1661336_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|1661340_1661556_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_032167420.1|1661706_1663560_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	94.3	0.0e+00
WP_000871291.1|1663820_1664156_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001333559.1|1664226_1664439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|1664927_1665014_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000935516.1|1665311_1666361_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.0	2.3e-199
WP_000917767.1|1666511_1666709_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000762880.1|1666935_1667757_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904114.1|1667753_1668128_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265091.1|1668140_1669187_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_001403449.1|1669188_1669461_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_000687431.1|1669520_1669694_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_000401168.1|1669851_1670955_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004956.1|1670935_1671586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1671751_1671964_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000350274.1|1672198_1672432_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_102384962.1|1672472_1673701_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000207997.1|1673875_1674043_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224216.1|1674053_1674317_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_001142588.1|1674318_1674537_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000510387.1|1674538_1674754_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001289989.1|1674754_1675114_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000753053.1|1675110_1675287_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001224665.1|1675279_1675462_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000403782.1|1675557_1675914_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_001209470.1|1675891_1676353_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	1.3e-37
WP_001266130.1|1676349_1676646_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|1676642_1677035_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450705.1|1677050_1677821_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	9.7e-86
WP_001309414.1|1677854_1678397_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_066009535.1|1678308_1679349_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_000702041.1|1679420_1679846_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053425.1|1679829_1680105_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000753626.1|1680212_1680674_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_000379612.1|1680927_1681083_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171958.1|1681242_1681461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586951.1|1681483_1681804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|1681781_1682219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586950.1|1682632_1683487_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000450218.1|1683497_1683686_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093951.1|1683682_1683886_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021533631.1|1683965_1686458_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
>prophage 3
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	1910997	1951035	5144250	integrase,transposase	Enterobacteria_phage(36.36%)	34	1909948:1909966	1951372:1951390
1909948:1909966	attL	AATCCCCCCCTCACCGCCA	NA	NA	NA	NA
WP_001735705.1|1910997_1912497_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_000065240.1|1912493_1913249_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_044704957.1|1913404_1913893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066009386.1|1913889_1914267_-	toxin	NA	NA	NA	NA	NA
WP_001280955.1|1914313_1914688_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001220314.1|1914850_1915072_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186192.1|1915134_1915611_-	RadC family protein	NA	NA	NA	NA	NA
WP_023910464.1|1915626_1916112_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	4.4e-12
WP_001234682.1|1916202_1917021_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_053886242.1|1917360_1918431_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203541.1|1918427_1919333_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_066008961.1|1919329_1921714_-	dynamin family protein	NA	NA	NA	NA	NA
WP_068879452.1|1921931_1922804_-	GTPase family protein	NA	NA	NA	NA	NA
WP_023910471.1|1923134_1923317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053886252.1|1923616_1924042_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	1.3e-47
WP_031326669.1|1925857_1926238_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157922190.1|1926236_1926644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066009555.1|1926966_1927473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000527471.1|1927670_1927844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539577.1|1928215_1928659_-	Dr fimbrial tip invasin DraD	NA	NA	NA	NA	NA
WP_001330421.1|1931297_1932095_-	Dr fimbrial biogenesis chaperone DraB	NA	NA	NA	NA	NA
WP_001209230.1|1932434_1932740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066008899.1|1933590_1934763_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.2	1.0e-227
WP_000544830.1|1934762_1935560_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
WP_000700580.1|1935793_1936021_+	F1845 fimbrial adhesin operon transcriptional regulator DaaF	NA	NA	NA	NA	NA
WP_053886233.1|1936305_1937214_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.1	2.7e-55
WP_066008901.1|1938032_1940120_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	3.4e-08
WP_000555380.1|1940697_1941831_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053886234.1|1942690_1943269_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_088895425.1|1944194_1945422_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_066009346.1|1945923_1947759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070931.1|1947859_1948147_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_077820283.1|1948118_1949648_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000279860.1|1949817_1951035_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
1951372:1951390	attR	AATCCCCCCCTCACCGCCA	NA	NA	NA	NA
>prophage 4
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	2108359	2186071	5144250	transposase,tRNA	Stx2-converting_phage(30.0%)	51	NA	NA
WP_000886683.1|2108359_2109652_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2109742_2111086_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2111096_2111708_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|2111866_2115856_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2115990_2116485_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2117029_2117995_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043600.1|2118117_2119884_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202175.1|2119884_2121606_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|2121647_2122352_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2122636_2122855_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_068879455.1|2123346_2124189_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839256.1|2124273_2124471_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054233.1|2124487_2124976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|2124972_2125356_-	toxin	NA	NA	NA	NA	NA
WP_001285602.1|2125436_2125817_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086768.1|2125827_2126511_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.1	9.0e-27
WP_000692298.1|2126529_2126751_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_021543704.1|2126813_2127290_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214307.1|2127305_2127791_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_068879456.1|2127882_2128701_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.6e-44
WP_001119727.1|2128801_2129035_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000581502.1|2129113_2129569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068879457.1|2129644_2132161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068879458.1|2132281_2135128_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001397970.1|2135499_2136372_-	GTPase family protein	NA	NA	NA	NA	NA
WP_032171640.1|2136587_2137532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154670580.1|2137994_2138249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001431807.1|2138530_2138770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985465.1|2138809_2141248_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.4	1.9e-74
WP_000312833.1|2142593_2143250_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000634203.1|2143246_2144314_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	39.2	1.4e-18
WP_000108735.1|2144332_2147428_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.2	3.9e-53
WP_001122107.1|2147427_2148144_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001339397.1|2148722_2149400_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2149399_2149747_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2149766_2151338_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_021543690.1|2152944_2153292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126722400.1|2153817_2154270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066009371.1|2154440_2154875_-	adhesin	NA	NA	NA	NA	NA
WP_077884783.1|2154890_2155856_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_102384962.1|2155840_2157069_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_077884989.1|2157144_2158821_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_032145366.1|2158851_2159610_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_171844374.1|2166218_2166359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068879459.1|2167399_2168053_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000624622.1|2174182_2174530_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2174549_2176121_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_068879460.1|2180396_2181530_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021523955.1|2182409_2183207_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_048206690.1|2184792_2184999_-|transposase	transposase domain-containing protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.0	1.6e-11
WP_066008841.1|2185099_2186071_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	2209292	2251780	5144250	integrase,transposase,protease	Stx2-converting_phage(33.33%)	28	2228480:2228495	2253352:2253367
WP_000483766.1|2209292_2210639_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001505166.1|2210994_2211207_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001254932.1|2212879_2214031_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001171554.1|2214125_2214506_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2214502_2214850_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_068879466.1|2214899_2216438_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	95.5	3.2e-282
WP_068879467.1|2217380_2218394_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|2218405_2219722_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2219749_2220670_-	ribokinase	NA	NA	NA	NA	NA
WP_102384962.1|2222566_2223794_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001411495.1|2224000_2224138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072197.1|2225504_2226329_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_000195940.1|2226511_2226916_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000192271.1|2227029_2228601_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
2228480:2228495	attL	ATCAGCAGGCGCTGAA	NA	NA	NA	NA
WP_000459228.1|2228612_2229788_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_066009464.1|2229801_2231691_+	enterotoxin	NA	NA	NA	NA	NA
WP_024167628.1|2231859_2232066_-	methyltransferase	NA	NA	NA	NA	NA
WP_000622487.1|2232170_2233607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061088962.1|2233603_2238562_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000282077.1|2239224_2239788_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_102384962.1|2240506_2241735_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000335702.1|2241944_2243378_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|2243596_2243794_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2244020_2244317_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|2245428_2247246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|2247432_2248635_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000934041.1|2249152_2251429_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2251459_2251780_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
2253352:2253367	attR	TTCAGCGCCTGCTGAT	NA	NA	NA	NA
>prophage 6
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	2587398	2644846	5144250	lysis,head,portal,transposase,protease,capsid,integrase,tail,tRNA	Enterobacteria_phage(32.0%)	61	2586930:2586976	2634655:2634701
2586930:2586976	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2587398_2588352_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226382.1|2588538_2590023_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029237390.1|2590569_2591229_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000355612.1|2591422_2591716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235966.1|2591726_2592431_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654154.1|2592440_2592722_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_071836836.1|2592718_2595115_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_021562711.1|2595179_2595779_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_066009275.1|2595848_2599262_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000090892.1|2599321_2599954_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_021572741.1|2599890_2600634_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.6e-148
WP_001152612.1|2600639_2601338_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847401.1|2601337_2601667_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001571447.1|2604218_2604653_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.0e-63
WP_001552795.1|2604634_2605057_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	4.2e-59
WP_000381395.1|2605769_2607341_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2607360_2607708_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2607707_2608385_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000683128.1|2608527_2608923_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|2608919_2609498_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000753006.1|2609509_2609863_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_074152574.1|2609874_2610273_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	1.2e-60
WP_000063265.1|2610314_2611340_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001345004.1|2611395_2611728_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_066009462.1|2611737_2613057_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_066009460.1|2613037_2614639_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
WP_000198149.1|2614635_2614842_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453576.1|2616739_2617285_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001307652.1|2617673_2617868_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738421.1|2618228_2618522_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|2618612_2618795_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|2619011_2619509_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|2619508_2619724_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2620312_2621395_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_066008985.1|2621583_2621967_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	5.7e-55
WP_001547120.1|2621984_2622974_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.3	6.4e-191
WP_001061408.1|2622981_2623779_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001547119.1|2623798_2624188_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.3e-67
WP_000210176.1|2624184_2624511_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001573323.1|2624510_2625005_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_066008989.1|2625001_2625943_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	3.6e-151
WP_001250269.1|2625932_2626112_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515828.1|2626287_2626839_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_001535859.1|2626867_2627131_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	4.2e-09
WP_001535858.1|2627237_2627942_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	59.9	3.4e-69
WP_000357060.1|2629711_2630215_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_000135682.1|2630676_2631039_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001547115.1|2631104_2631929_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_001547114.1|2632056_2632593_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	1.4e-99
WP_001242707.1|2632583_2632946_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206813.1|2632945_2633251_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001298992.1|2633477_2634641_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|2634975_2635608_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2634655:2634701	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_066008993.1|2635610_2636126_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001350487.1|2636136_2637177_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988364.1|2639790_2640483_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2640702_2641245_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|2641715_2642582_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2642583_2642796_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143542.1|2642903_2643425_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912385.1|2643460_2644846_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
>prophage 7
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	2933192	2999469	5144250	integrase,plate,transposase	Enterobacteria_phage(18.18%)	56	2952604:2952619	2983481:2983496
WP_102384962.1|2933192_2934421_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001335904.1|2934755_2935547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072146520.1|2936619_2936769_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001099653.1|2937000_2937600_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_021534030.1|2937971_2938355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013303.1|2938351_2938777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|2940909_2942418_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000597528.1|2943583_2943934_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000057773.1|2943946_2945539_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_024176379.1|2945638_2946595_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001178466.1|2946844_2948398_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.9e-19
WP_000911138.1|2948391_2949438_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000197460.1|2949437_2950436_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000155278.1|2950462_2951485_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774153.1|2951513_2952389_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558519.1|2952437_2952728_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
2952604:2952619	attL	ATAAAGATGAAGCCGC	NA	NA	NA	NA
WP_001081495.1|2952738_2953482_+	epimerase	NA	NA	NA	NA	NA
WP_001333700.1|2953856_2954114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132880.1|2957787_2959494_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001087767.1|2959486_2960695_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000772656.1|2960936_2962145_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
WP_000893278.1|2962498_2963752_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|2963763_2964867_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|2965154_2966210_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_000174677.1|2966248_2966650_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|2966707_2967952_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|2968043_2968502_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|2968762_2970220_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001352051.1|2970276_2970834_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|2970745_2971012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|2971317_2971770_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263488.1|2971779_2972178_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|2972180_2972474_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|2972525_2973581_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207552.1|2973651_2974437_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|2974381_2976121_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|2976344_2976842_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|2977017_2977767_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|2977976_2978237_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|2978239_2978518_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2978673_2979414_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2979384_2980152_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2980357_2980936_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_066009639.1|2981175_2983620_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
2983481:2983496	attR	ATAAAGATGAAGCCGC	NA	NA	NA	NA
WP_000532698.1|2983662_2984136_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|2984289_2985060_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_068879476.1|2985100_2986237_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000008098.1|2986667_2986844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024198219.1|2986827_2987061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066008979.1|2987038_2991271_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_000103354.1|2991346_2993488_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|2993697_2994216_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|2994910_2995411_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|2995445_2995670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611744.1|2997201_2997615_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|2997618_2999469_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 8
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	3136051	3149225	5144250		Escherichia_phage(50.0%)	12	NA	NA
WP_068879478.1|3136051_3138613_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.7e-30
WP_001141322.1|3138718_3139375_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3139425_3140193_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3140388_3141297_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3141293_3142556_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3142552_3143191_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3143195_3143972_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3144060_3145425_+	GntP family transporter	NA	NA	NA	NA	NA
WP_066009455.1|3145494_3146502_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.2e-32
WP_001272592.1|3146564_3147704_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3147843_3148470_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3148463_3149225_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 9
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	3373749	3424160	5144250	integrase,transposase,protease	Enterobacteria_phage(50.0%)	46	3385177:3385192	3419628:3419643
WP_001309720.1|3373749_3374508_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000442530.1|3374593_3376156_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_000105566.1|3376305_3377226_-	agmatinase	NA	NA	NA	NA	NA
WP_000715527.1|3377361_3378093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3378238_3380215_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3380223_3380355_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3380490_3380706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3381009_3382164_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3382600_3383995_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3384071_3384569_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3384663_3385371_+	deoxyribonuclease I	NA	NA	NA	NA	NA
3385177:3385192	attL	ATTGCGCGCACCTACT	NA	NA	NA	NA
WP_001222509.1|3385450_3386182_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3386194_3387145_+	glutathione synthase	NA	NA	NA	NA	NA
WP_024174106.1|3387253_3387817_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3387816_3388233_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001305834.1|3388347_3389328_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3389345_3390050_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3390067_3390634_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3390630_3390921_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3390928_3391522_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239947.1|3391514_3392651_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|3392963_3393950_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021542650.1|3393994_3394498_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_066009196.1|3394497_3395799_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745254.1|3395854_3396862_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_066009197.1|3396978_3398025_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984795.1|3398200_3398920_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001178592.1|3398940_3399081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107564.1|3399103_3399430_-	YggL family protein	NA	NA	NA	NA	NA
WP_001309725.1|3400310_3401363_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3401390_3401666_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3401730_3402810_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3403011_3404268_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839789.1|3404316_3406452_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|3406844_3407552_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001522333.1|3407909_3409088_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	1.3e-121
WP_171844375.1|3410301_3412986_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.3	9.7e-258
WP_113328817.1|3413166_3414198_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001522329.1|3415460_3415943_-	Dr family adhesin structural subunit	NA	NA	NA	NA	NA
WP_066009557.1|3416144_3416318_-	DraP	NA	NA	NA	NA	NA
WP_001522328.1|3416696_3417140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522323.1|3419778_3420576_-	Dr fimbrial biogenesis chaperone DraB	NA	NA	NA	NA	NA
3419628:3419643	attR	AGTAGGTGCGCGCAAT	NA	NA	NA	NA
WP_001522322.1|3420829_3421135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068879479.1|3421935_3422193_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001522318.1|3422631_3422874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171844376.1|3422947_3424160_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
>prophage 10
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	4826541	4890778	5144250	integrase,transposase,tRNA,protease	Shigella_phage(14.29%)	58	4820997:4821013	4899895:4899911
4820997:4821013	attL	AAGCATCTCCGATGGTT	NA	NA	NA	NA
WP_102384962.1|4826541_4827769_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_102384962.1|4828164_4829393_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001218773.1|4830458_4831724_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
WP_001188520.1|4832103_4832679_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068922.1|4832715_4834413_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|4834388_4834727_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4834842_4836144_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|4836261_4837698_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4838034_4838511_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|4838526_4839783_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4840058_4840352_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4840395_4842042_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4842179_4842533_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008040.1|4842735_4843605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940549.1|4843999_4845028_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|4845069_4845636_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4845687_4845813_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4845923_4846070_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|4846245_4846563_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|4846559_4847093_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001336292.1|4847181_4848315_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|4848377_4848737_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|4848747_4849143_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4849153_4849888_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192973.1|4849880_4851689_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|4852013_4852991_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001336293.1|4853209_4854712_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|4854763_4855078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|4855074_4855389_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236847.1|4855417_4858741_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|4858762_4859731_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041964.1|4859827_4860880_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4860974_4861520_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|4862262_4862316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|4862298_4863438_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|4863436_4864984_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4864955_4865417_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990333.1|4865435_4866773_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_066009563.1|4866782_4868624_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	1.1e-58
WP_001280345.1|4868616_4869567_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4869652_4869961_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4870036_4871317_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4871402_4872662_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4872664_4873669_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4873750_4873948_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_033549920.1|4874051_4875350_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4875554_4875980_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|4876018_4878460_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001293282.1|4878639_4879371_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000400400.1|4879447_4880227_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000842401.1|4880555_4881449_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001284215.1|4881499_4882801_+	MFS transporter	NA	NA	NA	NA	NA
WP_001424054.1|4882834_4884430_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_000012563.1|4885787_4886447_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4886464_4886863_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000944017.1|4887513_4888677_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	4.1e-80
WP_000558727.1|4888760_4890386_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4890502_4890778_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
4899895:4899911	attR	AAGCATCTCCGATGGTT	NA	NA	NA	NA
>prophage 11
NZ_LT601384	Escherichia coli isolate NCTC86EC chromosome I	5144250	4953387	5029151	5144250	integrase,transposase,tRNA,holin	Enterobacteria_phage(14.29%)	57	4946335:4946350	5003201:5003216
4946335:4946350	attL	CGGGCGGCTTCAACAG	NA	NA	NA	NA
WP_000416392.1|4953387_4956243_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|4956242_4956686_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4957039_4958551_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4958817_4959918_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001422763.1|4959917_4961000_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_032230423.1|4961118_4962621_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	3.6e-84
WP_066009171.1|4962698_4963697_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_066009173.1|4963763_4965083_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4965147_4965912_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001422766.1|4965935_4966967_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896741.1|4967182_4967746_+	gluconokinase	NA	NA	NA	NA	NA
WP_000061766.1|4967749_4968769_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_000142490.1|4969198_4970125_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001223819.1|4970114_4971734_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001082109.1|4972036_4972948_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.6	5.5e-48
WP_001143292.1|4973033_4973327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202280.1|4973694_4974567_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000886597.1|4974811_4976635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000236931.1|4976627_4979597_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	32.9	7.3e-81
WP_000643690.1|4979690_4980887_-	DNA cytosine methyltransferase	NA	A0A191SAU1	Nostoc_phage	30.8	2.2e-36
WP_125079971.1|4981159_4981684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000950585.1|4981693_4982731_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068879494.1|4982714_4983383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099275.1|4984257_4984554_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001104341.1|4985183_4986260_+	Fic family protein	NA	NA	NA	NA	NA
WP_001825864.1|4986310_4986940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114712.1|4987850_4988675_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066009509.1|4988840_4990397_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000859648.1|4990396_4991086_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001215043.1|4991197_4991362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066009507.1|4993331_4994363_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.3e-18
WP_000916805.1|4994633_4995077_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|4995092_4995380_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|4995392_4996649_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|4996895_4997150_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|4997571_4998585_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000350265.1|4999939_5000860_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|5001165_5001948_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171844377.1|5002800_5004029_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	4.1e-171
5003201:5003216	attR	CTGTTGAAGCCGCCCG	NA	NA	NA	NA
WP_001422798.1|5004482_5004611_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|5004791_5005448_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000625669.1|5005693_5006971_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|5007033_5009031_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001300030.1|5011526_5012477_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_001825888.1|5012481_5013570_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_160371899.1|5013572_5014415_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000177057.1|5015879_5016137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175459.1|5016694_5017462_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	4.9e-13
WP_000684856.1|5017462_5018419_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|5018415_5019414_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|5019410_5020313_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188260.1|5020357_5022682_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068914.1|5022768_5023722_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|5023718_5024240_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|5025160_5025418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|5026168_5027527_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|5027765_5029151_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
